The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	44517	52025	2700997	tail,transposase	Mannheimia_phage(81.82%)	11	NA	NA
WP_095578351.1|44517_44712_-	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	94.1	1.9e-06
WP_006248673.1|44698_44941_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_134983781.1|44941_47002_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	98.7	0.0e+00
WP_006253441.1|46998_47556_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47504_48500_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48552_48741_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48770_49139_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49138_49513_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|50002_50806_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50850_51129_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51305_52025_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	575496	659464	2700997	tRNA,tail,transposase,head,protease,plate	Mannheimia_phage(17.02%)	93	NA	NA
WP_006249683.1|575496_576174_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|576387_576606_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_020828826.1|576615_578586_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	43.9	9.6e-146
WP_006253638.1|578765_579254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|579285_580227_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|580229_580544_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|580555_580792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|580775_581069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|581190_581409_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|581418_581601_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|581617_582007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|582055_582343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|582461_583007_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|582993_583527_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|583691_584051_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|584186_584696_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|584698_584968_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|584961_585309_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|585487_585823_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|585824_586121_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|586143_586716_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|586715_588272_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|588390_589845_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|589837_591115_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|591316_591661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|591724_592189_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|592423_593539_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|593569_594496_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|594564_594846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|594845_595280_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|595285_595783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|595867_597253_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|597263_597779_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|597874_598189_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|598185_598338_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|598316_598619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715984.1|598666_601324_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|601333_602257_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|602240_602468_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|602460_603525_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|603511_604048_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|604102_604465_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|604474_605578_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|605570_606137_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|606146_608426_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|608426_609029_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|609012_609288_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|609287_609575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|609741_610446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142777899.1|610614_610758_+	adhesin	NA	NA	NA	NA	NA
WP_006249630.1|610805_611594_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|611630_614069_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|614388_616155_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|616309_617221_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|617343_618426_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|618513_619383_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|619436_619931_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|620131_620956_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|621045_623370_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|623604_624630_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|624878_625619_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|625749_627816_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|627937_629095_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|629153_629369_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|629558_630374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|630435_631080_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|631191_632895_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|632929_633328_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|633355_634492_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|634488_635304_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|635303_636185_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|636181_636850_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|637193_638477_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|638642_642359_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|642466_644470_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_020831139.1|644568_645936_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|645949_646684_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|646686_647322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062715982.1|647589_648327_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|648323_649292_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|649472_649808_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|649791_650115_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|650104_651991_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|652038_652821_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|652869_654030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|654089_655106_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|655193_655355_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|655332_656334_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|656335_656740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|656874_657057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|657060_657390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|657425_658178_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|658216_659464_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	915561	971526	2700997	integrase,transposase	Mannheimia_phage(26.67%)	59	938398:938413	972427:972442
WP_096864247.1|915561_916602_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006252258.1|916755_917529_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|917677_921874_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|921928_923023_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|923109_923379_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|923442_924081_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|924164_924941_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|924950_925205_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|925206_925500_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015587023.1|925566_926607_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_015587024.1|926605_927337_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006248322.1|927654_928209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248324.1|928476_928707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|928827_929145_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248329.1|929642_929900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|930334_931423_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248333.1|931487_931919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|931922_934025_-	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006253298.1|934051_934330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248336.1|935298_935730_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032845458.1|935747_936740_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_005719386.1|936736_937726_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
938398:938413	attL	ATATCTATTGGTGTTT	NA	NA	NA	NA
WP_006248338.1|938717_939359_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_006248339.1|939376_940132_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005719377.1|940135_940783_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005719374.1|940779_941943_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006248340.1|941939_943241_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719369.1|943382_944270_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248341.1|944294_944849_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719365.1|944908_945232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719361.1|945255_946359_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_015484362.1|947587_948235_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_006248344.1|948258_948666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|948763_949114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|949204_949567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|949679_949940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248349.1|951230_952067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|952170_952635_-	ArdC family protein	NA	NA	NA	NA	NA
WP_006253302.1|952843_953107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270676.1|953190_954258_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075270679.1|954514_954724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248352.1|954868_957037_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_006253295.1|957037_959020_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006253296.1|959081_959387_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015484352.1|959421_960462_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	95.7	1.1e-193
WP_021265545.1|960560_960791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|960860_961412_-	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_049800970.1|961748_962003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|962241_962496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248359.1|962661_962868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248360.1|962864_963641_+	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248362.1|964416_965391_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248363.1|965477_965675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587023.1|965787_966828_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006248364.1|966959_967202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|967361_967619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248367.1|967630_968131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008793.1|968634_970608_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248370.1|970761_971526_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
972427:972442	attR	AAACACCAATAGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1071372	1078157	2700997		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1071372_1072155_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1072164_1072893_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1073028_1074048_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1074049_1074652_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1074780_1074936_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1075013_1075595_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1075609_1076257_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1076360_1076990_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1077104_1078157_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 5
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1158288	1176019	2700997	integrase,transposase	Staphylococcus_phage(28.57%)	18	1159021:1159035	1176894:1176908
WP_014325826.1|1158288_1159053_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
1159021:1159035	attL	GAAATGTTGAGAGAG	NA	NA	NA	NA
WP_075266381.1|1159230_1160205_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_014325825.1|1160319_1161225_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_075266406.1|1161368_1161614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1161644_1163138_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1163249_1163555_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|1163582_1164797_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|1165073_1165958_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|1166278_1166503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|1166585_1167878_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|1168040_1168886_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1169054_1169858_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1169857_1170694_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|1171029_1171845_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|1172761_1173772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075266381.1|1173872_1174847_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_087437310.1|1174816_1175041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|1175119_1176019_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
1176894:1176908	attR	GAAATGTTGAGAGAG	NA	NA	NA	NA
>prophage 6
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1272301	1371885	2700997	capsid,tRNA,integrase,tail,transposase,terminase,protease	Mannheimia_phage(85.0%)	117	1272087:1272105	1294232:1294250
1272087:1272105	attL	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250229.1|1272301_1273252_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1273262_1273922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1273931_1274138_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_062715992.1|1274607_1275822_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1276193_1276931_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1276962_1277349_-	RidA family protein	NA	NA	NA	NA	NA
WP_147015533.1|1277429_1278431_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.2	1.2e-75
WP_006249037.1|1278497_1278839_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1279031_1280372_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1280533_1281499_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1281765_1283436_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1283596_1284040_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1284090_1284666_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1284772_1285663_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1285729_1286296_-	elongation factor P	NA	NA	NA	NA	NA
WP_006253558.1|1286462_1287032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249378.1|1287085_1288078_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1288177_1289581_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1290053_1291043_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1291039_1291297_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1291323_1291815_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1292314_1292779_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1292762_1292966_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1292962_1293490_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1293567_1294020_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1294229_1294865_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
1294232:1294250	attR	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250257.1|1294861_1295656_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1295696_1296647_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1296659_1296872_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1297005_1297485_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1297481_1297841_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1297844_1298351_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1298919_1299156_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1299537_1299768_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1300059_1300335_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1300343_1300649_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_020910232.1|1300786_1301827_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006250077.1|1301936_1302434_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1302426_1302807_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1302857_1303517_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1303646_1303853_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1303873_1304134_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1304442_1305312_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1305308_1306670_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1306666_1307203_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1307293_1307509_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1307492_1307999_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1308048_1308261_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250091.1|1308306_1308501_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250093.1|1308628_1309198_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_062716082.1|1309187_1309640_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	5.1e-79
WP_020910232.1|1309737_1310778_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006251707.1|1311188_1311374_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1311712_1311958_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1311950_1312520_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1312492_1312843_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1313412_1313937_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1313920_1315141_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1315137_1316514_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1316467_1317406_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1317392_1318763_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1318755_1319190_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1319204_1320194_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251227.1|1320477_1320855_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1320854_1321199_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1321200_1321569_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1321565_1321946_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1321949_1322432_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1322471_1322888_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1322943_1323120_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1323215_1323887_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1323901_1324135_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1324303_1324762_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1325306_1327802_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1327805_1328135_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1328134_1328605_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1328612_1329329_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_006249177.1|1329332_1330064_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_147015534.1|1330332_1330962_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	99.5	1.3e-109
WP_075270690.1|1330971_1334703_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008794.1|1334699_1337693_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.7	0.0e+00
WP_100067196.1|1337692_1338136_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1338136_1338736_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1338850_1339144_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1339690_1340209_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484183.1|1340278_1340869_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249380.1|1341288_1342836_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1342832_1343432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1343443_1344262_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1344297_1344570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1344566_1344917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1344927_1346121_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1346134_1346980_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1347142_1347379_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1347617_1349636_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1349638_1350049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1350269_1351358_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1351376_1352342_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1352356_1352854_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1353027_1353672_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1353671_1354079_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1354275_1355235_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1355314_1355575_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1355624_1356515_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1356644_1359251_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1359300_1360239_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249030.1|1360252_1361329_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1361359_1362115_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1362266_1362476_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1362524_1363247_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1363294_1364482_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1364615_1365734_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1365790_1366273_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1366283_1368944_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1369095_1369935_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1370023_1371106_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1371192_1371885_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1550518	1642273	2700997	capsid,tRNA,integrase,tail,transposase,terminase,portal,head,plate,holin	Mannheimia_phage(90.12%)	110	1634320:1634338	1651089:1651107
WP_006248143.1|1550518_1553146_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1553340_1553766_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1553996_1554770_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1554913_1555705_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1555757_1556054_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1556078_1556357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1556516_1558493_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1558584_1559385_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1559752_1560751_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1561028_1561211_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1561480_1561771_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1561745_1562015_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1562004_1562337_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1562347_1562800_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1562799_1563132_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1563144_1565505_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1565501_1565834_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1565830_1566073_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1566224_1566518_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1566530_1566863_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1566945_1567218_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1567350_1567596_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1567694_1567907_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1568030_1568717_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1568720_1569239_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1569256_1569667_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1569766_1570027_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1570061_1570868_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1571050_1572289_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1572288_1572726_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1572727_1573075_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1573138_1573255_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1573278_1573593_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1573671_1574178_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1574186_1575368_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1575781_1576024_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1576024_1578304_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1578306_1578939_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1578925_1579843_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1579839_1580175_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1580174_1580780_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_020910232.1|1581059_1582100_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_021265529.1|1582134_1582404_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LP36	Mannheimia_phage	91.7	3.6e-40
WP_006250778.1|1582396_1582576_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_006248191.1|1585588_1585867_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_062716029.1|1585917_1586376_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	99.3	9.8e-78
WP_006248193.1|1586368_1586854_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1586850_1587072_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1587220_1587676_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1587672_1588239_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1588231_1588438_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1588443_1588656_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1588652_1589168_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1589279_1589969_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1589978_1591007_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1591020_1591848_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1591961_1593800_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1593808_1594849_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1595624_1596629_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1596853_1597249_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1597335_1598418_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1598547_1598778_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1598786_1599839_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1599909_1600803_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1600789_1601755_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1601757_1603509_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1603501_1604461_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1604769_1605351_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1605391_1605844_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1605847_1606168_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1606164_1606764_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1606806_1607325_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1607375_1609067_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1609069_1609888_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1609975_1610824_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1610951_1612673_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1612757_1613441_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1613450_1614980_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1615204_1615951_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249163.1|1616115_1618929_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1619031_1620261_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1620553_1621714_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1621722_1622592_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1622662_1624108_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1624212_1625199_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1625189_1625828_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1627011_1627602_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1627671_1628190_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_020910232.1|1628411_1629452_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1629589_1629895_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1629903_1630179_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1630470_1630701_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1631082_1631319_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1631887_1632394_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1632397_1632757_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1632753_1633233_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1633366_1633579_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1633591_1634542_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1634320:1634338	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1634582_1635377_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1635373_1636009_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250260.1|1636218_1636671_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1636748_1637276_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1637272_1637476_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1637459_1637924_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1637927_1638116_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1638577_1638793_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1639337_1640039_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1640556_1640940_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1640989_1641211_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1641232_1642273_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1651089:1651107	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 8
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1647846	1736100	2700997	tRNA,integrase,tail,transposase,portal,terminase,holin	Mannheimia_phage(56.36%)	99	1656382:1656415	1679695:1679728
WP_006247813.1|1647846_1650705_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247812.1|1650989_1651283_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1651426_1651816_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1651787_1652087_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1652263_1652950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1653351_1653552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1653682_1654366_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1654440_1654821_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1654813_1655311_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1655442_1655625_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1655663_1656083_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
1656382:1656415	attL	CTACATTCACTAAGAATTTTTATCAAAGCCCTTT	NA	NA	NA	NA
WP_006253274.1|1656418_1657063_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_015587044.1|1657200_1658241_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253513.1|1658307_1659714_-	YdgA family protein	NA	NA	NA	NA	NA
WP_006248821.1|1659763_1660570_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006248820.1|1660571_1661762_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248819.1|1661773_1662526_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006253512.1|1662751_1664284_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248816.1|1664720_1665122_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006248815.1|1665191_1666031_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248814.1|1666067_1666751_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248812.1|1667018_1668092_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248811.1|1668218_1669274_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
WP_006248810.1|1669233_1669509_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248809.1|1669534_1670026_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248808.1|1670088_1670931_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248807.1|1670977_1671103_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248806.1|1671249_1671459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248805.1|1671461_1671755_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248804.1|1671747_1672185_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248801.1|1672423_1673101_-	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248800.1|1673348_1674188_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248797.1|1674417_1674795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484162.1|1674926_1675115_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248795.1|1675118_1675616_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_006248794.1|1675599_1675800_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248793.1|1675796_1676315_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248792.1|1676424_1677228_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248791.1|1677297_1677657_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248790.1|1677692_1678151_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248789.1|1678153_1678351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248788.1|1678334_1678520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248787.1|1678733_1679009_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248786.1|1679011_1679263_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_015484163.1|1679715_1679946_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
1679695:1679728	attR	AAAGGGCTTTGATAAAAATTCTTAGTGAATGTAG	NA	NA	NA	NA
WP_015484164.1|1680209_1681322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249427.1|1681318_1681822_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_006249426.1|1681826_1682558_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249425.1|1682684_1682909_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249424.1|1682957_1683719_+	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249423.1|1683715_1684507_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249422.1|1684494_1685130_+	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_015484167.1|1685126_1685699_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_015587038.1|1685768_1686797_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_006249418.1|1686789_1687149_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015484169.1|1687138_1687498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587037.1|1687577_1688384_+	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006249199.1|1688547_1688895_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015484172.1|1688884_1689481_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249197.1|1689481_1689832_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_006249195.1|1690145_1690544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249194.1|1690691_1691168_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249193.1|1691167_1693279_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249192.1|1693275_1693500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249191.1|1693499_1694999_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249190.1|1695010_1696972_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249189.1|1697045_1697369_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249188.1|1697361_1697664_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1697667_1698192_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249186.1|1698188_1698584_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249185.1|1698611_1699253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249184.1|1699336_1699738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1699782_1700013_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249181.1|1700075_1700303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249180.1|1700356_1703923_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249179.1|1703922_1704252_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249178.1|1704251_1704968_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_020828760.1|1704971_1705703_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249176.1|1705971_1706601_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_075272501.1|1706610_1710342_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008795.1|1710338_1713665_+	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_006247812.1|1713787_1714081_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006248119.1|1714385_1715888_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1716041_1717517_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1718993_1719287_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1719353_1720367_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_134916814.1|1720469_1720763_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1720763_1721684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1721710_1722385_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1722384_1723248_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1723257_1725039_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1725060_1725738_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_134983790.1|1727720_1728182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1728340_1729477_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1729523_1729940_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1730001_1730595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1730725_1733014_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1733277_1735041_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1735137_1736100_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1861638	1871955	2700997		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1861638_1862613_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1862615_1862813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1862796_1862982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1863627_1864224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1864259_1864997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1865148_1865523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1865534_1866191_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1866315_1866504_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1866561_1867245_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1867241_1868288_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1868298_1868892_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1871001_1871325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1871405_1871573_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1871580_1871955_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 10
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	1875188	1882132	2700997	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1875188_1875899_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1876156_1876876_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1877097_1877724_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1877772_1878384_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1878494_1879181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1879357_1879657_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1879628_1880018_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1880161_1880455_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1880833_1882132_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 11
NZ_CP017546	Mannheimia haemolytica strain 1342 chromosome, complete genome	2700997	2315337	2323492	2700997	integrase,terminase	Synechococcus_phage(16.67%)	12	2318543:2318602	2323908:2323981
WP_006250276.1|2315337_2315877_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2316014_2316305_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2316276_2316579_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2316596_2316890_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2316840_2317053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2317055_2318015_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2318543:2318602	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2318821_2320048_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2320322_2320541_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2320653_2320977_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2321371_2322058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2322377_2322803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2322799_2323492_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2323908:2323981	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
