The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	44517	52025	2646006	tail,transposase	Mannheimia_phage(81.82%)	11	NA	NA
WP_095578351.1|44517_44712_-	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	94.1	1.9e-06
WP_006248673.1|44698_44941_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44941_47002_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|46998_47556_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47504_48500_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48552_48741_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48770_49139_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49138_49513_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|50002_50806_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50850_51129_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51305_52025_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	574308	658292	2646006	tail,protease,plate,tRNA,head,transposase	Mannheimia_phage(17.02%)	92	NA	NA
WP_006249683.1|574308_574986_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|575199_575418_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|575427_577398_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|577577_578066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|578097_579039_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|579041_579356_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|579367_579604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|579587_579881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|580002_580221_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|580230_580413_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|580429_580819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|580867_581155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|581273_581819_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|581805_582339_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|582503_582863_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|582998_583508_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|583510_583780_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|583773_584121_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|584299_584635_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|584636_584933_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|584955_585528_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|585527_587084_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|587202_588657_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|588649_589927_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|590128_590473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|590536_591001_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|591235_592351_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|592381_593308_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|593376_593658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|593657_594092_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|594097_594595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|594679_596065_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|596075_596591_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|596686_597001_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|596997_597150_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|597128_597431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249645.1|597478_600136_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|600145_601069_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_147008889.1|601052_601280_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	47.8	5.5e-13
WP_006249642.1|601272_602337_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|602323_602860_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|602914_603277_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|603286_604390_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|604382_604949_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|604958_607238_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|607238_607841_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|607824_608100_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|608099_608387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|608553_609258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|609633_610422_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|610458_612897_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|613216_614983_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|615137_616049_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|616171_617254_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|617341_618211_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|618264_618759_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|618959_619784_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|619873_622198_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_147008890.1|622432_623458_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.9	1.7e-90
WP_006250031.1|623706_624447_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|624577_626644_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|626765_627923_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|627981_628197_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|628386_629202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|629263_629908_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|630019_631723_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|631757_632156_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|632183_633320_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|633316_634132_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|634131_635013_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|635009_635678_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|636021_637305_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|637470_641187_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|641294_643298_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_020831139.1|643396_644764_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|644777_645512_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|645514_646150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249329.1|646417_647155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|647151_648120_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|648300_648636_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|648619_648943_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|648932_650819_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|650866_651649_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|651697_652858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|652917_653934_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|654021_654183_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|654160_655162_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|655163_655568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|655702_655885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|655888_656218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|656253_657006_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|657044_658292_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1056458	1063243	2646006		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1056458_1057241_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1057250_1057979_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1058114_1059134_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1059135_1059738_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1059866_1060022_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1060099_1060681_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1060695_1061343_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1061446_1062076_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1062190_1063243_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 4
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1459706	1586186	2646006	tail,integrase,transposase,plate,capsid,tRNA,head,holin,portal,terminase	Mannheimia_phage(93.6%)	154	1578233:1578251	1595002:1595020
WP_006248143.1|1459706_1462334_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1462528_1462954_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1463184_1463958_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1464101_1464893_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1464945_1465242_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1465266_1465545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1465704_1467681_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1467772_1468573_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1468940_1469939_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1470216_1470399_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1470668_1470959_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1470933_1471203_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1471192_1471525_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1471535_1471988_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1471987_1472320_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1472332_1474693_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1474689_1475022_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1475018_1475261_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1475412_1475706_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1475718_1476051_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1476133_1476406_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1476538_1476784_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1476882_1477095_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1477218_1477905_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1477908_1478427_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1478444_1478855_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1478954_1479215_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1479249_1480056_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1480238_1481477_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1481476_1481914_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1481915_1482263_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1482326_1482443_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1482466_1482781_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1482859_1483366_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1483374_1484556_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1484937_1485180_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1485180_1487460_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1487462_1488095_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1488081_1488999_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1488995_1489331_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1489330_1489936_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1490064_1490352_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006248190.1|1490585_1493498_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1493536_1493815_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1493865_1494324_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1494316_1494802_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1494798_1495020_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1495168_1495624_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1495620_1496187_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1496179_1496386_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1496391_1496604_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1496600_1497116_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1497227_1497917_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1497926_1498955_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1498968_1499796_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1499909_1501748_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1501756_1502797_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1503572_1504577_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1504801_1505197_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1505283_1506366_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1506495_1506726_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1506734_1507787_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1507857_1508751_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1508737_1509703_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1509705_1511457_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1511449_1512409_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1512717_1513299_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1513339_1513792_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1513795_1514116_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1514112_1514712_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1514754_1515273_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1515323_1517015_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1517017_1517836_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1517923_1518772_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1518899_1520621_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1520705_1521389_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1521398_1522928_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1523152_1523899_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_147008904.1|1524063_1526877_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1526979_1528209_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1528501_1529662_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1529670_1530540_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1530610_1532056_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1532160_1533147_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1533137_1533776_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1534959_1535550_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1535619_1536138_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1536284_1536596_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1536971_1537265_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147008905.1|1537387_1544434_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	96.1	0.0e+00
WP_006248123.1|1544436_1545027_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	100.0	2.3e-103
WP_006248125.1|1545295_1546027_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.1	3.3e-144
WP_075272472.1|1546030_1546747_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	99.6	1.2e-135
WP_006251214.1|1546754_1547225_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251215.1|1547224_1547554_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251216.1|1547557_1550053_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251218.1|1550597_1551056_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|1551224_1551458_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|1551472_1552144_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|1552239_1552416_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|1552471_1552888_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|1552927_1553410_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|1553413_1553794_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|1553790_1554159_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|1554160_1554505_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|1554504_1554882_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251229.1|1555165_1556155_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|1556169_1556604_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|1556596_1557967_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|1557953_1558892_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|1558845_1560222_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_020824318.1|1560218_1561439_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	100.0	8.3e-241
WP_020849856.1|1561422_1561947_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	100.0	2.2e-89
WP_020824300.1|1562338_1562572_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1562516_1562867_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1562839_1563409_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1563401_1563647_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1563985_1564171_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1564490_1564964_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1564953_1565523_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1565650_1565845_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1565890_1566103_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1566152_1566659_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1566642_1566858_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1566948_1567485_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1567481_1568843_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1568839_1569709_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1570017_1570278_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1570298_1570505_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1570634_1571294_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1571344_1571725_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1571717_1572215_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_015587044.1|1572324_1573365_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253368.1|1573502_1573808_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1573816_1574092_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1574383_1574614_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1574995_1575232_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1575800_1576307_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1576310_1576670_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1576666_1577146_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1577279_1577492_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1577504_1578455_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1578233:1578251	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1578495_1579290_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1579286_1579922_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_015484282.1|1580131_1580584_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	100.0	6.3e-85
WP_006250261.1|1580661_1581189_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1581185_1581389_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1581372_1581837_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1581840_1582029_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1582490_1582706_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1583250_1583952_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1584469_1584853_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1584902_1585124_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1585145_1586186_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1595002:1595020	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1591759	1602154	2646006	transposase,integrase	Mannheimia_phage(66.67%)	13	1593341:1593357	1612022:1612038
WP_006247813.1|1591759_1594618_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
1593341:1593357	attL	ACAAGCGGTCAAATTTA	NA	NA	NA	NA
WP_006247812.1|1594902_1595196_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1595339_1595729_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1595700_1596000_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1596176_1596863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1597264_1597465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1597595_1598279_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1598353_1598734_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1598726_1599224_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1599355_1599538_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1599576_1599996_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006253274.1|1600331_1600976_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_041447883.1|1601113_1602154_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	9.4e-201
1612022:1612038	attR	TAAATTTGACCGCTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1626192	1731807	2646006	tail,integrase,tRNA,holin,transposase,portal,terminase	Mannheimia_phage(44.83%)	105	1641189:1641248	1741409:1741575
WP_006253506.1|1626192_1627329_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1627375_1627792_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1627853_1628447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1628577_1630866_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1631129_1632893_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1632989_1633952_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006248099.1|1634004_1636437_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_147008906.1|1636568_1639205_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	36.0	1.6e-140
WP_006250663.1|1639214_1641047_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
WP_147008907.1|1641145_1641355_-	adenine methyltransferase	NA	NA	NA	NA	NA
1641189:1641248	attL	GCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGT	NA	NA	NA	NA
WP_006248097.1|1641554_1642430_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006248096.1|1642422_1643184_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248095.1|1643250_1644618_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248094.1|1644651_1645281_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248093.1|1645412_1647077_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248092.1|1647076_1648843_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006253502.1|1648957_1653055_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_147008908.1|1653135_1654971_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_006248088.1|1654982_1655828_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248087.1|1655828_1656992_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248086.1|1657159_1657843_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248085.1|1657979_1658537_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248084.1|1658588_1659305_-	UMP kinase	NA	NA	NA	NA	NA
WP_006248083.1|1659396_1660959_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248082.1|1661022_1661874_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_006253501.1|1661969_1662689_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006253500.1|1663033_1664062_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248079.1|1664184_1665831_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006248078.1|1665840_1666851_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248077.1|1666860_1667487_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248076.1|1667548_1669039_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248075.1|1669097_1670333_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248074.1|1670420_1671143_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248073.1|1671372_1672290_-	GTPase Era	NA	NA	NA	NA	NA
WP_006248072.1|1672392_1673067_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248071.1|1673112_1674072_-	signal peptidase I	NA	NA	NA	NA	NA
WP_006253499.1|1674158_1675952_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248069.1|1676224_1677454_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253498.1|1677647_1679879_+	collagen-binding protein	NA	NA	NA	NA	NA
WP_147008909.1|1681023_1681956_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	96.7	1.4e-166
WP_006252769.1|1682197_1682638_+	DoxX family protein	NA	NA	NA	NA	NA
WP_006248065.1|1682663_1682951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248064.1|1683051_1683975_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_006248063.1|1683964_1684705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248062.1|1685505_1685676_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_006247812.1|1685943_1686237_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_147008910.1|1686359_1693415_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	96.6	0.0e+00
WP_006249176.1|1693424_1694054_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_095586241.1|1694322_1695054_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	96.7	5.7e-144
WP_006249178.1|1695057_1695774_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1695773_1696103_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1696102_1699669_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1699722_1699950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1700012_1700243_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1700287_1700689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1700772_1701414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1701441_1701837_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1701833_1702358_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1702361_1702664_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1702656_1702980_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1703053_1705015_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1705026_1706526_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1706525_1706750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1706746_1708858_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1708857_1709334_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1709481_1709880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824324.1|1710015_1710249_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	86.5	7.0e-32
WP_006249197.1|1710193_1710544_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1710544_1711141_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1711130_1711478_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1711641_1712448_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1712527_1712887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1712876_1713236_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1713228_1714257_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1714326_1714899_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1714895_1715531_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1715518_1716310_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1716306_1717068_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1717116_1717341_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1717467_1718199_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1718203_1718707_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1718703_1719816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1720079_1720310_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1720762_1721014_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1721016_1721292_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1721505_1721691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1721674_1721872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1721874_1722333_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1722368_1722728_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1722797_1723601_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1723710_1724229_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1724225_1724426_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1724409_1724907_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1724910_1725099_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1725230_1725608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1725837_1726677_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1726924_1727602_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1727840_1728278_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1728270_1728564_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1728566_1728776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1728922_1729048_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1729094_1729937_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1729999_1730491_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1730516_1730792_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1730751_1731807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1741409:1741575	attR	ACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCGTGATCTCAACGCTGACACAAGTCAAGCCTTTTTAAACGAACTCGACCAAACCCTCTGGACTGCCGCCGACAAACTGCGTAAAAACCTCGATGCCGCCAACT	NA	NA	NA	NA
>prophage 7
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1805588	1815905	2646006		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1805588_1806563_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1806565_1806763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1806746_1806932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1807577_1808174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1808209_1808947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1809098_1809473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1809484_1810141_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1810265_1810454_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1810511_1811195_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1811191_1812238_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1812248_1812842_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1814951_1815275_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1815355_1815523_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1815530_1815905_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 8
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	1819138	1826082	2646006	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1819138_1819849_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1820106_1820826_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1821047_1821674_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1821722_1822334_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1822444_1823131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1823307_1823607_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1823578_1823968_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1824111_1824405_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1824783_1826082_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 9
NZ_CP017491	Mannheimia haemolytica strain 38599 chromosome, complete genome	2646006	2259341	2267496	2646006	integrase,terminase	Synechococcus_phage(16.67%)	12	2262547:2262606	2267912:2267985
WP_006250276.1|2259341_2259881_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2260018_2260309_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2260280_2260583_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2260600_2260894_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2260844_2261057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2261059_2262019_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2262547:2262606	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2262825_2264052_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2264326_2264545_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2264657_2264981_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2265375_2266062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2266381_2266807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2266803_2267496_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2267912:2267985	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
