The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	693648	746150	3000133	transposase	Bacillus_phage(28.57%)	30	NA	NA
WP_146988304.1|693648_694866_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.0	2.4e-22
WP_146988306.1|694858_696361_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.8	3.4e-34
WP_010011227.1|696389_696536_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_146988308.1|696599_697529_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	37.1	1.8e-49
WP_146988310.1|697754_699158_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	5.0e-24
WP_010011225.1|699138_699849_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	1.4e-30
WP_146988312.1|700056_701082_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.1e-39
WP_146988315.1|701319_701715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988318.1|702961_703876_-	EamA family transporter	NA	NA	NA	NA	NA
WP_146988320.1|704013_704304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988322.1|704517_707040_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_146988324.1|707154_710700_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	22.3	1.4e-09
WP_146988326.1|710841_714456_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_056980324.1|714471_715053_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_146988328.1|715058_715643_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_003688751.1|716728_717016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010011610.1|717039_717918_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_146988330.1|718174_719248_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	2.8e-43
WP_010010765.1|724935_725259_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_146988332.1|725251_726154_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_146988334.1|726156_729522_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_146988336.1|732844_733219_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_146988338.1|733250_734072_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_146988340.1|734074_735490_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.3	9.2e-58
WP_010011215.1|735514_735862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011214.1|735902_736517_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_146988342.1|737328_738897_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXE4	Bacillus_phage	37.3	2.8e-15
WP_146988312.1|739890_740916_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.1e-39
WP_146988344.1|742889_745004_-	AAA domain-containing protein	NA	K4FB40	Cronobacter_phage	38.6	4.5e-117
WP_146988347.1|745220_746150_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	30.0	3.2e-19
>prophage 2
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	754779	813716	3000133	transposase,protease,integrase	Streptococcus_phage(37.5%)	46	769002:769061	812253:813821
WP_146988355.1|754779_755566_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_035457635.1|756337_758491_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.0e-59
WP_002816262.1|758741_759173_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_099046409.1|759835_760635_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_146988357.1|760830_762165_+	amino acid permease	NA	NA	NA	NA	NA
WP_146988359.1|762190_763414_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_146988362.1|763542_763863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988364.1|763939_764863_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.6	6.9e-30
WP_146988366.1|765034_765469_-	YfhO family protein	NA	NA	NA	NA	NA
WP_099046409.1|765558_766357_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003680692.1|766810_768229_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_082602285.1|768351_768447_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
769002:769061	attL	CTAAACCGTGAAAGTTCAAAACCCAGCTAAACCTGATTGCACTAAGTTATTTTAGCCCAA	NA	NA	NA	NA
WP_099267106.1|769132_770500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_137638872.1|770787_772215_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_146990956.1|773069_774518_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	25.1	1.8e-08
WP_016376044.1|774693_775203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677683.1|776736_777372_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003677685.1|777496_778015_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_146988368.1|778130_778709_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_146988370.1|778710_779328_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_146988372.1|779520_780267_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_146988374.1|781846_782527_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_035456673.1|783401_784076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146988376.1|784072_784966_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.7	6.5e-25
WP_146988378.1|785131_787843_-	HAD-IC family P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.7	1.9e-67
WP_146988380.1|790126_791017_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_010010540.1|791214_791694_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_146988382.1|791743_792421_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988384.1|792565_793207_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_146988386.1|793824_794484_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010010538.1|794464_795148_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003677701.1|795162_795900_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-33
WP_146990958.1|796186_797635_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
WP_010010537.1|797810_798641_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146988388.1|798696_799077_-	glyoxalase	NA	NA	NA	NA	NA
WP_146988391.1|799330_800704_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_146988393.1|800773_801316_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_010010531.1|801299_802763_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146988395.1|802934_804884_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010529.1|804999_805860_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_146988397.1|805874_806720_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_146988399.1|806888_807663_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	1.7e-26
WP_010010527.1|807715_808102_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_010010525.1|808541_809219_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_099267106.1|810813_812181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146988402.1|812879_813716_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
812253:813821	attR	TTGGGCTAAAATAACTTAGTGCAATCAGGTTTAGCTGGGTTTTGAACTTTCACGGTTTAGCTAAGCGATAAAAGCTTTCAAAAACGTTCCCGGTCTGCCCATAACCAGTGGCTTTAGACAAATCGATCGTGTCCAACGCAGCGCTGGCTGGTAAATTCAAAACTTGTTTTGTTGCCGCCTGCTGATTGGAATTCTGTCCACAGGCACTCAACACCCCGACTAATATCACTAACGCCGCACCTGCTAGTACGGATCTTAATTTACGCATACCAAATCTTCCATTCACGCGGTCATTTTCAATTGGACAAAAAAAGCTGCGCCCCCAGCCTAGATTAACTAGACTAGGGACGCAGATTTGCGTGTTACCACCCTGATTCGTGTCGCTAACGACACCTCGCCGGTACGCCAGTCTGTGTCCAGACTTTGATACCCGGCAAAGTAACGCTTGCCCACGAGTTGCTAGCCTATACCAGCAACCTGCTCAGAGCTCATCTTCATGTTCATTGCAACGTGGCTTTTTCAGCTTACCGCCATCTCTGTTCATTGCTCAGCACATTACTCTTCTCGTCAACGCATTGAATTGATCCGCTTTAATTGTGTTTATTATGCAACCAGATAGACTAGCTGTCAATCATTAATTTTGGGCCGTTGGATCTCCCACCAGACAAAACCAGCAATGGCGATCAATAAGACCAATAAAATTACGAAGCCGCCCTCAAAACCAAAAATACCGCCATTGATCAGATCAAAGCCCAGGTGCGAAGTCGTTTTTAAAACCAATGCATCACTAGCGCCACCGGATACTGGTACCCCAAATAGTGGCCCCTCCGCAAAATTCCAGGCACTATGAAAGGCACTCGCGACCCACAAATTAGCAAAACGCAACCGTAGCAGTGTTAACAGAATACTAAAAGCCAGAATGTTAATAAAAGCCAGGCCATTAATCCCCGTATTCATTAAATGCAACCCTGCAAAAACTAGTGAATTAACGATTACCACGACATAGGTCCGTTCGGTTTTAAGTAACTTACCCACTATGTAACCTCGGGTCAGCAGTTCCTCACTGAAGCCTTGAATCACGTAACCGAAAAATAGGATCAGTAACCACAACCAAGCGCCAGAACGCAAGAATGAATGGACAGCTGCCGCATTAAGTCCTAATGTGCCTAACCAGACTAACGTAAAAAAGAACAGTCCAGCAAGATAGGCCCAACCATAGTACCAAAACCATTTTTTGCGTGGAAACGGCAGAACCGCTGGATCTCGCCGACGATAATAAAAATAAAGTAATAGTATTAAAATACCAGTACTGAATAATTCTGCTGCGACTGCACCAAGACCATGATTTAATACTGTGATATGGCGCAAAAGTAAGTACTTGACCAGCAGTGTTAGCAATTGAGCCAGTACAAACCAGCCGATTGCAATTAAAGTAACCTGCACGATCTTTTTAACGTGTTGCATTGTTTTCCTCCATACTAACTAACTTCGGTCGAAATTGGTCCTTAACTAGCTTACGCTAAACATGGGTCATTGTGCAATTATTTTTTAGCTAATCATCATATTTAA	NA	NA	NA	NA
>prophage 3
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	828249	894537	3000133	transposase,integrase	Streptococcus_phage(31.58%)	58	829064:829079	890761:890776
WP_146988438.1|828249_829461_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	8.9e-86
829064:829079	attL	TTCCCGGTATTGGTGA	NA	NA	NA	NA
WP_099236033.1|829660_830329_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_146988441.1|830908_831514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146988443.1|831779_831977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988446.1|832504_833245_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	26.0	1.4e-17
WP_146988448.1|833361_834255_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	30.1	1.7e-25
WP_146988450.1|834251_834926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146988452.1|835053_835815_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988454.1|837447_838296_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_146988456.1|838319_839396_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_146988458.1|839419_840814_-	MFS transporter	NA	NA	NA	NA	NA
WP_146990964.1|841284_842631_+	MFS transporter	NA	NA	NA	NA	NA
WP_146988461.1|842623_843676_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_146988463.1|843690_844650_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_146988465.1|844656_845628_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_146988438.1|846002_847214_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	8.9e-86
WP_146988467.1|847466_847646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988469.1|847635_847995_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_146988471.1|848042_849596_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.2	6.8e-54
WP_010010496.1|849860_850454_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988473.1|850763_854699_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_146988476.1|854745_856293_-	gluconate kinase	NA	NA	NA	NA	NA
WP_146988478.1|856473_857298_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_146988480.1|857327_857912_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_010014482.1|857927_858722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988482.1|858931_859390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146988484.1|859406_860051_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_146988486.1|860228_860666_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988488.1|860665_862102_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.2	2.2e-19
WP_146988490.1|862185_862386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988492.1|862416_862962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988494.1|862951_864919_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	32.6	1.0e-70
WP_002354485.1|865128_865815_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_146990966.1|866030_866510_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_146988496.1|867145_868405_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.6	3.0e-20
WP_010010479.1|868503_869316_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_146988498.1|869451_870276_-	regulator	NA	NA	NA	NA	NA
WP_146988500.1|870275_871598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988502.1|871587_873468_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	3.2e-34
WP_010014501.1|873704_874415_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	7.9e-42
WP_146988504.1|875090_875888_+	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_003680679.1|876147_877440_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.4e-65
WP_010010471.1|878658_879201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010469.1|879334_879802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988506.1|879850_881143_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010010467.1|881597_881855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141707574.1|881861_882008_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003680228.1|882152_883559_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.1	3.0e-125
WP_003680229.1|883754_884207_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_146988508.1|884270_886283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988510.1|886778_887534_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	94.8	1.1e-131
WP_146988511.1|887587_887839_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_146988513.1|887863_888268_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BW99	unidentified_phage	46.9	8.5e-09
WP_003680800.1|888403_888649_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_146988516.1|888678_889233_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	61.4	1.4e-41
WP_003680796.1|889273_889573_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003677393.1|889895_892457_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.9	9.6e-114
890761:890776	attR	TTCCCGGTATTGGTGA	NA	NA	NA	NA
WP_146988518.1|892584_894537_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.1	1.5e-143
>prophage 4
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	902339	966515	3000133	transposase,tRNA	Planktothrix_phage(20.0%)	52	NA	NA
WP_010010454.1|902339_903731_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003677377.1|903800_905708_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_099235709.1|905816_906758_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_146988525.1|906802_907477_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	2.3e-35
WP_146988527.1|907479_908541_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_146988529.1|908541_909063_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988531.1|909205_909937_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_146988533.1|909936_911406_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_146988535.1|911606_912026_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146988537.1|912097_914488_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_146988539.1|914846_916034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677358.1|916115_916943_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_146988541.1|917109_917766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988544.1|917849_920099_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A2R4A262	Mycobacterium_phage	31.9	1.9e-81
WP_146988546.1|920404_921601_+	MFS transporter	NA	NA	NA	NA	NA
WP_003677353.1|921949_922618_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_146990968.1|922651_925396_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_146990970.1|925738_928045_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_146988548.1|928237_928939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988551.1|929853_930381_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146988553.1|930494_931595_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_146988556.1|931591_932356_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_146988558.1|932399_932969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010014308.1|934047_934422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035456771.1|934418_934808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010014305.1|935663_936365_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.4e-35
WP_146988561.1|936373_938917_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_146988563.1|939232_940585_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	31.6	3.0e-05
WP_146988565.1|940642_941077_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.5	4.1e-41
WP_146988567.1|941481_942621_+	serine hydrolase	NA	NA	NA	NA	NA
WP_146988570.1|943019_943835_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_146988572.1|943836_944580_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	37.0	7.5e-27
WP_146990972.1|944630_945347_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_146988574.1|945367_946066_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_146988577.1|946126_947305_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_146988579.1|947304_948459_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_146988582.1|948487_949423_+	beta-1,6-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_146988584.1|949406_950312_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_146988587.1|950333_951275_+	SP_1767 family glycosyltransferase	NA	A0A1V0SAI7	Catovirus	33.3	3.0e-20
WP_146988589.1|951292_952477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988592.1|952492_953413_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_146988594.1|953409_954393_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.8	4.0e-76
WP_146988597.1|954632_954956_+	VanZ family protein	NA	NA	NA	NA	NA
WP_146988599.1|955351_955561_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_010015028.1|955635_956985_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146990974.1|957137_957278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146988601.1|958935_960177_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	7.6e-48
WP_146988603.1|960487_961270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988605.1|962263_963262_+	glycosyltransferase family 92 protein	NA	NA	NA	NA	NA
WP_056943351.1|964025_964211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990976.1|964207_964966_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_146988607.1|964952_966515_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	35.9	1.8e-70
>prophage 5
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	969648	1039143	3000133	transposase,tRNA	Lactobacillus_phage(15.79%)	53	NA	NA
WP_125553116.1|969648_970860_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	2.0e-85
WP_146988616.1|971112_971292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679178.1|971281_971641_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_146988618.1|971688_973242_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.5	4.7e-55
WP_010010402.1|973639_974173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988620.1|974717_975350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146988622.1|975591_975846_-	DUF2922 family protein	NA	NA	NA	NA	NA
WP_146988624.1|976328_976532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010398.1|976776_977274_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010010397.1|977556_978369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010396.1|978642_979524_+	(S)-ureidoglycine aminohydrolase	NA	A0A1P8VVR3	Streptococcus_phage	38.2	4.6e-07
WP_146988626.1|979507_980839_+	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	42.2	2.0e-70
WP_146988628.1|980868_981054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010391.1|981348_981564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821209.1|982166_983117_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	7.2e-99
WP_146988630.1|983131_984058_-	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	31.4	3.2e-35
WP_146988632.1|984164_986333_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.8	8.4e-252
WP_146988634.1|986339_986792_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_146988636.1|989741_990809_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.6	1.5e-39
WP_146988639.1|990809_991412_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.5	3.0e-26
WP_146988641.1|991413_992625_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	4.4e-85
WP_146988643.1|992624_993092_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	3.0e-34
WP_146988645.1|993995_995513_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_146988648.1|995527_997390_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_146990978.1|997401_998244_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002816285.1|998505_998757_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_146988650.1|998810_999551_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.0	2.8e-135
WP_146988652.1|1000038_1006446_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_146988654.1|1009414_1011208_-	adenine deaminase	NA	NA	NA	NA	NA
WP_035457728.1|1011227_1012562_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.2	1.1e-44
WP_146988657.1|1012762_1013797_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_146988660.1|1015234_1016260_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.7	9.0e-39
WP_003677837.1|1016490_1016958_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_146988662.1|1017323_1017677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010012274.1|1017908_1018598_+	VIT family protein	NA	NA	NA	NA	NA
WP_146988664.1|1018621_1019326_+	VIT family protein	NA	NA	NA	NA	NA
WP_146988666.1|1019392_1020784_+	MFS transporter	NA	NA	NA	NA	NA
WP_146988668.1|1020802_1022080_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	2.2e-98
WP_146988670.1|1022420_1023344_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.6	5.3e-30
WP_003132716.1|1023447_1025127_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_146988672.1|1025294_1026437_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146988674.1|1026598_1027420_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_146988677.1|1027453_1027969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146988680.1|1028037_1029177_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_146988682.1|1029169_1029709_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_035457020.1|1029744_1030563_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_146988684.1|1030978_1031707_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_146988686.1|1031897_1033094_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_003677813.1|1033330_1033663_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_146988688.1|1033982_1034582_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	1.3e-24
WP_146988690.1|1034518_1035427_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146988692.1|1036933_1037575_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003677807.1|1037889_1039143_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	40.3	7.6e-80
>prophage 6
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	1240044	1283219	3000133	transposase,integrase	Streptococcus_phage(20.0%)	35	1233662:1233676	1263404:1263418
1233662:1233676	attL	CTTAGATGAAGTCCA	NA	NA	NA	NA
WP_056943358.1|1240044_1241493_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
WP_003680658.1|1243397_1244153_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003645608.1|1244160_1245540_+	MFS transporter	NA	NA	NA	NA	NA
WP_146988945.1|1245536_1246460_+	ferrochelatase	NA	NA	NA	NA	NA
WP_146988948.1|1246807_1248346_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_035457681.1|1248450_1248939_+	histidine kinase	NA	NA	NA	NA	NA
WP_003688751.1|1249647_1249935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146988950.1|1249958_1250837_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.3e-41
WP_146988952.1|1250868_1252140_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	2.3e-28
WP_146988954.1|1252678_1253260_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.4	4.8e-21
WP_056943351.1|1254735_1254921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099267185.1|1254917_1255727_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_146988957.1|1255662_1257225_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	35.2	1.4e-70
WP_146988959.1|1257948_1258620_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	1.1e-29
WP_057707429.1|1258624_1259671_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_146988961.1|1261425_1262178_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_146988963.1|1262336_1262567_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_146988965.1|1262765_1265597_+	PRD domain-containing protein	NA	NA	NA	NA	NA
1263404:1263418	attR	CTTAGATGAAGTCCA	NA	NA	NA	NA
WP_003678518.1|1265751_1266150_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_146988967.1|1266164_1266668_+	PTS transporter subunit IIB	NA	NA	NA	NA	NA
WP_146988970.1|1266794_1267766_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003678515.1|1267796_1268603_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003678514.1|1268621_1269554_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003678513.1|1269655_1270054_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_010009213.1|1270274_1270628_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_010014018.1|1270641_1271346_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.9	3.0e-17
WP_146988972.1|1271342_1272146_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_146988974.1|1272402_1272645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003678510.1|1274324_1275494_+	galactokinase	NA	NA	NA	NA	NA
WP_146988976.1|1275692_1276688_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.1	7.4e-54
WP_146988978.1|1276689_1278144_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003680778.1|1278204_1279212_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_146988980.1|1279297_1280317_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_146988982.1|1280598_1281882_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	7.1e-49
WP_146988984.1|1282028_1283219_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.7	3.7e-36
>prophage 7
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	1715874	1722696	3000133		Streptococcus_phage(33.33%)	7	NA	NA
WP_146989516.1|1715874_1716759_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	4.2e-08
WP_003678997.1|1716755_1717757_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	56.8	7.6e-99
WP_003678995.1|1717777_1718725_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	9.8e-48
WP_146989518.1|1718773_1719286_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003678991.1|1719362_1719944_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	8.4e-50
WP_146989520.1|1720061_1721048_-	zinc-binding dehydrogenase	NA	K7Z7U2	Megavirus	23.2	1.7e-05
WP_003679699.1|1721847_1722696_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.0	2.6e-47
>prophage 8
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	1760568	1832783	3000133	transposase,tRNA	Bacillus_phage(21.43%)	55	NA	NA
WP_137638872.1|1760568_1761996_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_146989564.1|1762702_1764052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146989566.1|1764171_1765479_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_146989569.1|1765660_1766458_-	winged helix DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146989571.1|1766509_1766845_-	winged helix DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146989572.1|1766949_1767348_+	glyoxalase	NA	NA	NA	NA	NA
WP_146989573.1|1767414_1768239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989574.1|1768245_1768689_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146989575.1|1768834_1771165_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.6	2.1e-35
WP_146989578.1|1771626_1773015_-	amino acid permease	NA	NA	NA	NA	NA
WP_146989581.1|1773441_1774653_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	1.2e-85
WP_146989583.1|1775261_1775759_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_146989585.1|1775774_1776950_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	33.9	5.1e-38
WP_146989587.1|1776984_1778280_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003678045.1|1778439_1779732_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	55.4	2.2e-119
WP_146989589.1|1779999_1781346_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_146989591.1|1781348_1782194_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_146989594.1|1782309_1782864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010611.1|1782955_1783534_+	hypothetical protein	NA	U5J9X2	Bacillus_phage	27.8	6.1e-08
WP_010010610.1|1783563_1783758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989596.1|1784961_1785885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010014744.1|1786239_1787229_+	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	36.4	2.5e-38
WP_003679161.1|1787444_1788182_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.7e-34
WP_003679160.1|1788199_1789027_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146989598.1|1789029_1789668_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_146989600.1|1789683_1790340_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003679154.1|1790665_1792285_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.1	6.8e-49
WP_146991024.1|1792487_1793018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989602.1|1793174_1794947_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	36.9	2.6e-73
WP_146989604.1|1794936_1795830_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010010597.1|1795807_1796086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989606.1|1796219_1797008_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_146989608.1|1797160_1797700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146989610.1|1797809_1798373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679143.1|1798614_1799139_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003679141.1|1799709_1801389_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_146989612.1|1801483_1802209_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_146989614.1|1802543_1804007_+	amino acid permease	NA	NA	NA	NA	NA
WP_146989616.1|1804105_1805611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010009283.1|1805753_1806419_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.9	6.2e-49
WP_056943348.1|1806867_1808145_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.7	1.8e-92
WP_010010162.1|1815073_1816054_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.8	3.2e-25
WP_003678869.1|1816067_1817564_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.7	6.6e-14
WP_146989618.1|1817815_1819777_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_146989620.1|1819789_1820650_+	ROK family protein	NA	NA	NA	NA	NA
WP_146989622.1|1820667_1822347_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_146989624.1|1822461_1824639_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_146989626.1|1824726_1826079_-	amino acid permease	NA	NA	NA	NA	NA
WP_146989628.1|1826461_1827136_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035456720.1|1827132_1828026_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	30.1	2.9e-25
WP_010010157.1|1828118_1828748_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_146989630.1|1828831_1829449_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_146989632.1|1829681_1830560_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099267150.1|1830709_1831423_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_146989634.1|1831616_1832783_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	1843186	1911220	3000133	transposase,tRNA,protease	Bacillus_phage(22.22%)	48	NA	NA
WP_146989649.1|1843186_1844110_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.9	3.9e-49
WP_146989651.1|1844438_1844783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146991027.1|1845016_1846279_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.0	2.4e-17
WP_146989653.1|1846389_1847721_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_146989655.1|1847827_1849354_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_146989657.1|1849353_1850322_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	9.2e-25
WP_146989659.1|1850557_1851643_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_146989661.1|1851694_1852471_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003678471.1|1852727_1853456_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	1.4e-33
WP_010010133.1|1853452_1854928_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.7	2.2e-33
WP_035457274.1|1854964_1855543_-	ABC transporter	NA	NA	NA	NA	NA
WP_010010131.1|1855627_1856404_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_099267115.1|1856619_1857654_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	8.8e-42
WP_146989663.1|1857845_1860029_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	50.6	1.6e-181
WP_003678475.1|1860314_1860986_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003678477.1|1861374_1862235_+	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_003678480.1|1862390_1863731_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003678484.1|1864803_1865439_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010010682.1|1865627_1865912_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	7.3e-15
WP_003678487.1|1866092_1867733_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.2	3.2e-155
WP_146989665.1|1868011_1869334_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.0	1.3e-74
WP_146989667.1|1871419_1873246_+	APC family permease	NA	NA	NA	NA	NA
WP_003678490.1|1873345_1874155_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_146991030.1|1874175_1874541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146991032.1|1874753_1877399_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.7	1.1e-35
WP_146989670.1|1877522_1879460_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.9	4.3e-58
WP_146989672.1|1879456_1880026_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_146989674.1|1880236_1880848_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003678495.1|1880881_1881901_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.3	3.1e-07
WP_029508007.1|1882186_1883221_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003678498.1|1883628_1884771_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.7	6.7e-83
WP_003678499.1|1884847_1885279_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_146989676.1|1885623_1888245_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_146989678.1|1888374_1889877_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	34.4	4.4e-74
WP_099235906.1|1890490_1891516_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	7.4e-41
WP_146989680.1|1891891_1893259_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_137638872.1|1893616_1895044_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_146989682.1|1895404_1896430_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.7	9.0e-39
WP_146989684.1|1896480_1897764_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	56.2	1.8e-129
WP_146991034.1|1898216_1900997_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_146989686.1|1900989_1902696_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_146989689.1|1902706_1903300_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_146991036.1|1903306_1904380_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_146989691.1|1904360_1905059_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_146989694.1|1905071_1905755_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_146989696.1|1905760_1906714_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_146989698.1|1906710_1907598_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_146989700.1|1910341_1911220_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	1939345	2005594	3000133	transposase,tRNA,integrase	Staphylococcus_phage(33.33%)	58	1940136:1940151	1991811:1991826
WP_086989537.1|1939345_1940120_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
1940136:1940151	attL	CTAGTTTATTTTGTTT	NA	NA	NA	NA
WP_146989734.1|1940345_1941947_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	45.7	2.1e-13
WP_146989736.1|1942057_1942732_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146989738.1|1943688_1944765_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010637.1|1945275_1946118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099235906.1|1946349_1947375_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	7.4e-41
WP_146991040.1|1947517_1948966_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	3.1e-08
WP_146989740.1|1949141_1950419_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_146989742.1|1950499_1950880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010634.1|1950927_1951776_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_146989744.1|1952152_1953076_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.3	2.1e-47
WP_146991042.1|1953169_1954054_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_146989746.1|1954384_1954855_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_010011679.1|1954854_1955289_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_137638872.1|1955502_1956930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_146989749.1|1956952_1958050_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_003679242.1|1958255_1959257_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_146991045.1|1959299_1961864_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_146989751.1|1962083_1963184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989753.1|1963309_1964275_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010011672.1|1964411_1964660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989755.1|1964685_1965150_-	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_010011670.1|1965287_1965746_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_010011669.1|1965835_1966015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010011666.1|1966137_1966596_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_003678907.1|1966944_1968348_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_146989757.1|1968456_1969014_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003678909.1|1969046_1969700_+	HD domain-containing protein	NA	S4W232	Pandoravirus	29.7	1.7e-11
WP_010011663.1|1969782_1970127_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003678912.1|1970193_1970679_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146989759.1|1970691_1972128_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003678915.1|1972370_1973600_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_035457368.1|1973801_1974761_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_035457369.1|1974787_1975498_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003678921.1|1975769_1976705_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_010011658.1|1976736_1977090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989761.1|1977762_1978323_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003678922.1|1978309_1978615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989764.1|1978989_1979601_+	metallophosphatase	NA	L0LAH5	Bacillus_phage	40.3	1.4e-31
WP_010011655.1|1979684_1979924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989766.1|1980261_1981644_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003678929.1|1981653_1982274_+	YutD family protein	NA	NA	NA	NA	NA
WP_003678932.1|1982298_1983069_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003678933.1|1983056_1983704_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_146989768.1|1983757_1984411_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_146989770.1|1984535_1985039_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.8	2.1e-36
WP_146989772.1|1985040_1986033_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010014189.1|1986225_1986810_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.0	5.5e-25
WP_010011646.1|1987026_1987398_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146989774.1|1987499_1987880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003680443.1|1995488_1996676_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.8	5.4e-144
1991811:1991826	attR	CTAGTTTATTTTGTTT	NA	NA	NA	NA
WP_010010933.1|1996763_1998236_+	MFS transporter	NA	NA	NA	NA	NA
WP_146989776.1|1998232_1998895_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003680180.1|1999273_2001694_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	71.4	0.0e+00
WP_035457680.1|2001802_2002234_-	universal stress protein	NA	NA	NA	NA	NA
WP_003680178.1|2002405_2004037_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_010014779.1|2004046_2004772_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_086989537.1|2004818_2005594_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 11
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2025427	2063187	3000133	bacteriocin,transposase,tRNA	Staphylococcus_phage(40.0%)	38	NA	NA
WP_146989818.1|2025427_2025712_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_010010969.1|2025901_2026213_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_146989820.1|2026209_2026743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562607.1|2026850_2028227_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_004562606.1|2028304_2028508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989822.1|2028740_2029760_-	aldehyde reductase	NA	NA	NA	NA	NA
WP_146989824.1|2030010_2030430_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029508019.1|2030466_2031333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010975.1|2031464_2031962_+	kinase	NA	NA	NA	NA	NA
WP_146989826.1|2031962_2032445_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_146989829.1|2032726_2033038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989831.1|2033205_2034138_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.9	3.6e-50
WP_146989833.1|2034719_2036051_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	56.2	8.2e-141
WP_003688751.1|2036291_2036579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010011610.1|2036602_2037481_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_146989836.1|2037707_2038442_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_146989839.1|2038872_2039664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003680063.1|2039904_2040615_+	VIT family protein	NA	NA	NA	NA	NA
WP_146989841.1|2040925_2042617_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.5	2.9e-74
WP_003680058.1|2042821_2043913_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_146989843.1|2044409_2044868_+	arginine repressor	NA	NA	NA	NA	NA
WP_146989846.1|2044953_2045835_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_146989848.1|2046239_2048381_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003679231.1|2048644_2048989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989851.1|2049315_2050533_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_146989853.1|2050522_2053204_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_146989855.1|2053348_2054299_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_146989858.1|2054549_2054882_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_146989860.1|2055755_2056802_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_146989862.1|2057019_2057367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003679218.1|2057420_2057861_-	HIT family protein	NA	NA	NA	NA	NA
WP_146989865.1|2058002_2058737_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	6.9e-25
WP_146989866.1|2058733_2059945_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_146989869.1|2060089_2060881_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_010011000.1|2061069_2061747_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_010011002.1|2061700_2062003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989871.1|2062083_2062515_+	universal stress protein	NA	NA	NA	NA	NA
WP_146989873.1|2062530_2063187_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2141769	2237285	3000133	integrase,transposase,protease,bacteriocin,tRNA	Lactobacillus_phage(19.23%)	102	2139008:2139023	2219240:2219255
2139008:2139023	attL	TGTTTTAAAAGCTTTA	NA	NA	NA	NA
WP_146991053.1|2141769_2143218_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
2139008:2139023	attL	TGTTTTAAAAGCTTTA	NA	NA	NA	NA
WP_010011070.1|2143393_2143621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989949.1|2143798_2144419_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.8	2.8e-11
WP_146989951.1|2144415_2144676_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_146989953.1|2144826_2146044_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	1.5e-40
WP_146989955.1|2146141_2148556_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_010011075.1|2148601_2149549_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	1.4e-09
WP_146989957.1|2149538_2150891_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003677274.1|2150896_2151643_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_146989959.1|2151639_2153370_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	27.7	1.4e-20
WP_003677270.1|2153409_2154315_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_010011079.1|2154311_2154974_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003677265.1|2154966_2155611_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_010011081.1|2155663_2155849_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_029507564.1|2156014_2156350_-	hypothetical protein	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	45.0	3.9e-15
WP_010011085.1|2156328_2156601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989962.1|2156734_2157250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003677264.1|2157544_2157907_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003677262.1|2158001_2159672_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_010011087.1|2159761_2161807_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_146989964.1|2161828_2162851_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_146989966.1|2163092_2163332_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	47.8	1.2e-05
WP_003677256.1|2163622_2164315_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	34.0	4.7e-23
WP_146989969.1|2164631_2168189_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_010011091.1|2168185_2168995_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003677251.1|2169011_2170022_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_010011092.1|2170089_2170416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003677249.1|2170609_2170951_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_146989971.1|2171135_2172572_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_146989973.1|2172775_2172988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680393.1|2173317_2173593_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010011095.1|2173612_2173843_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_003680395.1|2174031_2174562_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_146991056.1|2174551_2175295_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003680397.1|2175420_2175768_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_146989975.1|2175862_2176282_+	flavodoxin	NA	NA	NA	NA	NA
WP_146989977.1|2176366_2177911_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146989981.1|2178182_2178434_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	3.5e-37
WP_146989983.1|2178487_2179228_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.6	1.4e-134
WP_146989984.1|2179598_2181713_+	AAA domain-containing protein	NA	K4FB40	Cronobacter_phage	38.5	4.5e-117
WP_035457965.1|2181849_2182524_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.0	2.5e-29
WP_146989986.1|2182520_2183414_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	22.5	4.7e-07
WP_003680658.1|2183839_2184595_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003645608.1|2184602_2185982_+	MFS transporter	NA	NA	NA	NA	NA
WP_146988948.1|2187248_2188787_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
2188493:2188508	attR	TGTTTTAAAAGCTTTA	NA	NA	NA	NA
WP_035457681.1|2188891_2189380_+	histidine kinase	NA	NA	NA	NA	NA
2188493:2188508	attR	TGTTTTAAAAGCTTTA	NA	NA	NA	NA
WP_146989989.1|2189552_2190476_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	4.0e-30
WP_146989991.1|2190725_2190986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146989993.1|2190957_2191194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016374492.1|2191322_2191883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146989981.1|2192212_2192464_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	3.5e-37
WP_146989995.1|2192481_2193258_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.0	8.7e-135
WP_146989997.1|2193638_2193941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990000.1|2193916_2194087_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146990002.1|2194215_2194794_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003680476.1|2194806_2195211_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_010011100.1|2195392_2195680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990004.1|2195785_2196532_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003680471.1|2196524_2197238_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.3	6.5e-12
WP_003680470.1|2197234_2197609_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146990006.1|2198304_2198610_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_146990008.1|2198746_2199046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990010.1|2199226_2199874_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_029507561.1|2200268_2200919_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_146990012.1|2201215_2201506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990014.1|2203685_2205011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990017.1|2205239_2206589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146990018.1|2206667_2207081_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_146990021.1|2207334_2207934_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_146990023.1|2207969_2211068_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	22.0	2.5e-15
WP_146990025.1|2211080_2212733_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.1	1.1e-123
WP_146990028.1|2212743_2213970_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	29.0	3.4e-32
WP_146990031.1|2214078_2214423_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_146990033.1|2214416_2214680_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146990036.1|2214765_2215353_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	33.0	2.5e-17
WP_146990038.1|2215450_2216716_+	topoisomerase IV	NA	NA	NA	NA	NA
WP_146990041.1|2216845_2217109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099267185.1|2217298_2218108_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010013312.1|2218043_2219606_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	35.2	8.0e-71
WP_003688751.1|2219940_2220228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146990043.1|2220251_2221130_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.2e-42
WP_016374492.1|2221278_2221839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990045.1|2222031_2222634_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_146990048.1|2223206_2223932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010013243.1|2224093_2224348_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_010011124.1|2224701_2224905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011125.1|2225036_2225531_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010011127.1|2225809_2226622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990050.1|2226969_2227848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990052.1|2227831_2229163_+	DNA helicase	NA	A8YQM1	Lactobacillus_phage	41.8	4.3e-73
WP_146990055.1|2229179_2229365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035457603.1|2229401_2229617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035457601.1|2229785_2230094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146991058.1|2230300_2230816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010011144.1|2230836_2231580_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010011146.1|2231730_2232153_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_146990057.1|2232154_2232472_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_146990060.1|2232754_2233273_+	VanZ family protein	NA	NA	NA	NA	NA
WP_010011150.1|2233384_2233807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990062.1|2233850_2235182_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	42.9	1.3e-90
WP_146990065.1|2235344_2236355_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_146990067.1|2236559_2237285_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	55.3	2.1e-05
>prophage 13
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2333525	2342286	3000133	integrase	Streptococcus_phage(50.0%)	8	2331156:2331170	2344452:2344466
2331156:2331170	attL	CGTGGAAAGTATTTC	NA	NA	NA	NA
WP_003678435.1|2333525_2335601_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	2.3e-102
WP_146990189.1|2335698_2336562_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_010009951.1|2336613_2337372_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	36.8	5.7e-22
WP_146990191.1|2337364_2338222_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003678442.1|2338358_2339618_-|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	26.6	5.4e-25
WP_021349957.1|2339706_2339958_-	hypothetical protein	NA	W6LM55	Streptococcus_phage	43.3	4.5e-08
WP_146990193.1|2340077_2341298_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	38.6	8.4e-76
WP_003678446.1|2341731_2342286_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.3	6.0e-05
2344452:2344466	attR	CGTGGAAAGTATTTC	NA	NA	NA	NA
>prophage 14
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2361419	2369003	3000133	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_003679736.1|2361419_2362265_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.6	1.3e-19
WP_146990211.1|2362421_2362922_-	dihydrofolate reductase	NA	A0A0S2MU93	Bacillus_phage	36.0	4.4e-23
WP_146991072.1|2362973_2363924_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.3	9.7e-120
WP_146990213.1|2363946_2365836_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-50
WP_003679730.1|2365955_2367158_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.2	1.6e-47
WP_035457506.1|2367154_2367961_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003680513.1|2368133_2369003_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.5	4.0e-56
>prophage 15
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2466357	2521023	3000133	transposase,holin,tRNA,protease	Paenibacillus_phage(30.77%)	57	NA	NA
WP_146990321.1|2466357_2467272_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003677003.1|2467447_2467801_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_146990323.1|2468058_2470602_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.3	2.3e-19
WP_010010056.1|2470615_2470921_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_010010057.1|2470910_2471216_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003677008.1|2471243_2472413_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003677010.1|2472432_2472906_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_146990325.1|2473180_2477530_-	PolC-type DNA polymerase III	NA	A0A2H4P8G0	Corynebacterium_phage	21.1	2.1e-15
WP_146990327.1|2477785_2479495_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_146990329.1|2479570_2480845_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_146990331.1|2480892_2481675_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_146990333.1|2481712_2482477_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.8	2.8e-21
WP_146990336.1|2482615_2483176_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003677024.1|2483177_2483903_-	UMP kinase	NA	NA	NA	NA	NA
WP_146990338.1|2484039_2484924_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_146990340.1|2485196_2486021_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_146990342.1|2486257_2487250_-	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	35.0	3.5e-48
WP_010014855.1|2487338_2487623_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_056943264.1|2487609_2488347_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010010067.1|2488458_2489073_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010010068.1|2489109_2489328_-	YneF family protein	NA	NA	NA	NA	NA
WP_035456688.1|2489494_2489731_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003677037.1|2489884_2490505_+	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	34.6	5.0e-08
WP_010010074.1|2490552_2490741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990345.1|2490937_2491831_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	23.4	4.7e-07
WP_035457965.1|2491827_2492502_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.0	2.5e-29
WP_146990347.1|2494200_2494638_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_146990349.1|2494719_2495055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990351.1|2495068_2496142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990353.1|2496327_2496690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_146990355.1|2496800_2497007_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_146990357.1|2497003_2497189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990359.1|2497713_2498607_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	25.0	2.8e-12
WP_010012236.1|2498603_2499278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099267106.1|2500365_2501733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146990361.1|2502120_2502345_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_146990364.1|2502331_2502697_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	44.1	4.7e-22
WP_146991078.1|2502892_2503003_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_146990366.1|2503961_2504534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990368.1|2504608_2504791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990368.1|2504945_2505128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010082.1|2505277_2505526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990370.1|2507581_2508163_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_146990372.1|2508192_2508648_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2K9L7B8	Tupanvirus	39.7	1.2e-14
WP_146991081.1|2508644_2509166_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146990374.1|2509140_2509992_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_146990377.1|2510087_2511104_-	zinc-binding dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	25.9	8.5e-05
WP_035457576.1|2511103_2511436_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010010092.1|2512266_2512530_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_146990379.1|2512603_2513125_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	57.0	3.3e-37
WP_146990381.1|2513192_2514032_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_029507982.1|2515070_2516399_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_035457699.1|2516774_2517011_-	cytochrome b5	NA	NA	NA	NA	NA
WP_003680268.1|2517187_2517505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010013474.1|2517697_2518099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990384.1|2518133_2519303_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_146990386.1|2519739_2521023_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.0	5.4e-49
>prophage 16
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2543151	2551723	3000133		Synechococcus_phage(50.0%)	9	NA	NA
WP_146990406.1|2543151_2543721_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.7	1.4e-25
WP_146990408.1|2543717_2544752_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.6	1.1e-60
WP_146990412.1|2544867_2546295_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	1.5e-52
WP_146990414.1|2546288_2548487_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	3.0e-140
WP_146990416.1|2548483_2549164_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_146990418.1|2549166_2549412_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_146990421.1|2549398_2550127_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	37.7	1.3e-36
WP_146990423.1|2550126_2551245_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_146990425.1|2551237_2551723_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.1	7.1e-18
>prophage 17
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2658115	2718067	3000133	transposase,tRNA,protease	Streptococcus_phage(20.0%)	57	NA	NA
WP_003678319.1|2658115_2658628_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_010014548.1|2658785_2660069_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	9.2e-49
WP_146990529.1|2660146_2661394_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.7	6.8e-105
WP_146990531.1|2661496_2662333_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	7.6e-44
WP_010013707.1|2662498_2663011_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_010013706.1|2663053_2664472_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_010013704.1|2664572_2665412_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_010013703.1|2665411_2666500_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_146991088.1|2666581_2667583_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_003678327.1|2667603_2668479_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_146990534.1|2668478_2670512_-	transketolase	NA	NA	NA	NA	NA
WP_146990536.1|2671404_2672328_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.3	1.5e-29
WP_146991090.1|2672502_2673537_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.1	3.3e-41
WP_029507672.1|2673789_2674005_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_010009778.1|2674155_2675598_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003678724.1|2675647_2676124_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_146990539.1|2676110_2677349_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.8	1.3e-108
WP_010013682.1|2677329_2678634_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_146990540.1|2678647_2679442_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.5	2.2e-08
WP_146990542.1|2679757_2680579_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_146990544.1|2680622_2681321_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010009787.1|2681313_2682348_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-30
WP_146990546.1|2682733_2683939_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_146990549.1|2684145_2684364_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_010009791.1|2684338_2684632_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_146990551.1|2684738_2684927_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_146990553.1|2684941_2685925_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_146990555.1|2686125_2687490_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010009795.1|2687518_2687752_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_146990557.1|2688031_2688457_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_146990559.1|2688468_2689917_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_146990561.1|2689954_2690890_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003678748.1|2690904_2692431_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_146990563.1|2692510_2693053_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003678752.1|2693039_2693564_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_146990565.1|2693671_2693884_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_146990567.1|2693914_2694631_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003678756.1|2695182_2695812_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003678757.1|2695938_2697189_-	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	53.6	2.5e-99
WP_003678759.1|2697359_2698382_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	39.8	4.9e-53
WP_146990570.1|2698400_2699237_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003678763.1|2699229_2700312_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_010009811.1|2700479_2701064_-	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	52.1	1.9e-46
WP_146990572.1|2701457_2702810_+	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_146990575.1|2702955_2703702_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_146990578.1|2703827_2704790_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_146990581.1|2704887_2705892_-	serine hydrolase	NA	NA	NA	NA	NA
WP_146990582.1|2705997_2707869_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.3	1.4e-58
WP_146990584.1|2707861_2709604_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	2.9e-45
WP_146990586.1|2709665_2710295_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146990588.1|2710456_2711143_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_146990590.1|2711788_2713483_-	oleate hydratase	NA	NA	NA	NA	NA
WP_010009829.1|2713576_2713705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990592.1|2714018_2715188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146990594.1|2715807_2716440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010688028.1|2716586_2716787_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	2.0e-19
WP_146990596.1|2717041_2718067_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	4.3e-41
>prophage 18
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2724413	2770224	3000133	transposase,tRNA,integrase	Streptococcus_phage(20.0%)	39	2738004:2738018	2751710:2751724
WP_146991092.1|2724413_2725478_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_146990606.1|2725434_2725953_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_010688021.1|2725949_2726498_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_146990608.1|2726481_2727195_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_146990611.1|2727663_2728638_+	asparaginase	NA	NA	NA	NA	NA
WP_146990613.1|2728698_2729601_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.5	1.8e-75
WP_010009846.1|2729770_2730013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990616.1|2731035_2731914_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.7e-41
WP_003688751.1|2731937_2732225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146990618.1|2732857_2733097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990620.1|2733275_2733812_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_146990623.1|2733926_2734328_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_146990625.1|2735434_2736850_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_146990628.1|2736915_2738091_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
2738004:2738018	attL	CAAAAAAAGCATAGC	NA	NA	NA	NA
WP_146991095.1|2738095_2738713_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_146990631.1|2738964_2739897_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	50.5	8.7e-81
WP_146990633.1|2741353_2742880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990635.1|2742876_2743872_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	37.0	1.8e-47
WP_146990638.1|2744010_2744895_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	3.0e-30
WP_029507971.1|2746483_2746888_+	GtrA family protein	NA	NA	NA	NA	NA
WP_146990640.1|2746979_2747471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990642.1|2747566_2749096_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.3	2.5e-53
WP_010011941.1|2749160_2749514_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_056943358.1|2749856_2751305_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
WP_146990644.1|2751580_2753662_-	hypothetical protein	NA	NA	NA	NA	NA
2751710:2751724	attR	GCTATGCTTTTTTTG	NA	NA	NA	NA
WP_146990646.1|2753802_2754981_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_146989581.1|2755498_2756710_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	1.2e-85
WP_010009368.1|2756962_2757142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679178.1|2757131_2757491_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_146990648.1|2757538_2759092_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.0	1.7e-52
WP_146990651.1|2759336_2762303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990648.1|2762583_2764137_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.0	1.7e-52
WP_003679178.1|2764184_2764544_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_010009368.1|2764533_2764713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146990653.1|2764965_2766177_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.1	2.0e-85
WP_146990655.1|2766379_2767405_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	4.8e-40
WP_010009248.1|2767747_2768731_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.2	3.4e-75
WP_146990657.1|2768730_2769300_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	42.5	3.4e-35
WP_056943238.1|2769339_2770224_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.2	5.7e-98
>prophage 19
NZ_CP042392	Lactobacillus coryniformis strain CBA3616 chromosome, complete genome	3000133	2803667	2809958	3000133	transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_146990703.1|2803667_2803907_-	helix-turn-helix domain-containing protein	NA	G4KNM9	Staphylococcus_phage	51.4	6.8e-14
WP_146990705.1|2804097_2804544_+	helix-turn-helix domain-containing protein	NA	G4KNM8	Staphylococcus_phage	42.3	1.1e-12
WP_146990707.1|2804554_2804863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146990709.1|2805898_2806657_+	carboxypeptidase regulatory-like domain-containing protein	NA	O64371	Lactobacillus_phage	66.4	1.3e-39
WP_146990711.1|2806741_2808103_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	59.6	3.4e-94
WP_146990713.1|2808292_2808916_+	hypothetical protein	NA	S5MBZ0	Brevibacillus_phage	33.3	1.3e-11
WP_146990716.1|2808932_2809958_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	4.3e-41
