The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	696648	746829	2590626	tail,transposase,integrase,head,plate,terminase	Mannheimia_phage(79.17%)	61	745648:745707	751732:752147
WP_147009073.1|696648_697689_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|697812_698373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698353_700285_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700427_700610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700759_701800_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701799_702273_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702262_703471_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703733_704966_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|705032_706019_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|706059_706470_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706535_707846_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708260_708980_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|709156_709435_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711361_712243_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712253_712502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712511_712832_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712834_713026_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|713038_713656_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713974_714187_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714192_714375_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714397_714973_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714985_715354_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715595_716150_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|716133_716556_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716911_717511_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717521_717728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717820_718711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718838_719270_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719355_719889_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719891_720134_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|720130_720490_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720652_720910_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720909_721164_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|721171_721672_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721821_723447_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723515_725189_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|725175_726465_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726612_727029_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|727025_727244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727287_728355_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|728354_729272_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|729317_729635_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729634_730060_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|730056_730698_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730698_730878_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730877_732287_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732297_732672_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732671_733040_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|733069_733258_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733310_735590_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735589_736882_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736884_738012_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|738013_738664_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738772_739123_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|739135_740197_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740196_740763_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740763_743490_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743490_744114_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|744106_744571_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744691_745480_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745648:745707	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|746064_746829_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|746064_746829_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751732:752147	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	999509	1006294	2590626		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999509_1000292_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000301_1001030_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1001165_1002185_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1002186_1002789_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002917_1003073_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1003150_1003732_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003746_1004394_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004497_1005127_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005241_1006294_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	1316043	1393531	2590626	holin,capsid,portal,tail,transposase,integrase,head,plate,terminase,tRNA	Mannheimia_phage(85.0%)	84	1318460:1318476	1361929:1361945
WP_006252789.1|1316043_1318431_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1318460:1318476	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1318478_1319465_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1319693_1320353_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1321837_1322590_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1322589_1323489_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1323497_1324061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1324060_1324837_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1324936_1325332_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1325348_1325777_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1326075_1326471_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1326631_1328203_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1328219_1328531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1328652_1329324_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1329444_1330908_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1331135_1334303_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1334316_1335522_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1335552_1336125_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1336363_1336585_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1336589_1338323_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1339034_1339415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1339456_1343917_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1344092_1344809_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1344857_1346201_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1346458_1347346_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1347481_1347667_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1347756_1350384_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1350578_1351004_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1351234_1352008_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1352151_1352943_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1352995_1353292_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1353316_1353595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1353754_1355731_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1355822_1356635_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006252804.1|1356999_1357998_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	100.0	3.1e-185
WP_006248154.1|1358275_1358458_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_134916677.1|1358586_1359627_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.1	6.1e-200
WP_075271718.1|1359724_1360216_-	methyltransferase	NA	A0A0M3LQB3	Mannheimia_phage	100.0	1.2e-97
WP_006252806.1|1360215_1360506_-	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	100.0	5.5e-50
WP_006252807.1|1360480_1360750_-	hypothetical protein	NA	A0A0M3LPF0	Mannheimia_phage	100.0	1.1e-44
WP_006252809.1|1361082_1361526_-	single-stranded DNA-binding protein	NA	A0A0M3LP18	Mannheimia_phage	100.0	1.5e-75
WP_006250958.1|1361525_1361852_-	hypothetical protein	NA	A0A0M3LSB5	Mannheimia_phage	100.0	3.4e-56
WP_075271719.1|1361836_1364197_-	replication endonuclease	NA	A0A0M3LSC6	Mannheimia_phage	100.0	0.0e+00
1361929:1361945	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1364193_1364526_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1364522_1364765_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1364915_1365209_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1365217_1365550_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1365632_1365905_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1366044_1366290_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1366388_1366601_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1366724_1367411_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1367414_1367933_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1367950_1368361_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1368472_1369513_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888665.1|1369572_1369947_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1369946_1371188_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1371187_1371625_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1371624_1372011_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1372071_1372212_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1372211_1372526_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1372606_1373113_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1373121_1374303_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1374404_1374668_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1374636_1375272_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_147010270.1|1375272_1378287_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	100.0	0.0e+00
WP_061888620.1|1378289_1378829_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1378815_1379733_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1379729_1380065_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1380064_1380670_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1380798_1381086_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_075271747.1|1381319_1384232_-|tail	phage tail protein	tail	A0A0M3LS92	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1384270_1384549_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1384599_1385058_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1385050_1385536_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_075271746.1|1385532_1385754_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LQ09	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1385902_1386358_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1386354_1386921_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1386913_1387120_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1387125_1387338_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006252832.1|1387334_1387850_-|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1387961_1388651_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1388660_1389689_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006248198.1|1389702_1390530_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1390643_1392482_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_040081096.1|1392490_1393531_+|portal	phage portal protein	portal	A0A0M3LQ03	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	1425581	1481326	2590626	holin,integrase,head,terminase	Mannheimia_phage(46.55%)	74	1428156:1428175	1481478:1481497
WP_006252023.1|1425581_1426046_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1426038_1426662_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009275.1|1426662_1429602_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.6	0.0e+00
1428156:1428175	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1429674_1430295_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1430291_1431488_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1431484_1431835_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1431838_1432501_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1432490_1433378_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1433377_1433674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1433676_1434384_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1434618_1435515_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1435799_1435979_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1436130_1436802_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1436824_1437487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1437486_1440156_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1440328_1440733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1440800_1441322_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1441456_1441900_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1441957_1443436_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1443451_1443958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1443942_1444323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1444330_1445035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1445037_1445643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1445639_1446071_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1446073_1446448_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1446517_1447648_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1447659_1448169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1448180_1449437_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1449433_1450624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1450676_1451507_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1451481_1452993_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1453060_1454440_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1454442_1454940_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1455140_1455320_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1455329_1455479_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1455507_1455858_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1455858_1456455_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1456469_1456913_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1456964_1457438_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_032844502.1|1457427_1457997_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	82.5	3.1e-81
WP_032844503.1|1458187_1458493_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	56.0	1.8e-19
WP_032844505.1|1458503_1458824_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	58.9	1.5e-24
WP_032844506.1|1459124_1459655_+	antirepressor	NA	D0UIM5	Aggregatibacter_phage	50.3	3.5e-42
WP_032844507.1|1459810_1460239_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	7.8e-37
WP_006252693.1|1460225_1460438_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	86.8	5.8e-33
WP_006250086.1|1460528_1461065_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_032844508.1|1461061_1461709_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	95.3	9.2e-114
WP_032844512.1|1461708_1461993_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	95.7	4.2e-47
WP_006252350.1|1462490_1463330_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1463392_1463836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1463884_1464079_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1464175_1464835_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1464834_1465674_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1465690_1466518_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252943.1|1466548_1467376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252944.1|1467534_1467831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252945.1|1468294_1468546_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	81.5	1.6e-29
WP_006248787.1|1468548_1468824_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1469501_1470017_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_147010271.1|1470336_1471032_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	59.3	1.6e-47
WP_020824128.1|1471138_1471645_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006250254.1|1471648_1472008_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|1472004_1472484_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1472617_1472830_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1472842_1473766_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1473758_1474421_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|1474461_1475307_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|1475334_1475787_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_147010273.1|1475831_1476335_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	99.4	1.1e-82
WP_061888593.1|1477029_1477866_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1478251_1479094_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1479609_1479993_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1480042_1480264_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1480285_1481326_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1481478:1481497	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	1634628	1683996	2590626	protease,transposase,tRNA	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1634628_1635669_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1635994_1636393_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1636479_1639206_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1639264_1639585_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1639705_1640008_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1640032_1640407_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1640763_1641075_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1641166_1641754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1642079_1642370_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1642429_1643161_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1643160_1643721_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1643720_1644146_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1644192_1645245_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1645629_1646997_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1647040_1647709_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1649796_1650714_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1650710_1651058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1651730_1652381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1652370_1652709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1653405_1653609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1653620_1653869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1654303_1654489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1655048_1655267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1655870_1657067_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1657173_1658148_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1658215_1658923_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1658967_1660419_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1660533_1661394_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1661900_1663199_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1663372_1664260_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1664262_1665486_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1665676_1666327_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1666383_1666713_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1667879_1670447_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1670387_1670570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251668.1|1670660_1671803_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_006251672.1|1673407_1674307_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1674320_1675223_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1675219_1675576_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1675645_1676251_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1676324_1678232_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1678535_1679714_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1679792_1680833_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1681048_1681471_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1682955_1683996_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	1925375	1968087	2590626	protease,holin,portal,tail,transposase,integrase,terminase	Mannheimia_phage(57.78%)	60	1926489:1926504	1966702:1966717
WP_020824044.1|1925375_1926416_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
1926489:1926504	attL	AAACGTTCCGAAAAAA	NA	NA	NA	NA
WP_006247812.1|1926685_1926979_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|1927122_1927512_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1927483_1927783_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|1927855_1928896_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824196.1|1930100_1930691_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_020824197.1|1930959_1931691_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1931694_1932411_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1932410_1932740_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1932739_1936291_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1936344_1936572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1936634_1936865_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1936909_1937311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1937393_1938035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1938062_1938455_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1938451_1938976_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1938979_1939282_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1939274_1939598_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1939850_1941812_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1942215_1943412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1943415_1944927_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1944926_1945151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1945147_1947259_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1947258_1947738_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1948007_1948157_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1948206_1948536_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1948536_1949130_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1949119_1949464_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1949811_1949997_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1950505_1950700_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1950667_1951108_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1951097_1951457_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1951449_1952478_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1952604_1953198_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1953208_1954255_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1954251_1955091_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1955266_1955527_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1955547_1955748_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1955878_1956562_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1956636_1957017_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1957009_1957507_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1957637_1957820_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1957858_1958278_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1958344_1958650_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1958658_1958934_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1959223_1959454_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1959932_1960256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1960448_1960634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1960787_1961246_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1961281_1961641_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1961712_1962516_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1962567_1963002_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1963011_1963500_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|1963520_1963730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1963876_1964002_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|1964048_1964891_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|1964953_1965337_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|1965386_1965662_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|1965621_1966677_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|1966824_1968087_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
1966702:1966717	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017489	Mannheimia haemolytica strain 39309 chromosome, complete genome	2590626	2233560	2335491	2590626	holin,tail,transposase,integrase,terminase,tRNA	Mannheimia_phage(86.42%)	120	2273594:2273610	2333276:2333292
WP_020824044.1|2233560_2234601_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2234720_2234951_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2235137_2235815_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2236008_2236281_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2236289_2236415_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2236594_2237368_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2237450_2238167_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2238176_2238929_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2239144_2239678_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2239586_2239808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2239783_2240125_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2240148_2240898_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2240907_2241858_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2242003_2243023_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2243103_2243859_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2243845_2244490_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2244493_2244715_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2244825_2246463_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2246536_2247502_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2247674_2248322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2248512_2249301_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2249597_2250551_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2251326_2254884_+	collagen-like protein	NA	NA	NA	NA	NA
WP_147010288.1|2254918_2255959_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	1.5e-198
WP_006252223.1|2256197_2257940_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2258155_2258413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2258919_2259150_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2260070_2260409_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2260666_2262565_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2262706_2263009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2263174_2264314_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2264601_2266110_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2266172_2266394_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2266415_2266862_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2266846_2267443_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2267551_2268886_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2268996_2270145_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2270274_2270622_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2270621_2271479_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2271587_2272550_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2273594:2273610	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2273659_2274157_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2274204_2275566_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2275757_2276309_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2277217_2278282_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2278466_2279126_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2279261_2280179_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2280392_2281271_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2281336_2281927_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2282057_2282900_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2283184_2283478_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2283593_2284193_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2284193_2284637_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2290503_2291094_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2291362_2292094_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2292097_2292814_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2292821_2293268_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2293289_2293619_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2293622_2296118_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2296204_2296600_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2296667_2297126_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2297294_2297528_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2297542_2298214_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2298310_2298487_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2298542_2298959_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2298998_2299481_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2299484_2299865_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2299861_2300230_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2300231_2300576_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2300575_2300953_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_062627922.1|2301272_2302259_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2302273_2302708_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2302700_2304071_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2304057_2304996_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2304949_2306326_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2306322_2307543_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2307526_2308051_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2308417_2308675_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2308675_2308816_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2308844_2309195_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2309195_2309789_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2309778_2310123_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2310241_2310820_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2311336_2311531_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2311498_2311864_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2311853_2312222_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2312218_2312503_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2312879_2313092_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2313141_2313594_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2313712_2314285_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2314281_2314929_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2314928_2315213_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2315698_2315941_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2316097_2316331_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2316459_2317146_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2317159_2317540_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2317532_2318030_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2318611_2318881_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2318858_2319131_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2319798_2320305_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2320308_2320668_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2320664_2321144_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2321277_2321490_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2321502_2322426_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2322418_2323081_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2323121_2323967_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2323994_2324447_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2324491_2324983_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2324979_2325183_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2325166_2325631_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2325634_2325823_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2325954_2326332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2326561_2327401_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2327648_2328326_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2328559_2329465_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2330701_2331298_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2331275_2331782_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2331871_2332147_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2332106_2333162_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2333413_2334367_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2333276:2333292	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824074.1|2334450_2335491_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
