The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	517919	643084	3895111	protease,holin,coat,transposase,capsid	Acinetobacter_phage(27.27%)	113	NA	NA
WP_010326927.1|517919_518945_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_002115636.1|519087_519534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115609.1|519891_521286_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_002115594.1|521402_522410_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	32.8	5.5e-49
WP_002115623.1|522475_522844_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.8	2.3e-13
WP_002115699.1|522888_523239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002115665.1|523256_523541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002115694.1|523558_523870_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	44.1	1.2e-18
WP_016802911.1|523872_524724_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002115639.1|524859_526248_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002115697.1|526264_526747_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002115656.1|526963_528199_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002115707.1|528198_529122_-	bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB	NA	NA	NA	NA	NA
WP_002115677.1|529145_529634_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_002115720.1|529637_529892_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_005803484.1|529892_530933_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005803486.1|531162_533436_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002115739.1|533584_534214_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_002115596.1|534210_536991_-	nitrate reductase	NA	NA	NA	NA	NA
WP_002115654.1|537009_538632_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_170825823.1|538644_541179_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_005803489.1|541202_541544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115726.1|541927_542518_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_002115599.1|542518_543541_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005803491.1|544169_545174_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.4	2.5e-41
WP_002115662.1|545195_546209_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_146878922.1|546280_547921_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_002115668.1|547924_549130_+	MFS transporter	NA	NA	NA	NA	NA
WP_057081881.1|549126_552654_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_002115630.1|552646_553420_+	aldolase	NA	NA	NA	NA	NA
WP_002115621.1|553574_555824_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002115586.1|556090_557416_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	42.5	3.0e-95
WP_002115614.1|557651_558107_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000354611.1|558124_558544_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002115704.1|558561_559929_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002115710.1|559975_560479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078210265.1|560634_561783_-	MFS transporter	NA	NA	NA	NA	NA
WP_002115712.1|562349_563378_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_086373856.1|564273_565206_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	2.5e-59
WP_078210202.1|565886_566381_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_078210204.1|567372_568773_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_057081841.1|568982_570038_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_002115218.1|570100_570595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002115207.1|570651_571680_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002115205.1|571679_572804_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002115180.1|572808_573843_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002115216.1|573862_574366_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005073831.1|574622_574850_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_002115170.1|574912_575380_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002115171.1|575659_576208_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004994718.1|576378_577404_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_002115198.1|577530_577659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115209.1|579335_579647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115191.1|580006_581164_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002115173.1|581163_581598_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002115177.1|581645_583877_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_130136794.1|584201_586313_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.2	9.5e-43
WP_002115192.1|586435_587068_-|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_002115178.1|587090_588872_-	metalloendopeptidase CpaA	NA	NA	NA	NA	NA
WP_002115183.1|589130_590609_-	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	27.1	2.9e-30
WP_002115186.1|590734_591313_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057081814.1|591365_592619_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.3	2.3e-12
WP_002115175.1|592690_593545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115222.1|593619_595011_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_002115199.1|595246_596815_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002115172.1|596879_597314_-	chlorhexidine efflux PACE transporter AceI	NA	NA	NA	NA	NA
WP_002115224.1|597404_598298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002115174.1|598428_599418_+	transaldolase	NA	NA	NA	NA	NA
WP_016803130.1|599491_600142_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_078210201.1|600195_600690_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002115196.1|600855_602031_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_002115195.1|602091_602535_-	RDD family protein	NA	NA	NA	NA	NA
WP_002115204.1|602801_602975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115208.1|603151_603379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002115225.1|603669_604113_+	universal stress protein	NA	NA	NA	NA	NA
WP_081031796.1|604430_605957_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.6	1.4e-22
WP_002115181.1|606021_606450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005803527.1|606657_607164_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002115176.1|607255_607618_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_002114606.1|607866_608154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002114618.1|608428_608560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878760.1|608749_609619_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146878763.1|609842_610697_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002114625.1|610753_611017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002114622.1|611179_612286_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	70.2	4.4e-148
WP_146878765.1|613766_613997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343018.1|614565_615774_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_002114620.1|615899_616214_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002114624.1|616324_616741_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002114626.1|616824_617397_-	lysozyme	NA	I2GUG4	Acinetobacter_phage	69.0	5.2e-52
WP_002114613.1|617574_617775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|618321_619486_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_171488045.1|619526_619697_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	61.1	1.7e-11
WP_005803531.1|620002_620272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005803532.1|620540_620915_-	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_146878767.1|622392_622581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005803535.1|622843_623566_+	type 1 glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	22.9	1.3e-07
WP_031944153.1|623679_624195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002163151.1|625879_626275_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002163149.1|626316_627000_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.9	3.9e-22
WP_002163141.1|627094_629329_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002115236.1|629825_632015_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002163153.1|632091_632643_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085940844.1|633747_634912_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_146878769.1|634863_635547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|635618_636783_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_078210424.1|636873_637392_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002163146.1|637508_638192_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002163150.1|638201_638963_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002163145.1|638970_639657_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_002163143.1|639883_640903_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_146878924.1|640893_642030_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_086373856.1|642151_643084_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	2.5e-59
>prophage 2
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	2781824	2787019	3895111		uncultured_Caudovirales_phage(83.33%)	7	NA	NA
WP_000213577.1|2781824_2782259_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.0	5.3e-41
WP_000373080.1|2782314_2782638_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	1.2e-21
WP_000670223.1|2782644_2783118_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	5.6e-36
WP_057081815.1|2783125_2784166_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001052988.1|2784170_2784875_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-92
WP_001191832.1|2784893_2785847_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	1.2e-61
WP_000080827.1|2785951_2787019_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.5	4.2e-95
>prophage 3
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	3302143	3364863	3895111	integrase,transposase	Bacillus_phage(25.0%)	52	3302100:3302130	3344416:3344446
3302100:3302130	attL	GTGAGTTCGAATCTCACCGCTTCCGCCAAAT	NA	NA	NA	NA
WP_057081786.1|3302143_3303352_-|integrase	site-specific integrase	integrase	G3EN73	Psychrobacter_phage	43.2	1.1e-78
WP_057081834.1|3304431_3305004_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_057081833.1|3305042_3307472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057081832.1|3307623_3307959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002159601.1|3308994_3309603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057081958.1|3309633_3311220_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_057081957.1|3311233_3312472_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_057081956.1|3312563_3312758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002123001.1|3313636_3314572_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005403706.1|3315186_3315447_+	glutaredoxin	NA	M4R2D4	Vibrio_phage	42.9	2.5e-06
WP_005403705.1|3315478_3315919_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_001281573.1|3316424_3317087_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_002119794.1|3317306_3318284_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	1.7e-18
WP_153310265.1|3318655_3318832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257537.1|3318901_3320188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043971153.1|3321275_3321830_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004911234.1|3321967_3322483_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_057081898.1|3323421_3323634_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057081899.1|3323844_3324135_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.1	2.7e-09
WP_057081900.1|3324180_3324801_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_057081901.1|3324800_3326324_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.2	1.4e-88
WP_057081902.1|3326313_3327543_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_057081903.1|3327542_3328496_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_009391543.1|3328584_3329934_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_057081904.1|3329999_3333284_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_057081905.1|3333285_3334032_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_057081906.1|3334252_3334435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057081907.1|3334745_3334979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081031793.1|3336662_3336893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159455793.1|3337314_3340785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086222951.1|3340796_3342650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126038012.1|3343552_3344092_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014206119.1|3344810_3345128_+	hypothetical protein	NA	NA	NA	NA	NA
3344416:3344446	attR	GTGAGTTCGAATCTCACCGCTTCCGCCAAAT	NA	NA	NA	NA
WP_050458255.1|3345139_3346201_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002120508.1|3346260_3347349_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_079377731.1|3347937_3348039_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_106389263.1|3348013_3348808_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.6	3.4e-62
WP_002120495.1|3348813_3349323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002120578.1|3350474_3351146_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_002120559.1|3351163_3351532_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_146878845.1|3351528_3352209_+	DUF799 family lipoprotein	NA	NA	NA	NA	NA
WP_002120526.1|3352366_3352726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005802857.1|3353103_3354462_-	amino acid permease	NA	NA	NA	NA	NA
WP_002120500.1|3354610_3356056_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002120563.1|3356074_3357406_-	APC family permease	NA	NA	NA	NA	NA
WP_000191916.1|3357592_3358300_-	cache protein	NA	NA	NA	NA	NA
WP_002120532.1|3358365_3359085_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002120573.1|3359140_3359911_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_002120548.1|3359939_3361370_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002120489.1|3361698_3362121_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002120524.1|3362256_3363492_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.1	2.9e-23
WP_086373856.1|3363930_3364863_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	2.5e-59
>prophage 4
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	3429333	3437723	3895111		Acinetobacter_phage(44.44%)	13	NA	NA
WP_002163170.1|3429333_3430653_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	3.1e-60
WP_002163181.1|3430769_3431768_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_002163173.1|3431812_3432370_-	cytochrome b	NA	NA	NA	NA	NA
WP_078224857.1|3432559_3433000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002163155.1|3433070_3433637_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	2.4e-25
WP_000906487.1|3433704_3433959_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_002115333.1|3434205_3435486_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000362184.1|3435695_3435911_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_002163156.1|3435912_3436170_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	88.1	1.2e-40
WP_000048743.1|3436173_3436458_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	2.2e-43
WP_079733333.1|3436454_3436703_-	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	96.1	5.7e-40
WP_000100165.1|3436848_3437250_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.0e-66
WP_001277128.1|3437246_3437723_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 5
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	3444253	3484982	3895111	terminase,integrase,capsid,transposase	Acinetobacter_phage(78.38%)	42	3463566:3463580	3487241:3487255
WP_001136775.1|3444253_3444709_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
WP_002121499.1|3444768_3445203_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.9	1.4e-78
WP_002121497.1|3445171_3445813_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	96.2	2.2e-123
WP_000729387.1|3445871_3446387_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_005802767.1|3446346_3447639_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.3	4.9e-215
WP_005802765.1|3447678_3449022_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	89.1	6.6e-231
WP_005802763.1|3449031_3450135_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	85.2	3.3e-180
WP_000965230.1|3450144_3450573_+	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	92.3	7.3e-67
WP_005802761.1|3450671_3450914_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	95.0	5.2e-38
WP_005802759.1|3450929_3451082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019767894.1|3451203_3451755_+	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	68.4	6.2e-18
WP_005802756.1|3451863_3452595_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	75.4	1.0e-92
WP_002121495.1|3452597_3453569_+	hypothetical protein	NA	A0A2H4JIE6	uncultured_Caudovirales_phage	72.7	4.4e-136
WP_002121513.1|3453611_3454142_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	91.7	4.2e-40
WP_002121501.1|3454145_3454526_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	8.2e-54
WP_023187965.1|3454525_3454894_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.9	7.2e-63
WP_002121581.1|3455631_3456036_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	88.1	1.9e-61
WP_000539743.1|3456007_3456376_+	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	98.1	1.1e-55
WP_002121567.1|3456377_3456776_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	94.7	1.2e-68
WP_002121621.1|3456844_3457198_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	94.0	1.5e-57
WP_023187966.1|3457197_3458526_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	49.1	1.2e-86
WP_002121543.1|3458578_3459496_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	3.9e-166
WP_025464105.1|3459566_3460082_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.4	2.8e-73
WP_000838146.1|3460407_3460590_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_023187967.1|3460682_3461087_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	99.3	5.6e-69
WP_000721572.1|3461185_3461866_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|3461867_3462131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002121623.1|3462261_3466596_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	70.2	0.0e+00
3463566:3463580	attL	TAACCGTACTGCTGA	NA	NA	NA	NA
WP_002121607.1|3468385_3468547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277438.1|3468611_3469010_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	98.5	2.4e-72
WP_025464104.1|3469009_3469516_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.6	8.6e-91
WP_000835159.1|3469512_3469875_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	6.2e-51
WP_004994718.1|3470244_3471270_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_000433912.1|3474450_3474840_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	8.6e-67
WP_002121604.1|3474882_3475428_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	96.1	6.6e-97
WP_005802707.1|3475669_3476161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061598.1|3476273_3476522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|3476702_3477867_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_002045824.1|3478408_3479572_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.5	5.5e-08
WP_002051611.1|3479709_3480456_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	1.8e-12
WP_001289330.1|3483120_3483615_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	61.5	4.8e-46
WP_002121611.1|3483776_3484982_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PHZ3	Moraxella_phage	50.5	7.2e-104
3487241:3487255	attR	TCAGCAGTACGGTTA	NA	NA	NA	NA
>prophage 6
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	3555755	3562064	3895111	transposase	Acinetobacter_phage(50.0%)	8	NA	NA
WP_017481391.1|3555755_3556427_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.8	9.1e-64
WP_017481392.1|3557099_3557354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002119864.1|3557563_3557953_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	76.7	3.0e-51
WP_017481393.1|3557983_3558529_+	glycosyl hydrolase 108	NA	A0A0N7IRE7	Acinetobacter_phage	70.7	5.6e-72
WP_010326927.1|3558604_3559630_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_017481394.1|3559715_3560333_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017481395.1|3560572_3561505_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	2.7e-42
WP_005070223.1|3561848_3562064_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.7	5.9e-17
>prophage 7
NZ_CP042364	Acinetobacter pittii strain C54 chromosome, complete genome	3895111	3746911	3816386	3895111	head,plate,terminase,integrase,transposase,tail	Pseudomonas_phage(21.62%)	83	3794456:3794471	3811045:3811060
WP_010326927.1|3746911_3747937_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_057081764.1|3747863_3748358_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	52.9	8.5e-35
WP_002114437.1|3748672_3750091_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_080549271.1|3750132_3752277_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	1.8e-137
WP_002114565.1|3752332_3753211_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	42.1	2.9e-54
WP_002114331.1|3753351_3753753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878853.1|3754227_3755412_+	stress-induced protein	NA	NA	NA	NA	NA
WP_002114518.1|3755474_3755708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002114396.1|3755994_3756606_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	6.8e-50
WP_002114153.1|3756675_3757287_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000376211.1|3757443_3757899_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085946406.1|3757957_3759604_-	allantoin permease	NA	NA	NA	NA	NA
WP_002114405.1|3759778_3763231_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.4	1.0e-33
WP_002114366.1|3763230_3764190_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002114395.1|3764332_3764617_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_078210280.1|3764723_3764837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937462.1|3764924_3765560_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002114238.1|3765549_3766215_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002114432.1|3766217_3766949_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
WP_002114178.1|3766979_3767840_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002114386.1|3767923_3768790_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002114211.1|3768840_3768960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002114422.1|3769036_3769972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002114256.1|3770063_3770702_+	LysE family translocator	NA	NA	NA	NA	NA
WP_002114417.1|3771331_3773293_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.3	1.3e-94
WP_002114358.1|3773267_3774200_-	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.4	1.1e-43
WP_016803288.1|3774440_3775382_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_002114262.1|3775400_3775910_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002114398.1|3776148_3776886_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002114210.1|3777011_3777914_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002114483.1|3777973_3778792_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002114301.1|3778830_3779433_-	LysE family translocator	NA	NA	NA	NA	NA
WP_146878855.1|3779588_3780023_+	DUF2000 family protein	NA	NA	NA	NA	NA
WP_146878857.1|3780073_3781345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142498.1|3781341_3781878_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_146878859.1|3781874_3782921_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	28.3	4.0e-26
WP_146878861.1|3782924_3783287_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_146878863.1|3783294_3783777_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	42.1	4.0e-13
WP_146878865.1|3783773_3784829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878867.1|3784818_3785994_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	20.7	2.5e-16
WP_146878869.1|3786070_3788188_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	31.3	2.4e-41
WP_146878871.1|3788191_3788401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087400795.1|3788400_3788742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087400796.1|3788751_3789129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087400797.1|3789255_3790065_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_087400798.1|3790081_3793279_-	BNR-4 repeat-containing protein	NA	NA	NA	NA	NA
WP_002096154.1|3793290_3793638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087400799.1|3793637_3794255_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_087400800.1|3794248_3794677_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	37.3	1.2e-16
3794456:3794471	attL	AGCCATGTGGCAAGCA	NA	NA	NA	NA
WP_087400801.1|3794688_3795621_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2P9JZJ2	Alteromonadaceae_phage	55.1	2.5e-88
WP_000127534.1|3795620_3796043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087400802.1|3796039_3797134_-	hypothetical protein	NA	A0A2K9VH54	Faecalibacterium_phage	28.3	3.6e-17
WP_087400803.1|3797223_3797721_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_087400804.1|3797717_3798968_-|head	phage head morphogenesis protein	head	I6PBD2	Pseudomonas_phage	38.6	1.3e-71
WP_087400805.1|3798967_3800548_-	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	43.6	2.2e-108
WP_146878872.1|3800760_3801528_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A2I2Y7	Vibrio_virus	60.5	1.9e-89
WP_146878874.1|3801714_3802476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878877.1|3802472_3803837_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	58.0	1.9e-140
WP_146878878.1|3803839_3804409_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	36.4	1.4e-17
WP_146878880.1|3804417_3804711_-	ArsR family transcriptional regulator	NA	J9SNG3	Pseudomonas_phage	54.6	8.3e-22
WP_146878883.1|3804717_3804999_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_146878884.1|3804991_3805384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878886.1|3805380_3805881_-	hypothetical protein	NA	A0A0M3LSH2	Mannheimia_phage	50.6	4.4e-39
WP_000579781.1|3806536_3807190_-	helix-turn-helix transcriptional regulator	NA	A7Y8H7	Pseudomonas_virus	32.1	3.9e-19
WP_001244919.1|3807294_3807501_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	49.2	1.3e-08
WP_146878888.1|3807685_3807982_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	44.6	2.9e-14
WP_146878890.1|3807986_3808874_+	DUF3102 domain-containing protein	NA	Q6QID9	Burkholderia_phage	44.3	2.9e-25
WP_146878892.1|3808876_3810622_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	38.3	5.6e-105
WP_146878894.1|3810625_3811813_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	50.1	4.8e-92
3811045:3811060	attR	AGCCATGTGGCAAGCA	NA	NA	NA	NA
WP_146878896.1|3811904_3812123_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	40.8	2.5e-07
WP_146878898.1|3812119_3812311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878900.1|3812303_3812528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878902.1|3812517_3813222_+	DUF2752 domain-containing protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	45.6	1.9e-27
WP_146878904.1|3813218_3813833_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	53.0	8.9e-58
WP_146878906.1|3813844_3814024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878908.1|3814016_3814292_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	2.3e-21
WP_146878910.1|3814284_3814611_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	65.7	7.1e-30
WP_171488048.1|3814684_3814861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171488049.1|3814857_3815007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878912.1|3815068_3815272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878914.1|3815273_3815480_+	hypothetical protein	NA	K4IBU9	Acinetobacter_phage	57.1	2.6e-06
WP_146878916.1|3815483_3815927_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	33.3	4.8e-13
WP_000323306.1|3815936_3816386_+	transcriptional regulator	NA	A0A0N7AEB9	Bacillus_phage	33.8	3.7e-05
>prophage 1
NZ_CP042365	Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence	256887	66038	133938	256887	transposase,integrase	Escherichia_phage(21.43%)	79	101436:101456	133166:133186
WP_047471638.1|66038_67388_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	35.0	2.8e-64
WP_005006143.1|67693_68002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006141.1|68007_68514_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.4	6.2e-25
WP_043041425.1|68599_69454_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_024160730.1|69455_70262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041424.1|70321_70744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944358.1|70794_71364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041423.1|71398_72139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160733.1|72258_73005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041422.1|73073_73865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160879.1|73840_74491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041421.1|74647_75532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878972.1|75677_77345_-	DEAD/DEAH box helicase	NA	A0A0U1UNQ7	Pseudomonas_phage	48.4	4.1e-158
WP_005006108.1|77344_77713_-	hypothetical protein	NA	A0A0A7HAZ6	Arthrobacter_phage	36.1	3.6e-06
WP_031946107.1|77709_78894_-	zinc metalloproteinase Mpr protein	NA	NA	NA	NA	NA
WP_098733232.1|80019_81102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125274517.1|81244_81433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878974.1|81593_81938_+	hypothetical protein	NA	A0A1L2CU84	Pectobacterium_phage	51.3	1.3e-05
WP_024160743.1|81937_82207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160744.1|82286_82613_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_146878976.1|82799_83624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160914.1|83851_84280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878978.1|84279_85173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038350033.1|85214_85640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944364.1|85754_86228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160750.1|86219_86480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038350032.1|86838_87375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044111924.1|87477_87933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006071.1|88130_88343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006069.1|88412_89171_+	Fic family protein	NA	NA	NA	NA	NA
WP_001988464.1|89610_90636_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_000422636.1|90715_91495_-	aminoglycoside O-phosphotransferase APH(3')-VIa	NA	E4ZFP6	Streptococcus_phage	35.1	1.5e-30
WP_001988464.1|91595_92621_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_038350028.1|92761_93403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917499.1|93415_94249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878980.1|94280_94889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042892727.1|95301_96450_+	hypothetical protein	NA	I6XKU1	Burkholderia_virus	27.2	1.8e-27
WP_033917496.1|96826_97252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067790.1|98008_98713_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_001043260.1|99228_100044_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|100130_100433_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|100326_100578_-	hypothetical protein	NA	NA	NA	NA	NA
101436:101456	attL	TCAGCGGCACTGTTGCAAATA	NA	NA	NA	NA
WP_001067784.1|101502_102207_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_032073153.1|102334_102673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032073134.1|102731_103502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000438825.1|103742_104030_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004728120.1|104016_104331_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_085940844.1|104613_105779_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_000286964.1|106376_106679_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
WP_000985609.1|106679_106961_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_001180106.1|107040_107460_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_085940844.1|107582_108747_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_033917544.1|108900_110235_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000897307.1|110365_110686_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000369781.1|110678_110951_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000052512.1|111443_112919_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|112974_113859_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004897650.1|114040_114745_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	4.2e-120
WP_114190151.1|114677_115553_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|115580_116795_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_072035758.1|117011_118133_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_004897650.1|118411_119116_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	4.2e-120
WP_000678311.1|119264_119831_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	50.0	4.1e-25
WP_001067790.1|120102_120807_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_146878982.1|120922_121492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917495.1|121514_121943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381192.1|122764_123757_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|123725_124226_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|124353_125193_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|125186_125534_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000186237.1|125690_126323_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_003159191.1|126417_126972_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_015063357.1|127098_127431_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_060614779.1|127662_128403_-	subclass B1 metallo-beta-lactamase IMP-26	NA	NA	NA	NA	NA
WP_146878984.1|128555_129569_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	4.7e-72
WP_000019304.1|130171_130741_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|130740_131241_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000050481.1|131506_133048_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|133233_133938_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
133166:133186	attR	TCAGCGGCACTGTTGCAAATA	NA	NA	NA	NA
>prophage 1
NZ_CP042366	Acinetobacter pittii strain C54 plasmid pC54_002	76008	0	54387	76008	protease,transposase,integrase	Acinetobacter_phage(38.1%)	49	9623:9637	59532:59546
WP_032017909.1|0_419_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	3.4e-77
WP_002120211.1|487_1486_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000155817.1|1506_1791_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000447196.1|2556_3075_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001089570.1|3206_3719_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_106405795.1|3926_4361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|4311_5477_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_000246757.1|6622_6868_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000221360.1|6857_7151_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	45.8	2.0e-15
WP_000269910.1|8468_8777_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001140619.1|8817_9120_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000069470.1|9112_9322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555567.1|9431_9659_-	hypothetical protein	NA	NA	NA	NA	NA
9623:9637	attL	TTAATTGATCTAAAT	NA	NA	NA	NA
WP_002120200.1|10467_10728_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000269908.1|10720_11077_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085940844.1|11833_12999_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_171250639.1|13517_14909_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_000464612.1|17897_18410_-	Fic family protein	NA	NA	NA	NA	NA
WP_000755724.1|18412_18598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743263.1|18764_19697_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.0	3.9e-57
WP_025464206.1|19827_20025_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	57.1	7.5e-11
WP_000994925.1|20117_20336_-	hypothetical protein	NA	A0A0R6PIC9	Moraxella_phage	77.4	4.0e-21
WP_000096286.1|20392_20995_-	hypothetical protein	NA	A0A0P0J0J1	Acinetobacter_phage	62.2	3.2e-36
WP_000453245.1|21201_21471_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000288004.1|21525_21855_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	64.6	2.9e-23
WP_001258993.1|21841_22129_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	48.4	3.3e-15
WP_000340067.1|22165_22354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002120129.1|23094_23271_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	1.1e-08
WP_005804845.1|23342_23666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372120.1|25127_25769_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	85.0	3.2e-111
WP_000378528.1|25737_26199_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	73.8	9.0e-55
WP_001136766.1|26259_26715_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	4.7e-80
WP_000152660.1|27376_27613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162097055.1|27806_27953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000395699.1|28025_28496_-	hypothetical protein	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	66.4	8.3e-56
WP_002120188.1|28711_31912_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001124154.1|31916_34268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000911012.1|34280_34745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366815.1|37297_37603_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000964375.1|39359_40214_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000254418.1|40362_41262_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	37.4	3.0e-14
WP_000104830.1|41280_42057_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	36.6	1.8e-18
WP_000064928.1|42970_44143_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	29.4	9.8e-05
WP_005804864.1|45371_48038_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.7	3.3e-157
WP_000276416.1|49397_50375_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001043693.1|50511_51444_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.8	8.4e-60
WP_000627021.1|51988_52210_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000937271.1|52404_52656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000059636.1|53187_54387_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	29.1	9.6e-40
59532:59546	attR	TTAATTGATCTAAAT	NA	NA	NA	NA
