The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042344	Comamonas sp. NLF-7-7 strain NLF 7-7 chromosome, complete genome	3333437	2304003	2379902	3333437	integrase,protease,tRNA,transposase	Ralstonia_phage(17.65%)	57	2294819:2294839	2364903:2364923
2294819:2294839	attL	CGCGCCAAGGTGGCGCAGGAA	NA	NA	NA	NA
WP_146913126.1|2304003_2305380_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.9	1.1e-42
WP_146913127.1|2305535_2306513_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_146913128.1|2306564_2307524_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_146913129.1|2307579_2308839_+	aspartate kinase	NA	NA	NA	NA	NA
WP_146913130.1|2310238_2310610_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_146913131.1|2310606_2310924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146913132.1|2312029_2312251_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_146913133.1|2312466_2313258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146914178.1|2313654_2314920_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.0	2.0e-40
WP_146913134.1|2314935_2315349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146914179.1|2315974_2318419_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_146911817.1|2318520_2319504_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	68.8	1.5e-120
WP_146913135.1|2319587_2321276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913136.1|2321868_2322615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913137.1|2322613_2323853_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	69.0	6.1e-106
WP_146913138.1|2323842_2326308_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_146914180.1|2326394_2326826_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_146913139.1|2326788_2327418_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_146913140.1|2327482_2328898_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_146913141.1|2328894_2331144_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	29.3	8.9e-39
WP_146911817.1|2332067_2333051_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	68.8	1.5e-120
WP_146913142.1|2333202_2333829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913143.1|2335207_2336470_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	44.0	1.4e-78
WP_146913144.1|2336697_2337036_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_146913145.1|2337053_2337761_-	methyltransferase domain-containing protein	NA	A0A1B1IU40	uncultured_Mediterranean_phage	29.8	1.3e-07
WP_146913146.1|2337865_2338426_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_146913147.1|2338451_2339048_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_146913148.1|2339050_2339788_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.8	1.6e-05
WP_146913149.1|2340257_2341649_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_146913150.1|2341653_2343375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913151.1|2343471_2343726_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_146913152.1|2343819_2345082_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_146913153.1|2345304_2345637_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	43.9	3.1e-17
WP_146913154.1|2345739_2348268_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_146913155.1|2348260_2351611_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_146913156.1|2351684_2352425_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_146913157.1|2352415_2353786_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_146913158.1|2353832_2354819_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	28.8	5.3e-28
WP_146913159.1|2354837_2355638_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_146913160.1|2355682_2357482_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_146913161.1|2357565_2358738_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.4	5.9e-18
WP_146913162.1|2359752_2360790_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_146913163.1|2360872_2361196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913164.1|2361192_2361702_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_146913165.1|2361614_2362658_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_146913166.1|2362654_2364271_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	5.8e-16
WP_146914181.1|2364281_2365142_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.1	2.1e-44
2364903:2364923	attR	TTCCTGCGCCACCTTGGCGCG	NA	NA	NA	NA
WP_146913167.1|2365248_2366301_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_146913168.1|2366533_2369413_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_146913169.1|2369499_2370765_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_146913170.1|2370831_2372259_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	2.6e-44
WP_146913171.1|2372334_2373432_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_146913172.1|2373448_2374252_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_146913173.1|2374261_2375059_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_146913174.1|2375183_2375783_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_146913175.1|2375877_2379420_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	36.3	7.9e-175
WP_146913176.1|2379545_2379902_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	39.6	1.2e-11
>prophage 2
NZ_CP042344	Comamonas sp. NLF-7-7 strain NLF 7-7 chromosome, complete genome	3333437	3155116	3185850	3333437	transposase	Pseudomonas_phage(54.17%)	40	NA	NA
WP_146913832.1|3155116_3155737_-	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	62.1	7.6e-65
WP_146913833.1|3155756_3155993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913835.1|3155989_3156595_-	hypothetical protein	NA	A0A0M5MXL4	Ralstonia_phage	31.2	7.3e-12
WP_146913837.1|3156591_3156786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913838.1|3156854_3157064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913840.1|3157066_3158359_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	46.3	2.0e-83
WP_146913842.1|3158318_3160112_-|transposase	transposase family protein	transposase	Q5ZR04	Pseudomonas_phage	32.5	9.8e-65
WP_146913844.1|3160125_3161160_-	hypothetical protein	NA	Q6QID9	Burkholderia_phage	35.4	3.1e-23
WP_146913845.1|3161125_3161434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913847.1|3161430_3161709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146913849.1|3161711_3162185_-	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	40.9	8.4e-24
WP_146913850.1|3162293_3162599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913852.1|3162620_3162881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146913853.1|3162949_3163255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913855.1|3163402_3163765_+	helix-turn-helix domain-containing protein	NA	Q6QID2	Burkholderia_phage	50.4	1.4e-15
WP_146913857.1|3163780_3164608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913859.1|3164637_3165621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913861.1|3165634_3166189_+	hypothetical protein	NA	A0A0R6PJ56	Moraxella_phage	32.3	3.3e-11
WP_146913863.1|3166292_3166676_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	43.5	1.3e-14
WP_146914228.1|3166678_3167308_+	transglycosylase SLT domain-containing protein	NA	A0A0S4L2W4	Pseudomonas_phage	47.8	1.8e-34
WP_146913864.1|3167304_3167739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146914229.1|3167799_3168069_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	43.2	2.0e-06
WP_146913866.1|3168065_3168425_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	40.6	4.0e-18
WP_146913868.1|3168421_3168736_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	73.0	2.1e-39
WP_146913870.1|3168745_3169336_+	DUF3486 family protein	NA	Q5ZQY6	Pseudomonas_phage	62.6	5.2e-55
WP_146913872.1|3169335_3171009_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	46.0	1.7e-111
WP_146913874.1|3171016_3172648_+	DUF935 family protein	NA	J9SVY0	Pseudomonas_phage	56.3	3.0e-161
WP_146913876.1|3172750_3173989_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	55.2	2.1e-122
WP_146913878.1|3174204_3174765_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	41.2	2.2e-23
WP_146913880.1|3174813_3175965_+	hypothetical protein	NA	J9SH47	Pseudomonas_phage	49.5	4.2e-77
WP_146913881.1|3175989_3176400_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	58.3	9.5e-32
WP_146913883.1|3176439_3177333_+	hypothetical protein	NA	J9SVY7	Pseudomonas_phage	57.7	2.8e-92
WP_146913885.1|3177362_3177650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913887.1|3177797_3178334_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	48.3	4.4e-37
WP_146913889.1|3178346_3178766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913891.1|3178783_3179017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913893.1|3179013_3179958_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	32.5	6.8e-33
WP_146913895.1|3180050_3180542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146914230.1|3180607_3180907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146913897.1|3180921_3185850_+	hypothetical protein	NA	A0A2H4J107	uncultured_Caudovirales_phage	28.0	2.3e-31
