The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	44706	52033	2641287	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|44706_44949_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44949_47010_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|47006_47564_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47512_48508_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48560_48749_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48778_49147_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49146_49521_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|50010_50814_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50858_51137_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51313_52033_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	574299	658271	2641287	transposase,protease,tRNA,head,plate,tail	Mannheimia_phage(17.02%)	92	NA	NA
WP_006249683.1|574299_574977_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|575190_575409_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|575418_577389_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|577568_578057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|578088_579030_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|579032_579347_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|579358_579595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|579578_579872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|579993_580212_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|580221_580404_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|580420_580810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|580858_581146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|581264_581810_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|581796_582330_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|582494_582854_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|582989_583499_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|583501_583771_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|583764_584112_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|584290_584626_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|584627_584924_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|584946_585519_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|585518_587075_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|587193_588648_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|588640_589918_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|590119_590464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|590527_590992_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|591226_592342_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|592372_593299_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|593367_593649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|593648_594083_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|594088_594586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|594670_596056_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|596066_596582_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|596677_596992_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|596988_597141_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|597119_597422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147010026.1|597469_600127_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|600136_601060_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|601043_601271_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|601263_602328_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|602314_602851_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|602905_603268_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|603277_604381_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|604373_604940_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|604949_607229_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|607229_607832_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|607815_608091_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|608090_608378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|608544_609249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|609612_610401_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|610437_612876_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_147010027.1|613195_614962_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|615116_616028_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|616150_617233_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|617320_618190_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|618243_618738_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|618938_619763_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|619852_622177_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_147008890.1|622411_623437_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.9	1.7e-90
WP_006250031.1|623685_624426_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_147010028.1|624556_626623_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|626744_627902_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|627960_628176_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|628365_629181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|629242_629887_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|629998_631702_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|631736_632135_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|632162_633299_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|633295_634111_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|634110_634992_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|634988_635657_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|636000_637284_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|637449_641166_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|641273_643277_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_020831139.1|643375_644743_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|644756_645491_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|645493_646129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249329.1|646396_647134_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|647130_648099_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|648279_648615_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|648598_648922_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|648911_650798_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|650845_651628_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|651676_652837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|652896_653913_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|654000_654162_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|654139_655141_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|655142_655547_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|655681_655864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|655867_656197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|656232_656985_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|657023_658271_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	989005	995790	2641287		Organic_Lake_phycodnavirus(16.67%)	9	NA	NA
WP_006248955.1|989005_990058_-	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
WP_006248954.1|990172_990802_-	amino acid transporter	NA	NA	NA	NA	NA
WP_006248953.1|990905_991553_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248952.1|991567_992149_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248951.1|992226_992382_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248950.1|992510_993113_-	DedA family protein	NA	NA	NA	NA	NA
WP_006248949.1|993114_994134_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248948.1|994269_994998_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006253612.1|995007_995790_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
>prophage 4
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	1234055	1332081	2641287	terminase,integrase,capsid,transposase,protease,tRNA,tail	Mannheimia_phage(84.42%)	114	1233841:1233859	1255987:1256005
1233841:1233859	attL	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250229.1|1234055_1235006_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1235016_1235676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1235685_1235892_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_006250224.1|1236361_1237576_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1237947_1238685_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1238716_1239103_-	RidA family protein	NA	NA	NA	NA	NA
WP_006249038.1|1239183_1240185_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249037.1|1240251_1240593_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1240785_1242126_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1242287_1243253_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1243519_1245190_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1245350_1245794_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1245844_1246420_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1246526_1247417_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1247483_1248050_-	elongation factor P	NA	NA	NA	NA	NA
WP_006253558.1|1248216_1248786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249378.1|1248839_1249832_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1249931_1251335_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1251808_1252798_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1252794_1253052_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1253078_1253570_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1254069_1254534_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1254517_1254721_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1254717_1255245_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1255322_1255775_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1255984_1256620_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
1255987:1256005	attR	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250257.1|1256616_1257411_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250256.1|1258062_1258275_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1258408_1258888_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1258884_1259244_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1259247_1259754_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1260322_1260559_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1260940_1261171_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1261462_1261738_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1261746_1262052_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_015586954.1|1262189_1263230_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_020824298.1|1263339_1263837_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_006248823.1|1263829_1264210_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1264260_1264920_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1265049_1265256_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1265276_1265537_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1265845_1266715_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1266711_1268073_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1268069_1268606_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1268696_1268912_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1268895_1269402_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1269451_1269664_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250091.1|1269709_1269904_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250093.1|1270031_1270601_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250094.1|1270590_1271064_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006251707.1|1271383_1271569_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1271907_1272153_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1272145_1272715_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1272687_1273038_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1273607_1274132_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1274115_1275336_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1275332_1276709_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1276662_1277601_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1277587_1278958_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1278950_1279385_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1279399_1280389_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251227.1|1280672_1281050_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1281049_1281394_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1281395_1281764_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1281760_1282141_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1282144_1282627_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1282666_1283083_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1283138_1283315_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1283410_1284082_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1284096_1284330_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1284498_1284957_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1285501_1287997_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1288000_1288330_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1288329_1288800_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1288807_1289524_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_147010038.1|1289527_1290259_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	98.8	4.6e-146
WP_006249176.1|1290527_1291157_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_147010039.1|1291166_1297889_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	99.7	0.0e+00
WP_100067196.1|1297888_1298332_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1298332_1298932_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1299046_1299340_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1299886_1300405_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484183.1|1300474_1301065_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249380.1|1301484_1303032_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1303028_1303628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1303639_1304458_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1304493_1304766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1304762_1305113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1305123_1306317_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1306330_1307176_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1307338_1307575_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1307813_1309832_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1309834_1310245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1310465_1311554_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1311572_1312538_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1312552_1313050_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1313223_1313868_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1313867_1314275_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1314471_1315431_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1315510_1315771_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1315820_1316711_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1316840_1319447_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1319496_1320435_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249030.1|1320448_1321525_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1321555_1322311_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1322462_1322672_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1322720_1323443_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1323490_1324678_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1324811_1325930_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1325986_1326469_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1326479_1329140_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1329291_1330131_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1330219_1331302_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1331388_1332081_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	1508307	1551367	2641287	terminase,integrase,capsid,tRNA,head,holin,plate,tail,portal	Mannheimia_phage(92.31%)	58	1505387:1505403	1530911:1530927
1505387:1505403	attL	AAAAACGACCGCTTGTT	NA	NA	NA	NA
WP_006248143.1|1508307_1510935_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1511129_1511555_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1511785_1512559_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1512702_1513494_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1513546_1513843_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1513867_1514146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1514305_1516282_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1516373_1517174_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1517541_1518540_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1518817_1519000_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1519269_1519560_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1519534_1519804_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1519793_1520126_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1520136_1520589_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1520588_1520921_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1520933_1523294_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1523290_1523623_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1523619_1523862_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1524013_1524307_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1524319_1524652_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1524734_1525007_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1525139_1525385_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1525483_1525696_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_147010041.1|1525819_1526506_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	99.6	1.2e-127
WP_006248170.1|1526509_1527028_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1527045_1527456_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1527555_1527816_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1527850_1528657_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1528839_1530078_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1530077_1530515_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1530516_1530864_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1530927_1531044_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
1530911:1530927	attR	AAAAACGACCGCTTGTT	NA	NA	NA	NA
WP_006248177.1|1531067_1531382_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1531460_1531967_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1531975_1533157_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_147010042.1|1533455_1533641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248181.1|1533594_1533837_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1533837_1536117_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_147009206.1|1536119_1536665_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	98.9	7.8e-98
WP_006248186.1|1536651_1537569_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1537565_1537901_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1537900_1538506_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1538634_1538922_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006248190.1|1539155_1542068_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1542106_1542385_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1542435_1542894_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1542886_1543372_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1543368_1543590_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1543738_1544194_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1544190_1544757_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1544749_1544956_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1544961_1545174_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1545170_1545686_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1545797_1546487_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1546496_1547525_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1547538_1548366_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1548479_1550318_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1550326_1551367_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
>prophage 6
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	1588327	1598722	2641287	transposase,integrase	Mannheimia_phage(66.67%)	13	1589909:1589925	1608590:1608606
WP_006247813.1|1588327_1591186_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
1589909:1589925	attL	ACAAGCGGTCAAATTTA	NA	NA	NA	NA
WP_006247812.1|1591470_1591764_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1591907_1592297_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1592268_1592568_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1592744_1593431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1593832_1594033_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1594163_1594847_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1594921_1595302_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1595294_1595792_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1595923_1596106_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1596144_1596564_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006253274.1|1596899_1597544_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_147010043.1|1597681_1598722_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	9.4e-201
1608590:1608606	attR	TAAATTTGACCGCTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	1608650	1728134	2641287	terminase,integrase,transposase,tRNA,holin,tail,portal	Mannheimia_phage(43.1%)	114	1637555:1637614	1737701:1737832
WP_006248119.1|1608650_1610153_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1610306_1611782_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1613189_1613483_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1613549_1614563_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_134916814.1|1614665_1614959_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1614959_1615880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1615906_1616581_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1616580_1617444_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1617453_1619235_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1619278_1619956_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_134983790.1|1621938_1622400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1622558_1623695_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1623741_1624158_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1624219_1624813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1624943_1627232_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1627495_1629259_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1629355_1630318_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006248099.1|1630370_1632803_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_006248098.1|1632934_1635571_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.9	4.3e-141
WP_006250663.1|1635580_1637413_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
1637555:1637614	attL	GCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGT	NA	NA	NA	NA
WP_006248097.1|1637885_1638761_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006248096.1|1638753_1639515_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248095.1|1639581_1640949_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248094.1|1640982_1641612_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248093.1|1641743_1643408_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248092.1|1643407_1645174_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006253502.1|1645288_1649386_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_147008908.1|1649466_1651302_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_006248088.1|1651313_1652159_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248087.1|1652159_1653323_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248086.1|1653490_1654174_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248085.1|1654310_1654868_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248084.1|1654919_1655636_-	UMP kinase	NA	NA	NA	NA	NA
WP_006248083.1|1655727_1657290_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248082.1|1657353_1658205_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_006253501.1|1658300_1659020_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006253500.1|1659364_1660393_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248079.1|1660515_1662162_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006248078.1|1662171_1663182_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248077.1|1663191_1663818_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248076.1|1663879_1665370_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248075.1|1665428_1666664_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248074.1|1666751_1667474_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248073.1|1667703_1668621_-	GTPase Era	NA	NA	NA	NA	NA
WP_006248072.1|1668723_1669398_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248071.1|1669443_1670403_-	signal peptidase I	NA	NA	NA	NA	NA
WP_006253499.1|1670489_1672283_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248069.1|1672555_1673785_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253498.1|1673978_1676210_+	collagen-binding protein	NA	NA	NA	NA	NA
WP_147010044.1|1677354_1678287_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	97.0	4.6e-167
WP_006252769.1|1678528_1678969_+	DoxX family protein	NA	NA	NA	NA	NA
WP_006248065.1|1678994_1679282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248064.1|1679382_1680306_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_006248063.1|1680295_1681036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248062.1|1681836_1682007_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_006247812.1|1682274_1682568_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006249176.1|1689751_1690381_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_147010038.1|1690649_1691381_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	98.8	4.6e-146
WP_006249178.1|1691384_1692101_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1692100_1692430_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1692429_1695996_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1696049_1696277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1696339_1696570_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1696614_1697016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1697099_1697741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1697768_1698164_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1698160_1698685_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1698688_1698991_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1698983_1699307_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1699380_1701342_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1701353_1702853_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1702852_1703077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1703073_1705185_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1705184_1705661_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1705808_1706207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147010045.1|1706342_1706576_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	85.1	3.5e-31
WP_006249197.1|1706520_1706871_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1706871_1707468_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1707457_1707805_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1707968_1708775_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1708854_1709214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1709203_1709563_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1709555_1710584_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1710653_1711226_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1711222_1711858_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1711845_1712637_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1712633_1713395_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1713443_1713668_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1713794_1714526_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1714530_1715034_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1715030_1716143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1716406_1716637_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1717089_1717341_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1717343_1717619_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1717832_1718018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1718001_1718199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1718201_1718660_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1718695_1719055_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1719124_1719928_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1720037_1720556_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1720552_1720753_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1720736_1721234_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1721237_1721426_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1721557_1721935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1722164_1723004_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1723251_1723929_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1724167_1724605_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1724597_1724891_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1724893_1725103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1725249_1725375_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1725421_1726264_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1726326_1726818_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1726843_1727119_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1727078_1728134_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1737701:1737832	attR	ACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCAC	NA	NA	NA	NA
>prophage 8
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	1801999	1812316	2641287		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1801999_1802974_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1802976_1803174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1803157_1803343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1803988_1804585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1804620_1805358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1805509_1805884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1805895_1806552_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1806676_1806865_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1806922_1807606_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1807602_1808649_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1808659_1809253_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1811362_1811686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1811766_1811934_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1811941_1812316_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 9
NZ_CP017540	Mannheimia haemolytica strain 1451, complete genome	2641287	2255730	2263885	2641287	terminase,integrase	Synechococcus_phage(16.67%)	12	2258936:2258995	2264301:2264374
WP_006250276.1|2255730_2256270_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2256407_2256698_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2256669_2256972_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2256989_2257283_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2257233_2257446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2257448_2258408_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2258936:2258995	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2259214_2260441_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2260715_2260934_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2261046_2261370_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2261764_2262451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2262770_2263196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2263192_2263885_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2264301:2264374	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
