The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	44517	52025	2713886	tail,transposase	Mannheimia_phage(81.82%)	11	NA	NA
WP_095578351.1|44517_44712_-	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	94.1	1.9e-06
WP_006248673.1|44698_44941_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_134983781.1|44941_47002_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	98.7	0.0e+00
WP_006253441.1|46998_47556_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47504_48500_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48552_48741_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48770_49139_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49138_49513_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|50002_50806_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50850_51129_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51305_52025_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	577523	661479	2713886	head,tail,tRNA,protease,plate,transposase	Mannheimia_phage(17.02%)	93	NA	NA
WP_006249683.1|577523_578201_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|578414_578633_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_020828826.1|578642_580613_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	43.9	9.6e-146
WP_006253638.1|580792_581281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|581312_582254_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|582256_582571_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|582582_582819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|582802_583096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|583217_583436_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|583445_583628_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|583644_584034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|584082_584370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|584488_585034_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|585020_585554_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|585718_586078_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|586213_586723_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|586725_586995_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|586988_587336_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|587514_587850_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|587851_588148_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|588170_588743_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|588742_590299_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|590417_591872_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|591864_593142_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|593343_593688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|593751_594216_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|594450_595566_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|595596_596523_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|596591_596873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|596872_597307_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|597312_597810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|597894_599280_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|599290_599806_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|599901_600216_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|600212_600365_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|600343_600646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715984.1|600693_603351_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|603360_604284_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|604267_604495_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|604487_605552_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|605538_606075_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|606129_606492_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|606501_607605_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|607597_608164_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|608173_610453_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|610453_611056_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|611039_611315_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|611314_611602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|611768_612473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274821.1|612641_612773_+	adhesin	NA	NA	NA	NA	NA
WP_006249630.1|612820_613609_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|613645_616084_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|616403_618170_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|618324_619236_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|619358_620441_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|620528_621398_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|621451_621946_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|622146_622971_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|623060_625385_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|625619_626645_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|626893_627634_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|627764_629831_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|629952_631110_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|631168_631384_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|631573_632389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|632450_633095_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|633206_634910_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|634944_635343_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|635370_636507_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|636503_637319_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|637318_638200_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|638196_638865_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|639208_640492_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|640657_644374_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|644481_646485_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_020831139.1|646583_647951_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|647964_648699_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|648701_649337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062715982.1|649604_650342_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|650338_651307_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|651487_651823_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|651806_652130_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|652119_654006_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|654053_654836_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|654884_656045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|656104_657121_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|657208_657370_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|657347_658349_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|658350_658755_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|658889_659072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|659075_659405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|659440_660193_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|660231_661479_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	917575	973540	2713886	transposase,integrase	Mannheimia_phage(26.67%)	59	955996:956011	974441:974456
WP_096864247.1|917575_918616_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006252258.1|918769_919543_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|919691_923888_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|923942_925037_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|925123_925393_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|925456_926095_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|926178_926955_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|926964_927219_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|927220_927514_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015587023.1|927580_928621_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006248363.1|928733_928931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248362.1|929017_929992_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248360.1|930767_931544_-	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248359.1|931540_931747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|931912_932167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049800970.1|932405_932660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|932996_933548_+	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_021265545.1|933617_933848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484352.1|933946_934987_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	95.7	1.1e-193
WP_006253296.1|935021_935327_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_006253295.1|935388_937371_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006248352.1|937371_939540_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_075270679.1|939684_939894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270676.1|940150_941218_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006253302.1|941301_941565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|941773_942238_+	ArdC family protein	NA	NA	NA	NA	NA
WP_006248349.1|942341_943178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|944468_944729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|944841_945204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|945294_945645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248344.1|945742_946150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484362.1|946173_946821_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_005719361.1|948049_949153_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_005719365.1|949176_949500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248341.1|949559_950114_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719369.1|950138_951026_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248340.1|951167_952469_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719374.1|952465_953629_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_005719377.1|953625_954273_+	DUF452 family protein	NA	NA	NA	NA	NA
WP_006248339.1|954276_955032_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_006248338.1|955049_955691_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
955996:956011	attL	AAACACCAATAGATAT	NA	NA	NA	NA
WP_005719386.1|956682_957672_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
WP_032845458.1|957668_958661_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_006248336.1|958678_959110_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_006253298.1|960078_960357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|960383_962486_+	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006248333.1|962489_962921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|962985_964074_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248329.1|964508_964766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|965263_965581_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248324.1|965701_965932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248322.1|966199_966754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015587024.1|967071_967803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015587023.1|967801_968842_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006248364.1|968973_969216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|969375_969633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248367.1|969644_970145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008793.1|970648_972622_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248370.1|972775_973540_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
974441:974456	attR	AAACACCAATAGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1059561	1118626	2713886	tail,capsid,transposase,integrase	Escherichia_phage(17.39%)	58	1059189:1059208	1063294:1063313
1059189:1059208	attL	CGTGTAACTAAACGTGTAAC	NA	NA	NA	NA
WP_006248937.1|1059561_1059957_+|tail	tail protein	tail	K7PJP5	Enterobacteria_phage	26.6	5.6e-05
WP_006248938.1|1059967_1061836_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.9	8.1e-78
WP_006248939.1|1061994_1063236_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.6	2.2e-55
WP_006248940.1|1063548_1063875_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
1063294:1063313	attR	CGTGTAACTAAACGTGTAAC	NA	NA	NA	NA
WP_006248941.1|1063980_1065900_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.4	3.8e-38
WP_006248942.1|1065972_1066800_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_006248943.1|1066818_1067901_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.1	7.2e-87
WP_006248944.1|1067903_1071281_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_006248945.1|1071273_1072692_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_006248946.1|1072701_1073268_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_006253612.1|1073386_1074169_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1074178_1074907_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1075042_1076062_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1076063_1076666_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1076794_1076950_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1077027_1077609_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1077623_1078271_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1078374_1079004_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1079118_1080171_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
WP_006248956.1|1080272_1081328_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_006248957.1|1081327_1081816_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_006248958.1|1081825_1083163_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	4.6e-83
WP_006248959.1|1083249_1084035_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_006248960.1|1084159_1084960_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_006248961.1|1084994_1085888_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_006248962.1|1085893_1086124_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_006251553.1|1086248_1087037_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_006253613.1|1087069_1089019_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_006248834.1|1089089_1090007_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_006248835.1|1090019_1090382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253614.1|1090619_1091342_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_006248838.1|1091402_1091717_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_006248840.1|1091843_1092602_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_006248841.1|1092666_1093707_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_006248842.1|1093890_1095222_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	80.2	8.4e-53
WP_006248843.1|1095311_1095776_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.1	2.9e-45
WP_006248845.1|1095921_1096425_+	colicin V biosynthesis protein	NA	NA	NA	NA	NA
WP_006248846.1|1096439_1097957_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	1.4e-83
WP_006248847.1|1097990_1098440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248848.1|1098452_1099559_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_006251679.1|1099863_1101456_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	40.6	7.5e-32
WP_012340861.1|1101950_1102775_+	ParA family protein	NA	NA	NA	NA	NA
WP_012340860.1|1102786_1104148_+	replicative DNA helicase	NA	O80281	Escherichia_phage	45.5	6.7e-98
WP_012340859.1|1104156_1105803_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012340858.1|1105795_1106353_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_014325837.1|1106511_1107702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340856.1|1107880_1108639_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012340855.1|1108647_1109133_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_012340854.1|1109488_1109941_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	57.4	4.0e-39
WP_011200812.1|1110247_1110436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011200813.1|1110476_1110779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011200814.1|1110778_1112089_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.5	2.1e-96
WP_014325836.1|1112184_1113387_-	tetracycline efflux MFS transporter Tet(H)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.7	1.5e-08
WP_006248868.1|1113478_1114102_+	tetracycline resistance transcriptional repressor TetR(H)	NA	NA	NA	NA	NA
WP_001067858.1|1114355_1115060_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014325835.1|1115143_1116028_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|1116083_1117559_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067855.1|1117921_1118626_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1163868	1181599	2713886	transposase,integrase	Staphylococcus_phage(28.57%)	18	1164601:1164615	1182474:1182488
WP_014325826.1|1163868_1164633_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
1164601:1164615	attL	GAAATGTTGAGAGAG	NA	NA	NA	NA
WP_075266381.1|1164810_1165785_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_014325825.1|1165899_1166805_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_075266406.1|1166948_1167194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1167224_1168718_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1168829_1169135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|1169162_1170377_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|1170653_1171538_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|1171858_1172083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|1172165_1173458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|1173620_1174466_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1174634_1175438_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1175437_1176274_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|1176609_1177425_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|1178341_1179352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075266381.1|1179452_1180427_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_087437310.1|1180396_1180621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|1180699_1181599_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
1182474:1182488	attR	GAAATGTTGAGAGAG	NA	NA	NA	NA
>prophage 6
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1293757	1385288	2713886	head,tail,capsid,terminase,tRNA,integrase,portal,holin,plate,transposase	Mannheimia_phage(88.61%)	108	1362669:1362685	1388193:1388209
WP_006249379.1|1293757_1295161_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1295633_1296623_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1296619_1296877_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1296903_1297395_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1297894_1298359_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1298342_1298546_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1298542_1299070_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1299147_1299600_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1299809_1300445_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1300441_1301236_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1301276_1302227_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1302239_1302452_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1302585_1303065_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1303061_1303421_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1303424_1303931_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1304499_1304736_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1305117_1305348_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1305639_1305915_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1305923_1306229_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_020910232.1|1306366_1307407_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006249172.1|1307628_1308147_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249171.1|1308216_1308807_-	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249169.1|1309990_1310629_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249168.1|1310619_1311606_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249167.1|1311710_1313156_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249166.1|1313226_1314096_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249165.1|1314104_1315265_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249164.1|1315557_1316787_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249163.1|1316889_1319703_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_095578364.1|1319867_1320614_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249161.1|1320838_1322368_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_006249160.1|1322377_1323061_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249159.1|1323145_1324867_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_031192872.1|1324994_1325843_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006249157.1|1325930_1326749_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_015587056.1|1326751_1328443_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249155.1|1328493_1329012_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006249154.1|1329054_1329654_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249153.1|1329650_1329971_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249152.1|1329974_1330427_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249151.1|1330467_1331049_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006248209.1|1331357_1332317_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_006253548.1|1332309_1334061_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248207.1|1334063_1335029_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248206.1|1335015_1335909_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248205.1|1335979_1337032_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248204.1|1337040_1337271_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248203.1|1337400_1338483_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1338569_1338965_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248201.1|1339189_1340194_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248200.1|1340969_1342010_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006250768.1|1342018_1343857_-|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248198.1|1343970_1344798_+|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006248197.1|1344811_1345840_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006250770.1|1345849_1346539_+|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248195.1|1346650_1347166_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250771.1|1347162_1347375_+|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006250772.1|1347380_1347587_+|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250773.1|1347579_1348146_+	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006248210.1|1348142_1348598_+	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006248194.1|1348746_1348968_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248193.1|1348964_1349450_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_062716029.1|1349442_1349901_+	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	99.3	9.8e-78
WP_006248191.1|1349951_1350230_-	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006250778.1|1353242_1353422_+	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_021265529.1|1353414_1353684_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LP36	Mannheimia_phage	91.7	3.6e-40
WP_020910232.1|1353718_1354759_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006248188.1|1355038_1355644_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006248187.1|1355643_1355979_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248186.1|1355975_1356893_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248185.1|1356879_1357512_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_015981653.1|1357514_1359794_+|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248181.1|1359794_1360037_+	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_006248179.1|1360438_1361620_+|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248178.1|1361628_1362135_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248177.1|1362213_1362528_+|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_075270712.1|1362551_1362668_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
1362669:1362685	attL	AACAAGCGGTCGTTTTT	NA	NA	NA	NA
WP_006253663.1|1362731_1363079_+	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_006248175.1|1363080_1363518_+|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006248174.1|1363517_1364756_+	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248173.1|1364938_1365745_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248172.1|1365779_1366040_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006253662.1|1366139_1366550_-	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248170.1|1366567_1367086_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006248169.1|1367089_1367776_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248168.1|1367899_1368112_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006253660.1|1368210_1368456_-	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248166.1|1368588_1368861_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006248165.1|1368943_1369276_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248164.1|1369288_1369582_+	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248162.1|1369733_1369976_+	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248161.1|1369972_1370305_+	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248160.1|1370301_1372662_+	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248159.1|1372674_1373007_+	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248158.1|1373006_1373459_+	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248157.1|1373469_1373802_+	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248156.1|1373791_1374061_+	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248155.1|1374035_1374326_+	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248154.1|1374595_1374778_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248153.1|1375055_1376054_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248152.1|1376421_1377222_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_062715986.1|1377313_1379290_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248149.1|1379449_1379728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248148.1|1379752_1380049_+	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248147.1|1380101_1380893_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006251533.1|1381036_1381810_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248145.1|1382040_1382466_+	universal stress protein	NA	NA	NA	NA	NA
WP_006248143.1|1382660_1385288_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
1388193:1388209	attR	AACAAGCGGTCGTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1550692	1663578	2713886	tail,terminase,tRNA,integrase,protease,portal,holin,transposase	Mannheimia_phage(55.22%)	130	1631697:1631730	1655010:1655043
WP_015587044.1|1550692_1551733_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253551.1|1551935_1553252_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_006253552.1|1553380_1553566_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_006249010.1|1553681_1555004_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_006249011.1|1555219_1555543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249013.1|1556834_1557053_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_006249014.1|1557108_1557690_+	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	52.1	5.6e-54
WP_006249015.1|1557780_1558899_-	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	28.2	1.3e-06
WP_006249016.1|1558988_1560437_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.1	7.1e-13
WP_006249017.1|1560583_1562281_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_006249018.1|1562424_1562976_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249019.1|1563074_1563884_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006249020.1|1563900_1564593_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_006249021.1|1564679_1565762_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249022.1|1565850_1566690_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249023.1|1566841_1569502_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249024.1|1569512_1569995_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249025.1|1570051_1571170_-	ribonuclease D	NA	NA	NA	NA	NA
WP_006249026.1|1571303_1572491_+	ROK family protein	NA	NA	NA	NA	NA
WP_006249027.1|1572538_1573261_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249028.1|1573309_1573519_-	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249029.1|1573670_1574426_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249030.1|1574456_1575533_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249031.1|1575546_1576485_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249032.1|1576534_1579141_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249033.1|1579270_1580161_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249034.1|1580210_1580471_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249035.1|1580550_1581510_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006251052.1|1581706_1582114_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249369.1|1582113_1582758_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006249370.1|1582931_1583429_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_015484189.1|1583443_1584409_+	asparaginase	NA	NA	NA	NA	NA
WP_006249372.1|1584427_1585516_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006249373.1|1585736_1586147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249374.1|1586149_1588168_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249376.1|1588406_1588643_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_080628642.1|1588805_1589651_+	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006253556.1|1589664_1590858_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_015484185.1|1590868_1591219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484184.1|1591215_1591488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1591523_1592342_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_006249381.1|1592353_1592953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249380.1|1592949_1594497_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_015484183.1|1594916_1595507_+	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249172.1|1595576_1596095_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484180.1|1596641_1596935_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006250517.1|1597049_1597649_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|1597649_1598093_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_147008794.1|1598092_1601086_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.7	0.0e+00
WP_075272501.1|1601082_1604814_-	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_006249176.1|1604823_1605453_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_020828760.1|1605721_1606453_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249178.1|1606456_1607173_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1607172_1607502_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1607501_1611068_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1611121_1611349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1611411_1611642_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1611686_1612088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1612171_1612813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1612840_1613236_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1613232_1613757_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1613760_1614063_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1614055_1614379_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1614452_1616414_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1616425_1617925_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1617924_1618149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1618145_1620257_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1620256_1620733_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1620880_1621279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824324.1|1621414_1621648_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	86.5	7.0e-32
WP_006249197.1|1621592_1621943_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1621943_1622540_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1622529_1622877_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1623040_1623847_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1623926_1624286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1624275_1624635_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1624627_1625656_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1625725_1626298_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1626294_1626930_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1626917_1627709_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1627705_1628467_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1628515_1628740_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1628866_1629598_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1629602_1630106_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1630102_1631215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1631478_1631709_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
1631697:1631730	attL	CTACATTCACTAAGAATTTTTATCAAAGCCCTTT	NA	NA	NA	NA
WP_006248786.1|1632161_1632413_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1632415_1632691_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1632904_1633090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1633073_1633271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1633273_1633732_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1633767_1634127_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1634196_1635000_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1635109_1635628_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1635624_1635825_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1635808_1636306_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1636309_1636498_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1636629_1637007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1637236_1638076_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1638323_1639001_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1639239_1639677_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1639669_1639963_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1639965_1640175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1640321_1640447_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1640493_1641336_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1641398_1641890_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1641915_1642191_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1642150_1643206_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
WP_006248812.1|1643332_1644406_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248814.1|1644673_1645357_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248815.1|1645393_1646233_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248816.1|1646302_1646704_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006253512.1|1647140_1648673_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248819.1|1648898_1649651_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248820.1|1649662_1650853_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248821.1|1650854_1651661_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006253513.1|1651710_1653117_+	YdgA family protein	NA	NA	NA	NA	NA
WP_015587044.1|1653183_1654224_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253274.1|1654361_1655006_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1655341_1655761_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
1655010:1655043	attR	AAAGGGCTTTGATAAAAATTCTTAGTGAATGTAG	NA	NA	NA	NA
WP_006250075.1|1655799_1655982_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250077.1|1656113_1656611_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1656603_1656984_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1657058_1657742_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1657872_1658073_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1658474_1659161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1659337_1659637_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015484247.1|1659608_1659998_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1660141_1660435_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247813.1|1660719_1663578_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
>prophage 8
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1669854	1745751	2713886	tail,terminase,tRNA,integrase,transposase	Mannheimia_phage(92.96%)	87	1669152:1669211	1691632:1693680
1669152:1669211	attL	GGGTATCCGGATTTAGCGGTTGATCTGCGCTAGACGTAATTTTGTAAATAAACCGGATTT	NA	NA	NA	NA
WP_011200814.1|1669854_1671165_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.5	2.1e-96
WP_006247822.1|1671203_1672244_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
WP_006247823.1|1672265_1672487_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247824.1|1672536_1672920_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006253375.1|1673437_1674139_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247827.1|1674683_1674899_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253371.1|1675360_1675549_+	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006250263.1|1675552_1676017_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1676000_1676204_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1676200_1676728_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1676805_1677258_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1677467_1678103_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1678099_1678894_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1678934_1679885_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1679897_1680110_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1680243_1680723_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1680719_1681079_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1681082_1681589_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1682157_1682394_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1682775_1683006_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1683297_1683573_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1683581_1683887_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_015587023.1|1684024_1685065_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006250077.1|1685174_1685672_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1685664_1686045_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1686095_1686755_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1686884_1687091_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1687111_1687372_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1687680_1688550_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1688546_1689908_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1689904_1690441_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1690531_1690747_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1690730_1691237_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1691286_1691499_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_011200812.1|1691803_1691992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011200813.1|1692032_1692335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011200814.1|1692334_1693645_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.5	2.1e-96
WP_006250093.1|1693918_1694488_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
1691632:1693680	attR	GGGTATCCGGATTTAGCGGTTGATCTGCGCTAGACGTAATTTTGTAAATAAACCGGATTTTAGGGTTGACGGAAAAGGCCAGATGCCCTAATATTAGATTCAAGAGCTGAGAACAACGGCTCGGGCATAAGCCCAACGGGCGCACCGCCGAACTTGGTGCAGGATAGAAGCCATGTCATACGATGCAAATGATGCGCTGAATGAAATCGAAGAGGCGCTTAGCGAGCTTGAAAGGGTTGCTGAAGACCTAATCAACAACAACCCGAATAAAGAATCAGAATTACGCGGCCAAGGGGTTCACCAAGCGACAAAGCACCTCCGTTTTCGTATTCGCAACATCCGCCGCGGCGAAGCAATTTGACTAACATGCCGCCCTAGGGGCGGCTTTCAGCGAGGTCAGCATGAAAATCAAACTCTATTTTCCGGACGAGTCTATCGCCACGATAAAGCGAATGGGGCTTCGCCAAATGTCTCCCGAGACTCTCAGGTGGACTGCCGATCATCCGTCAAGCAGCTATGGTATGGGCGCTTTGCTCAGAGGCAAGTCTGGTGAAATCCTTGATGGGAAGTCTTTTGCTGCAATGGTGCATGCCTTTGGCGCGTGGATTGAAACAGACAGTGAAGATACCAGTCGTCGAGTTCATAACGCGCTAGTCACTGCTGCCACTGGCACCGAGGAATCGGTTAAGGTGGCAAAGGAGTAATGTCGAATATCCTCAACTGGCCTGATTACAAAGTGCTCCAGGTATCCGAACTGGAGCACGATTACCAGGTACACGCCGAAGTTTCCGAACCGCCTACGCAGTGCCCCCACTGCAATCATCCTGAAATCGTCGGCTTTGGTCGCCGTGATGAGGTGATCATGGATACACCCGTCCACGGAAGGCGTACCGGCATCATGCTTAACCGCCGTCGCTATCGCTGCCAGTCTTGCCGAAAGACGTTTCTGGAGCCTGTACCGCACAAAGACGAAAAGCGGCAGATGACCAACCGCCTGATCCAGTACATCGAGCGCGAGAGCCTGCGCCGCACGTTCTCCAGTGTTGCCGAGGATGTGGGCGTCGATGAAAAGACCGTCCGTAACATTTTCAACGACTATTGTGAACGCCTCGAAAAGACGCTCAATTTTGAAATGCCGCAGTGGTTGGGTATCGACGAAATCCACATCATCAAACCCCGCTGCGTGATCACCAACATTCAGCAGCAGACCATTGTGGACATGCTGGATAACCGCAATAAAACCACCGTCACCCGCTACCTGAGCAAACGCACTGACCGCGACCTGGTGCGCTACGTGGCAATGGATATGTGGAGGCCGTACCGGCAAGCAGTAGAAACCATGATTCCTGACGCCACGGTGATCATCGACAAGTTCCACGTTGTCAGGATGGCGAACGAATCACTGGAACGCGCCAGAAAAGCCATCAGAAGCGCCCTGACGCCACAGCAGCGCCGTGGGTTGATGCGAGATAGGTTTGTCCTACTGAAACGCCGTCACGAGCTGACAGATGCCGAATACATGCGTTTTTCAGGCTGGACATTGAATTACCCTGAGATTGGCCAAGCCTACGAACTGAAAGAAGCCTTTTTCGAGATTTGGGACTGTCAGACCCGGCACCAGGCACAGGAGGCATATTACTCTTGGCTGCGACAGATTACGCCGGAAATGAAAGCCCACTATGACCCGCTTATCAAAGCGATGGGCAACTGGCACGATGACATTTTCGCTTACTTCGACCACCCCATTACCAACGCCTACACCGAGTCACTGAACAACCTGATTCGTGTTGTTAATCGTGTTGGCCGTGGCTACAGCTTTGAAGCGCTGCGAGCCAAGATCCTGTTTACTGAGGGCTTCCAGAAGATCAAGAAGCCACGCTATCAGCGTCAACGGATACCCGAGGGCGCTATGGGCAGGATGCCGTTCTATGGCGTTGCCGAAGCGGGGCCATCCACTAACTACGGCGCTGACATATCAACACTGGTGCGGGAGATTGAGGCGGGGCGTTTATAGCCCTGTTTCAACCCTGTAATCCGGATACCCCTTTA	NA	NA	NA	NA
WP_062716082.1|1694477_1694930_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	5.1e-79
WP_020910232.1|1695027_1696068_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006251707.1|1696478_1696664_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1697002_1697248_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1697240_1697810_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1697782_1698133_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1698702_1699227_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1699210_1700431_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1700427_1701804_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1701757_1702696_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1702682_1704053_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1704045_1704480_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1704494_1705484_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251227.1|1705767_1706145_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1706144_1706489_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1706490_1706859_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1706855_1707236_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1707239_1707722_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1707761_1708178_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1708233_1708410_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1708505_1709177_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1709191_1709425_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1709593_1710052_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1710596_1713092_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1713095_1713425_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1713424_1713895_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1713902_1714619_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_020828760.1|1714622_1715354_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249176.1|1715622_1716252_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_075272501.1|1716261_1719993_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008795.1|1719989_1723316_+	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_006247812.1|1723438_1723732_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006248119.1|1724036_1725539_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1725692_1727168_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1728644_1728938_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1729004_1730018_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_134916814.1|1730120_1730414_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1730414_1731335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1731361_1732036_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1732035_1732899_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1732908_1734690_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1734711_1735389_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_134983790.1|1737371_1737833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1737991_1739128_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1739174_1739591_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1739652_1740246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1740376_1742665_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1742928_1744692_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1744788_1745751_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1871239	1881556	2713886		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1871239_1872214_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1872216_1872414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1872397_1872583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1873228_1873825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1873860_1874598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1874749_1875124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1875135_1875792_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1875916_1876105_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1876162_1876846_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1876842_1877889_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1877899_1878493_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1880602_1880926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1881006_1881174_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1881181_1881556_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 10
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	1884789	1891733	2713886	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1884789_1885500_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1885757_1886477_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1886698_1887325_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1887373_1887985_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1888095_1888782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1888958_1889258_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1889229_1889619_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1889762_1890056_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1890434_1891733_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 11
NZ_CP017541	Mannheimia haemolytica strain 1450, complete genome	2713886	2326171	2334326	2713886	terminase,integrase	Synechococcus_phage(16.67%)	12	2329377:2329436	2334742:2334815
WP_006250276.1|2326171_2326711_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2326848_2327139_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2327110_2327413_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2327430_2327724_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2327674_2327887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2327889_2328849_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2329377:2329436	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2329655_2330882_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2331156_2331375_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2331487_2331811_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2332205_2332892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2333211_2333637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2333633_2334326_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2334742:2334815	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
