The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	696647	746828	2590611	head,transposase,tail,terminase,integrase,plate	Mannheimia_phage(79.17%)	61	745647:745706	751731:752146
WP_147009073.1|696647_697688_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|697811_698372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698352_700284_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700426_700609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700758_701799_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701798_702272_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702261_703470_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703732_704965_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|705031_706018_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|706058_706469_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706534_707845_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708259_708979_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|709155_709434_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711360_712242_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712252_712501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712510_712831_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712833_713025_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|713037_713655_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713973_714186_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714191_714374_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714396_714972_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714984_715353_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715594_716149_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|716132_716555_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716910_717510_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717520_717727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717819_718710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718837_719269_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719354_719888_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719890_720133_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|720129_720489_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720651_720909_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720908_721163_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|721170_721671_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721820_723446_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723514_725188_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|725174_726464_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726611_727028_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|727024_727243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727286_728354_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|728353_729271_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|729316_729634_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729633_730059_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|730055_730697_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730697_730877_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730876_732286_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732296_732671_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732670_733039_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|733068_733257_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733309_735589_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735588_736881_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736883_738011_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|738012_738663_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738771_739122_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|739134_740196_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740195_740762_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740762_743489_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743489_744113_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|744105_744570_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744690_745479_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745647:745706	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|746063_746828_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|746063_746828_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751731:752146	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	999508	1006293	2590611		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999508_1000291_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000300_1001029_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1001164_1002184_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1002185_1002788_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002916_1003072_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1003149_1003731_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003745_1004393_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004496_1005126_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005240_1006293_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	1316042	1393530	2590611	head,capsid,holin,transposase,tail,terminase,tRNA,integrase,portal,plate	Mannheimia_phage(85.0%)	84	1318459:1318475	1361928:1361944
WP_006252789.1|1316042_1318430_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1318459:1318475	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1318477_1319464_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1319692_1320352_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1321836_1322589_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1322588_1323488_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1323496_1324060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1324059_1324836_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1324935_1325331_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1325347_1325776_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1326074_1326470_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1326630_1328202_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1328218_1328530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1328651_1329323_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1329443_1330907_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1331134_1334302_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1334315_1335521_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1335551_1336124_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1336362_1336584_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1336588_1338322_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1339033_1339414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1339455_1343916_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1344091_1344808_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1344856_1346200_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1346457_1347345_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1347480_1347666_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1347755_1350383_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1350577_1351003_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1351233_1352007_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1352150_1352942_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1352994_1353291_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1353315_1353594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1353753_1355730_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1355821_1356634_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006252804.1|1356998_1357997_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	100.0	3.1e-185
WP_006248154.1|1358274_1358457_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_134916677.1|1358585_1359626_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.1	6.1e-200
WP_075271718.1|1359723_1360215_-	methyltransferase	NA	A0A0M3LQB3	Mannheimia_phage	100.0	1.2e-97
WP_006252806.1|1360214_1360505_-	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	100.0	5.5e-50
WP_006252807.1|1360479_1360749_-	hypothetical protein	NA	A0A0M3LPF0	Mannheimia_phage	100.0	1.1e-44
WP_006252809.1|1361081_1361525_-	single-stranded DNA-binding protein	NA	A0A0M3LP18	Mannheimia_phage	100.0	1.5e-75
WP_006250958.1|1361524_1361851_-	hypothetical protein	NA	A0A0M3LSB5	Mannheimia_phage	100.0	3.4e-56
WP_075271719.1|1361835_1364196_-	replication endonuclease	NA	A0A0M3LSC6	Mannheimia_phage	100.0	0.0e+00
1361928:1361944	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1364192_1364525_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1364521_1364764_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1364914_1365208_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1365216_1365549_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1365631_1365904_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1366043_1366289_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1366387_1366600_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1366723_1367410_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1367413_1367932_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1367949_1368360_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1368471_1369512_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888665.1|1369571_1369946_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1369945_1371187_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1371186_1371624_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1371623_1372010_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1372070_1372211_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1372210_1372525_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1372605_1373112_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1373120_1374302_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1374403_1374667_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1374635_1375271_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_147010270.1|1375271_1378286_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	100.0	0.0e+00
WP_061888620.1|1378288_1378828_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1378814_1379732_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1379728_1380064_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1380063_1380669_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1380797_1381085_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_075271747.1|1381318_1384231_-|tail	phage tail protein	tail	A0A0M3LS92	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1384269_1384548_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1384598_1385057_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1385049_1385535_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_075271746.1|1385531_1385753_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LQ09	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1385901_1386357_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1386353_1386920_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1386912_1387119_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1387124_1387337_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006252832.1|1387333_1387849_-|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1387960_1388650_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1388659_1389688_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006248198.1|1389701_1390529_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1390642_1392481_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_040081096.1|1392489_1393530_+|portal	phage portal protein	portal	A0A0M3LQ03	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	1425580	1481325	2590611	head,holin,integrase,terminase	Mannheimia_phage(46.55%)	74	1428155:1428174	1481477:1481496
WP_006252023.1|1425580_1426045_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1426037_1426661_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009275.1|1426661_1429601_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.6	0.0e+00
1428155:1428174	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1429673_1430294_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1430290_1431487_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1431483_1431834_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1431837_1432500_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1432489_1433377_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1433376_1433673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1433675_1434383_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1434617_1435514_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1435798_1435978_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1436129_1436801_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1436823_1437486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1437485_1440155_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1440327_1440732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1440799_1441321_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1441455_1441899_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1441956_1443435_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1443450_1443957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1443941_1444322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1444329_1445034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1445036_1445642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1445638_1446070_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1446072_1446447_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1446516_1447647_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1447658_1448168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1448179_1449436_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1449432_1450623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1450675_1451506_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1451480_1452992_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1453059_1454439_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1454441_1454939_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1455139_1455319_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1455328_1455478_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1455506_1455857_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1455857_1456454_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1456468_1456912_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1456963_1457437_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_032844502.1|1457426_1457996_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	82.5	3.1e-81
WP_032844503.1|1458186_1458492_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	56.0	1.8e-19
WP_032844505.1|1458502_1458823_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	58.9	1.5e-24
WP_032844506.1|1459123_1459654_+	antirepressor	NA	D0UIM5	Aggregatibacter_phage	50.3	3.5e-42
WP_032844507.1|1459809_1460238_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	7.8e-37
WP_006252693.1|1460224_1460437_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	86.8	5.8e-33
WP_006250086.1|1460527_1461064_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_032844508.1|1461060_1461708_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	95.3	9.2e-114
WP_032844512.1|1461707_1461992_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	95.7	4.2e-47
WP_006252350.1|1462489_1463329_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1463391_1463835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1463883_1464078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1464174_1464834_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1464833_1465673_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1465689_1466517_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252943.1|1466547_1467375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252944.1|1467533_1467830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252945.1|1468293_1468545_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	81.5	1.6e-29
WP_006248787.1|1468547_1468823_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1469500_1470016_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_147010271.1|1470335_1471031_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	59.3	1.6e-47
WP_020824128.1|1471137_1471644_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006250254.1|1471647_1472007_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|1472003_1472483_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1472616_1472829_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1472841_1473765_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1473757_1474420_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|1474460_1475306_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|1475333_1475786_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_147010273.1|1475830_1476334_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	99.4	1.1e-82
WP_061888593.1|1477028_1477865_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1478250_1479093_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1479608_1479992_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1480041_1480263_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1480284_1481325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1481477:1481496	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	1634617	1683990	2590611	tRNA,transposase,protease	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1634617_1635658_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1635983_1636382_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1636468_1639195_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1639253_1639574_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1639694_1639997_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1640021_1640396_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1640752_1641064_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1641155_1641743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1642068_1642359_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1642418_1643150_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1643149_1643710_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1643709_1644135_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1644181_1645234_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1645618_1646986_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1647029_1647698_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1649785_1650703_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1650699_1651047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1651719_1652370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1652359_1652698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1653394_1653598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1653609_1653858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1654292_1654478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1655037_1655256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1655859_1657056_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1657162_1658137_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1658204_1658912_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1658956_1660408_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1660522_1661383_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1661889_1663188_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1663361_1664249_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1664251_1665475_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1665665_1666316_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1666372_1666702_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1667868_1670436_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1670376_1670559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251668.1|1670649_1671792_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_006251672.1|1673396_1674296_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1674309_1675212_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1675208_1675565_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1675634_1676240_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1676313_1678221_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1678529_1679708_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1679786_1680827_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1681042_1681465_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1682949_1683990_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	1925369	1968081	2590611	holin,transposase,protease,tail,terminase,portal,integrase	Mannheimia_phage(57.78%)	60	1926483:1926498	1966696:1966711
WP_020824044.1|1925369_1926410_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
1926483:1926498	attL	AAACGTTCCGAAAAAA	NA	NA	NA	NA
WP_006247812.1|1926679_1926973_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|1927116_1927506_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1927477_1927777_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|1927849_1928890_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824196.1|1930094_1930685_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_020824197.1|1930953_1931685_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1931688_1932405_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1932404_1932734_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1932733_1936285_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1936338_1936566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1936628_1936859_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1936903_1937305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1937387_1938029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1938056_1938449_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1938445_1938970_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1938973_1939276_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1939268_1939592_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1939844_1941806_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1942209_1943406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1943409_1944921_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1944920_1945145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1945141_1947253_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1947252_1947732_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1948001_1948151_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1948200_1948530_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1948530_1949124_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1949113_1949458_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1949805_1949991_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1950499_1950694_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1950661_1951102_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1951091_1951451_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1951443_1952472_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1952598_1953192_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1953202_1954249_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1954245_1955085_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1955260_1955521_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1955541_1955742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1955872_1956556_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1956630_1957011_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1957003_1957501_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1957631_1957814_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1957852_1958272_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1958338_1958644_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1958652_1958928_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1959217_1959448_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1959926_1960250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1960442_1960628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1960781_1961240_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1961275_1961635_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1961706_1962510_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1962561_1962996_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1963005_1963494_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|1963514_1963724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1963870_1963996_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|1964042_1964885_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|1964947_1965331_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|1965380_1965656_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|1965615_1966671_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|1966818_1968081_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
1966696:1966711	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017508	Mannheimia haemolytica strain 28240 chromosome, complete genome	2590611	2233554	2335476	2590611	holin,transposase,tail,terminase,tRNA,integrase	Mannheimia_phage(86.59%)	121	2273588:2273604	2333261:2333277
WP_020824044.1|2233554_2234595_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2234714_2234945_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2235131_2235809_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2236002_2236275_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2236283_2236409_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2236588_2237362_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2237444_2238161_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2238170_2238923_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2239138_2239672_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2239580_2239802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2239777_2240119_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2240142_2240892_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2240901_2241852_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2241997_2243017_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2243097_2243853_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2243839_2244484_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2244487_2244709_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2244819_2246457_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2246530_2247496_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2247668_2248316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2248506_2249295_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2249591_2250545_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2251320_2254878_+	collagen-like protein	NA	NA	NA	NA	NA
WP_147010288.1|2254912_2255953_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	1.5e-198
WP_006252223.1|2256191_2257934_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2258149_2258407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2258913_2259144_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2260064_2260403_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2260660_2262559_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2262700_2263003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2263168_2264308_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2264595_2266104_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2266166_2266388_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2266409_2266856_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2266840_2267437_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2267545_2268880_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2268990_2270139_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2270268_2270616_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2270615_2271473_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2271581_2272544_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2273588:2273604	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2273653_2274151_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2274198_2275560_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2275751_2276303_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2277211_2278276_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2278460_2279120_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2279255_2280173_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2280386_2281265_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2281330_2281921_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2282051_2282894_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2283178_2283472_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2283587_2284187_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2284187_2284631_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2290497_2291088_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2291356_2292088_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2292091_2292808_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2292815_2293262_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2293283_2293613_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2293616_2296112_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2296198_2296594_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2296661_2297120_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2297288_2297522_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2297536_2298208_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2298304_2298481_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2298536_2298953_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2298992_2299475_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2299478_2299859_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2299855_2300224_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2300225_2300570_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2300569_2300947_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_020828758.1|2300949_2301246_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	4.2e-21
WP_062627922.1|2301257_2302244_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2302258_2302693_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2302685_2304056_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2304042_2304981_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2304934_2306311_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2306307_2307528_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2307511_2308036_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2308402_2308660_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2308660_2308801_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2308829_2309180_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2309180_2309774_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2309763_2310108_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2310226_2310805_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2311321_2311516_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2311483_2311849_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2311838_2312207_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2312203_2312488_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2312864_2313077_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2313126_2313579_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2313697_2314270_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2314266_2314914_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2314913_2315198_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2315683_2315926_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2316082_2316316_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2316444_2317131_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2317144_2317525_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2317517_2318015_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2318596_2318866_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2318843_2319116_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2319783_2320290_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2320293_2320653_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2320649_2321129_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2321262_2321475_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2321487_2322411_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2322403_2323066_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2323106_2323952_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2323979_2324432_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2324476_2324968_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2324964_2325168_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2325151_2325616_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2325619_2325808_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2325939_2326317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2326546_2327386_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2327633_2328311_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2328544_2329450_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2330686_2331283_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2331260_2331767_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2331856_2332132_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2332091_2333147_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2333398_2334352_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2333261:2333277	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824074.1|2334435_2335476_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
