The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	44690	52017	2708096	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|44690_44933_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_134983781.1|44933_46994_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	98.7	0.0e+00
WP_006253441.1|46990_47548_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47496_48492_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48544_48733_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48762_49131_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49130_49505_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49994_50798_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50842_51121_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51297_52017_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	575506	659439	2708096	plate,transposase,tail,tRNA,head,protease	Mannheimia_phage(17.02%)	92	NA	NA
WP_006249683.1|575506_576184_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|576397_576616_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_020828826.1|576625_578596_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	43.9	9.6e-146
WP_006253638.1|578775_579264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|579295_580237_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|580239_580554_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|580565_580802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|580785_581079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|581200_581419_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|581428_581611_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|581627_582017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|582065_582353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|582471_583017_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|583003_583537_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|583701_584061_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|584196_584706_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|584708_584978_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|584971_585319_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|585497_585833_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|585834_586131_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|586153_586726_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|586725_588282_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|588400_589855_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|589847_591125_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|591326_591671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|591734_592199_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|592433_593549_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|593579_594506_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|594574_594856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|594855_595290_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|595295_595793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|595877_597263_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|597273_597789_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|597884_598199_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|598195_598348_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|598326_598629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715984.1|598676_601334_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|601343_602267_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|602250_602478_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|602470_603535_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|603521_604058_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|604112_604475_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|604484_605588_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|605580_606147_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|606156_608436_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|608436_609039_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|609022_609298_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|609297_609585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|609751_610456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|610779_611568_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|611604_614043_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|614362_616129_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|616283_617195_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|617317_618400_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|618487_619357_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|619410_619905_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|620105_620930_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|621019_623344_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|623578_624604_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|624852_625593_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|625723_627790_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|627911_629069_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|629127_629343_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|629532_630348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|630409_631054_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|631165_632869_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|632903_633302_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|633329_634466_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|634462_635278_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|635277_636159_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|636155_636824_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|637167_638451_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|638616_642333_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|642440_644444_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006253679.1|644542_645901_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|645924_646659_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|646661_647297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062715982.1|647564_648302_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|648298_649267_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|649447_649783_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|649766_650090_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|650079_651966_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|652013_652796_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|652844_654005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|654064_655081_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|655168_655330_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|655307_656309_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|656310_656715_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|656849_657032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|657035_657365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|657400_658153_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|658191_659439_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	915537	971502	2708096	integrase,transposase	Mannheimia_phage(26.67%)	59	938374:938389	972403:972418
WP_096864247.1|915537_916578_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006252258.1|916731_917505_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|917653_921850_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|921904_922999_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|923085_923355_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|923418_924057_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|924140_924917_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|924926_925181_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|925182_925476_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015587023.1|925542_926583_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_015587024.1|926581_927313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006248322.1|927630_928185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248324.1|928452_928683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|928803_929121_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248329.1|929618_929876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|930310_931399_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248333.1|931463_931895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|931898_934001_-	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006253298.1|934027_934306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248336.1|935274_935706_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032845458.1|935723_936716_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_005719386.1|936712_937702_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
938374:938389	attL	ATATCTATTGGTGTTT	NA	NA	NA	NA
WP_006248338.1|938693_939335_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_006248339.1|939352_940108_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005719377.1|940111_940759_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005719374.1|940755_941919_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006248340.1|941915_943217_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719369.1|943358_944246_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248341.1|944270_944825_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719365.1|944884_945208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719361.1|945231_946335_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_015484362.1|947563_948211_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_006248344.1|948234_948642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|948739_949090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|949180_949543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|949655_949916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248349.1|951206_952043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|952146_952611_-	ArdC family protein	NA	NA	NA	NA	NA
WP_006253302.1|952819_953083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270676.1|953166_954234_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075270679.1|954490_954700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248352.1|954844_957013_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_006253295.1|957013_958996_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006253296.1|959057_959363_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015484352.1|959397_960438_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	95.7	1.1e-193
WP_021265545.1|960536_960767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|960836_961388_-	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_049800970.1|961724_961979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|962217_962472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248359.1|962637_962844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248360.1|962840_963617_+	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248362.1|964392_965367_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248363.1|965453_965651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147010107.1|965763_966804_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.1	3.6e-200
WP_006248364.1|966935_967178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|967337_967595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248367.1|967606_968107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008793.1|968610_970584_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248370.1|970737_971502_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
972403:972418	attR	AAACACCAATAGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1071348	1078133	2708096		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1071348_1072131_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1072140_1072869_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1073004_1074024_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1074025_1074628_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1074756_1074912_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1074989_1075571_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1075585_1076233_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1076336_1076966_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1077080_1078133_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 5
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1158264	1175995	2708096	integrase,transposase	Staphylococcus_phage(28.57%)	18	1158997:1159011	1176870:1176884
WP_014325826.1|1158264_1159029_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
1158997:1159011	attL	GAAATGTTGAGAGAG	NA	NA	NA	NA
WP_075283441.1|1159206_1160181_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	3.0e-52
WP_014325825.1|1160295_1161201_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_075266406.1|1161344_1161590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1161620_1163114_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1163225_1163531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|1163558_1164773_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|1165049_1165934_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|1166254_1166479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|1166561_1167854_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|1168016_1168862_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1169030_1169834_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1169833_1170670_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|1171005_1171821_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|1172737_1173748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075266381.1|1173848_1174823_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_087437310.1|1174792_1175017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|1175095_1175995_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
1176870:1176884	attR	GAAATGTTGAGAGAG	NA	NA	NA	NA
>prophage 6
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1272277	1371870	2708096	transposase,tail,tRNA,terminase,integrase,capsid,protease	Mannheimia_phage(85.0%)	117	1272063:1272081	1294208:1294226
1272063:1272081	attL	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250229.1|1272277_1273228_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1273238_1273898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1273907_1274114_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_062715992.1|1274583_1275798_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1276169_1276907_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1276938_1277325_-	RidA family protein	NA	NA	NA	NA	NA
WP_006249038.1|1277405_1278407_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249037.1|1278473_1278815_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1279007_1280348_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1280509_1281475_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1281741_1283412_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1283572_1284016_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1284066_1284642_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1284748_1285639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1285705_1286272_-	elongation factor P	NA	NA	NA	NA	NA
WP_006253558.1|1286438_1287008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249378.1|1287061_1288054_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1288153_1289557_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1290029_1291019_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1291015_1291273_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1291299_1291791_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1292290_1292755_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1292738_1292942_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1292938_1293466_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1293543_1293996_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1294205_1294841_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
1294208:1294226	attR	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250257.1|1294837_1295632_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1295672_1296623_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1296635_1296848_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1296981_1297461_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1297457_1297817_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1297820_1298327_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1298895_1299132_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1299513_1299744_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1300035_1300311_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1300319_1300625_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_020910232.1|1300762_1301803_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006250077.1|1301912_1302410_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1302402_1302783_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1302833_1303493_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1303622_1303829_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1303849_1304110_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1304418_1305288_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1305284_1306646_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1306642_1307179_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1307269_1307485_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1307468_1307975_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1308024_1308237_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250091.1|1308282_1308477_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250093.1|1308604_1309174_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_062716082.1|1309163_1309616_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	5.1e-79
WP_020910232.1|1309713_1310754_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006251707.1|1311164_1311350_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1311688_1311934_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1311926_1312496_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1312468_1312819_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1313388_1313913_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1313896_1315117_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1315113_1316490_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1316443_1317382_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1317368_1318739_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1318731_1319166_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1319180_1320170_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251227.1|1320462_1320840_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1320839_1321184_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1321185_1321554_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1321550_1321931_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1321934_1322417_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1322456_1322873_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1322928_1323105_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1323200_1323872_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1323886_1324120_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1324288_1324747_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1325291_1327787_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1327790_1328120_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_147010108.1|1328119_1328590_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	99.4	1.6e-83
WP_006251213.1|1328597_1329314_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_020828760.1|1329317_1330049_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249176.1|1330317_1330947_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_075272501.1|1330956_1334688_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008794.1|1334684_1337678_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.7	0.0e+00
WP_100067196.1|1337677_1338121_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1338121_1338721_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1338835_1339129_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1339675_1340194_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484183.1|1340263_1340854_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249380.1|1341273_1342821_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1342817_1343417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1343428_1344247_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1344282_1344555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1344551_1344902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1344912_1346106_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1346119_1346965_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1347127_1347364_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1347602_1349621_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1349623_1350034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1350254_1351343_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1351361_1352327_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1352341_1352839_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1353012_1353657_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1353656_1354064_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1354260_1355220_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1355299_1355560_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1355609_1356500_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1356629_1359236_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1359285_1360224_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249030.1|1360237_1361314_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1361344_1362100_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1362251_1362461_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1362509_1363232_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1363279_1364467_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1364600_1365719_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1365775_1366258_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1366268_1368929_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1369080_1369920_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1370008_1371091_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1371177_1371870_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1550538	1642325	2708096	plate,portal,transposase,tail,holin,tRNA,head,integrase,terminase,capsid	Mannheimia_phage(90.24%)	111	1634372:1634390	1651141:1651159
WP_006248143.1|1550538_1553166_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1553360_1553786_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1554016_1554790_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1554933_1555725_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1555777_1556074_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1556098_1556377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715986.1|1556536_1558513_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1558604_1559405_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1559772_1560771_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1561048_1561231_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1561500_1561791_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1561765_1562035_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1562024_1562357_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1562367_1562820_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1562819_1563152_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1563164_1565525_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1565521_1565854_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1565850_1566093_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1566244_1566538_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1566550_1566883_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1566965_1567238_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1567370_1567616_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1567714_1567927_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1568050_1568737_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1568740_1569259_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1569276_1569687_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1569786_1570047_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1570081_1570888_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1571070_1572309_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1572308_1572746_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1572747_1573095_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1573158_1573275_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1573298_1573613_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1573691_1574198_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1574206_1575388_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_147010110.1|1575589_1575844_-	hypothetical protein	NA	A0A0M3LRS8	Mannheimia_phage	100.0	2.2e-10
WP_006248181.1|1575833_1576076_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1576076_1578356_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1578358_1578991_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1578977_1579895_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1579891_1580227_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1580226_1580832_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_015587044.1|1581111_1582152_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_021265529.1|1582186_1582456_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LP36	Mannheimia_phage	91.7	3.6e-40
WP_006250778.1|1582448_1582628_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_006248191.1|1585640_1585919_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_062716029.1|1585969_1586428_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	99.3	9.8e-78
WP_006248193.1|1586420_1586906_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1586902_1587124_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1587272_1587728_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1587724_1588291_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1588283_1588490_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1588495_1588708_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1588704_1589220_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1589331_1590021_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1590030_1591059_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1591072_1591900_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1592013_1593852_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1593860_1594901_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1595676_1596681_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1596905_1597301_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1597387_1598470_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1598599_1598830_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1598838_1599891_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1599961_1600855_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1600841_1601807_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1601809_1603561_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1603553_1604513_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1604821_1605403_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1605443_1605896_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1605899_1606220_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1606216_1606816_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1606858_1607377_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1607427_1609119_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1609121_1609940_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1610027_1610876_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1611003_1612725_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1612809_1613493_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1613502_1615032_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1615256_1616003_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249163.1|1616167_1618981_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1619083_1620313_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1620605_1621766_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1621774_1622644_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1622714_1624160_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1624264_1625251_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1625241_1625880_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1627063_1627654_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1627723_1628242_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_020910232.1|1628463_1629504_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1629641_1629947_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1629955_1630231_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1630522_1630753_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1631134_1631371_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1631939_1632446_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1632449_1632809_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1632805_1633285_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1633418_1633631_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1633643_1634594_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1634372:1634390	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1634634_1635429_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1635425_1636061_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250260.1|1636270_1636723_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1636800_1637328_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1637324_1637528_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1637511_1637976_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1637979_1638168_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1638629_1638845_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1639389_1640091_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1640608_1640992_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1641041_1641263_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1641284_1642325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1651141:1651159	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 8
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1647898	1736152	2708096	portal,transposase,tail,holin,tRNA,terminase,integrase	Mannheimia_phage(56.36%)	99	1656434:1656467	1679747:1679780
WP_006247813.1|1647898_1650757_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247812.1|1651041_1651335_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1651478_1651868_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1651839_1652139_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1652315_1653002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1653403_1653604_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1653734_1654418_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1654492_1654873_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1654865_1655363_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1655494_1655677_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1655715_1656135_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
1656434:1656467	attL	CTACATTCACTAAGAATTTTTATCAAAGCCCTTT	NA	NA	NA	NA
WP_006253274.1|1656470_1657115_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_020910232.1|1657252_1658293_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253513.1|1658359_1659766_-	YdgA family protein	NA	NA	NA	NA	NA
WP_006248821.1|1659815_1660622_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006248820.1|1660623_1661814_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248819.1|1661825_1662578_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006253512.1|1662803_1664336_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248816.1|1664772_1665174_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006248815.1|1665243_1666083_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248814.1|1666119_1666803_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248812.1|1667070_1668144_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248811.1|1668270_1669326_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
WP_006248810.1|1669285_1669561_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248809.1|1669586_1670078_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248808.1|1670140_1670983_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248807.1|1671029_1671155_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248806.1|1671301_1671511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248805.1|1671513_1671807_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248804.1|1671799_1672237_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248801.1|1672475_1673153_-	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248800.1|1673400_1674240_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248797.1|1674469_1674847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484162.1|1674978_1675167_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248795.1|1675170_1675668_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_006248794.1|1675651_1675852_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248793.1|1675848_1676367_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248792.1|1676476_1677280_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248791.1|1677349_1677709_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248790.1|1677744_1678203_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248789.1|1678205_1678403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248788.1|1678386_1678572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248787.1|1678785_1679061_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248786.1|1679063_1679315_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_015484163.1|1679767_1679998_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
1679747:1679780	attR	AAAGGGCTTTGATAAAAATTCTTAGTGAATGTAG	NA	NA	NA	NA
WP_015484164.1|1680261_1681374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249427.1|1681370_1681874_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_006249426.1|1681878_1682610_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249425.1|1682736_1682961_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249424.1|1683009_1683771_+	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249423.1|1683767_1684559_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249422.1|1684546_1685182_+	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_015484167.1|1685178_1685751_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_015587038.1|1685820_1686849_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_006249418.1|1686841_1687201_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015484169.1|1687190_1687550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587037.1|1687629_1688436_+	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006249199.1|1688599_1688947_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015484172.1|1688936_1689533_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249197.1|1689533_1689884_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_006249195.1|1690197_1690596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249194.1|1690743_1691220_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249193.1|1691219_1693331_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249192.1|1693327_1693552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249191.1|1693551_1695051_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249190.1|1695062_1697024_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249189.1|1697097_1697421_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249188.1|1697413_1697716_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1697719_1698244_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249186.1|1698240_1698636_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249185.1|1698663_1699305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249184.1|1699388_1699790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1699834_1700065_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249181.1|1700127_1700355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249180.1|1700408_1703975_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249179.1|1703974_1704304_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249178.1|1704303_1705020_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_020828760.1|1705023_1705755_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249176.1|1706023_1706653_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_075272501.1|1706662_1710394_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008795.1|1710390_1713717_+	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_006247812.1|1713839_1714133_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006248119.1|1714437_1715940_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1716093_1717569_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1719045_1719339_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1719405_1720419_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_134916814.1|1720521_1720815_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1720815_1721736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1721762_1722437_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1722436_1723300_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1723309_1725091_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1725112_1725790_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_134983790.1|1727772_1728234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1728392_1729529_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1729575_1729992_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1730053_1730647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1730777_1733066_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1733329_1735093_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1735189_1736152_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1861515	1871832	2708096		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1861515_1862490_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1862492_1862690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1862673_1862859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1863504_1864101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1864136_1864874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1865025_1865400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1865411_1866068_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1866192_1866381_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1866438_1867122_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1867118_1868165_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1868175_1868769_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1870878_1871202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1871282_1871450_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1871457_1871832_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 10
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	1875065	1882009	2708096	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1875065_1875776_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1876033_1876753_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1876974_1877601_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1877649_1878261_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1878371_1879058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1879234_1879534_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1879505_1879895_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1880038_1880332_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1880710_1882009_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 11
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	2315221	2323376	2708096	terminase,integrase	Synechococcus_phage(16.67%)	12	2318427:2318486	2323792:2323865
WP_006250276.1|2315221_2315761_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2315898_2316189_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2316160_2316463_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2316480_2316774_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2316724_2316937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2316939_2317899_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2318427:2318486	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2318705_2319932_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2320206_2320425_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2320537_2320861_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2321255_2321942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2322261_2322687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2322683_2323376_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2323792:2323865	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
>prophage 12
NZ_CP017542	Mannheimia haemolytica strain 1405, complete genome	2708096	2514264	2559633	2708096	tRNA,transposase,protease	Mannheimia_phage(25.0%)	36	NA	NA
WP_006249462.1|2514264_2514915_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006248255.1|2515243_2516602_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_062716086.1|2516602_2517868_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	21.5	7.8e-08
WP_006248257.1|2517857_2518751_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.3	4.8e-36
WP_006248503.1|2524726_2526130_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_006248502.1|2526340_2527213_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_006248501.1|2527212_2527785_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_006248499.1|2527933_2528884_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	28.3	7.4e-11
WP_006248496.1|2529249_2529714_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_015484031.1|2529734_2530334_-	VOC family protein	NA	NA	NA	NA	NA
WP_006248494.1|2530367_2532095_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.6	2.6e-86
WP_006248493.1|2532284_2533451_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_006248492.1|2533535_2534153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248491.1|2534199_2536158_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_006251244.1|2536154_2536712_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_006248488.1|2536897_2537095_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_006248487.1|2537109_2537847_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_006248486.1|2538046_2538709_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_006248485.1|2538705_2539347_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SKJ1	Klosneuvirus	24.1	7.0e-05
WP_006248484.1|2539490_2540201_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_006248482.1|2540470_2542072_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248481.1|2542343_2543348_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248479.1|2543449_2544343_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248478.1|2544353_2545343_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.2e-17
WP_006248477.1|2545470_2546460_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
WP_006248476.1|2546693_2547266_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015586953.1|2547435_2548305_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015587044.1|2548344_2549385_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253286.1|2549620_2550673_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.0	2.7e-22
WP_006248473.1|2550699_2551878_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_006248472.1|2552011_2553106_+	porin	NA	NA	NA	NA	NA
WP_015587044.1|2553468_2554509_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253286.1|2554744_2555797_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.0	2.7e-22
WP_006248473.1|2555823_2557002_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_006248472.1|2557135_2558230_+	porin	NA	NA	NA	NA	NA
WP_015587044.1|2558592_2559633_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
