The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	7173	42934	1842476	terminase,holin,integrase,portal,tail,capsid	Lactobacillus_phage(56.0%)	48	12410:12426	43980:43996
WP_146419205.1|7173_7425_-|holin	holin	holin	NA	NA	NA	NA
WP_146419677.1|7424_7652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419206.1|7758_7905_-	XkdX family protein	NA	NA	NA	NA	NA
WP_146419207.1|7904_8213_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_146419208.1|8224_8992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419209.1|8981_10811_-	hypothetical protein	NA	A0A2K9VBY4	Lactobacillus_phage	27.4	3.9e-24
WP_146419210.1|10810_11086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419211.1|11075_11402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419212.1|11391_12528_-	hypothetical protein	NA	O03938	Lactobacillus_phage	40.0	1.7e-54
12410:12426	attL	GAATTATCGATAAAATT	NA	NA	NA	NA
WP_146419678.1|12536_13334_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	41.9	2.0e-57
WP_146419213.1|13386_18654_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A7DYB8	Streptococcus_phage	26.3	9.3e-55
WP_146419214.1|18657_19290_-	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	33.5	3.3e-23
WP_146419215.1|19296_19734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419216.1|20386_20782_-|capsid	capsid protein	capsid	Q5YA65	Bacillus_phage	39.7	1.7e-22
WP_146419217.1|20768_21119_-|capsid	capsid protein	capsid	U3PIU9	Lactobacillus_phage	53.7	5.1e-18
WP_146419218.1|21118_21466_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	44.4	1.9e-20
WP_146419219.1|21462_21879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419220.1|21977_22889_-	hypothetical protein	NA	Q6SED2	Lactobacillus_prophage	64.3	8.1e-108
WP_158632712.1|22901_23459_-|capsid	capsid protein	capsid	Q9T1B8	Listeria_phage	41.4	3.1e-25
WP_146419222.1|23558_24692_-|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	41.8	3.9e-67
WP_146419223.1|24688_26245_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	57.2	1.5e-157
WP_146419679.1|26238_27597_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.3	7.0e-156
WP_146419224.1|27608_28109_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	64.5	1.9e-50
WP_146419225.1|28260_29370_-	hypothetical protein	NA	A0A2I6PCS6	Staphylococcus_phage	30.5	5.2e-08
WP_146419226.1|29736_30180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158632713.1|30551_30695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419227.1|30870_31107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419228.1|31099_31345_-	hypothetical protein	NA	O03923	Lactobacillus_phage	45.2	3.1e-14
WP_146419229.1|31337_31871_-	DUF1642 domain-containing protein	NA	A0A2P0ZKS6	Lactobacillus_phage	50.7	1.1e-11
WP_146419230.1|31870_32233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419231.1|32398_32716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419232.1|32727_33252_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	52.3	4.6e-39
WP_146419233.1|33271_33532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419234.1|33500_34202_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	65.0	9.1e-83
WP_146419235.1|34205_35078_-	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	37.8	5.3e-40
WP_146419236.1|35084_35852_-	single-stranded DNA-binding protein	NA	Q8SDH6	Lactococcus_phage	38.6	1.3e-13
WP_146419237.1|35851_36745_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_146419238.1|37103_37349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419680.1|37349_37673_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_146419239.1|37881_38103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419240.1|38171_38459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419241.1|38585_38807_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146419242.1|38950_39274_+	helix-turn-helix domain-containing protein	NA	A0A059T669	Listeria_phage	56.6	2.4e-22
WP_146419243.1|39280_39673_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	38.0	8.3e-09
WP_146419681.1|40006_40216_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	70.5	6.8e-18
WP_158632714.1|40291_41119_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_146419245.1|41415_41664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419682.1|41761_42934_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	29.9	2.7e-39
43980:43996	attR	AATTTTATCGATAATTC	NA	NA	NA	NA
>prophage 2
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	54347	146630	1842476	terminase,head,holin,tRNA,portal,integrase,tail,protease,capsid	Lactobacillus_phage(52.27%)	116	92569:92593	135629:135653
WP_011673299.1|54347_55085_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011673298.1|55084_55600_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011673297.1|55674_55947_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002833575.1|56305_57736_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002833574.1|57753_58095_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_060743712.1|58100_59321_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	35.9	2.7e-13
WP_146419247.1|59338_62869_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002833571.1|62878_63577_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	31.9	2.6e-21
WP_002833570.1|63673_63916_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	49.3	9.0e-06
WP_002833569.1|63954_64998_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_146419248.1|65014_67042_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_060743715.1|67092_68787_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002833566.1|68808_69171_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_011673291.1|69470_69656_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_060743716.1|69699_70341_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002833563.1|70340_70988_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_060743717.1|70984_71914_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_146419249.1|71924_73448_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	28.5	9.1e-19
WP_002833560.1|73444_74191_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	G9BWD9	Planktothrix_phage	24.2	2.8e-05
WP_146419250.1|74199_75534_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_060743718.1|75517_76480_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.3	5.7e-11
WP_146419251.1|76502_78923_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_146419252.1|78937_80131_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	5.6e-40
WP_002833554.1|80242_80452_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002833553.1|80453_81068_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	32.9	1.8e-18
WP_011673284.1|81363_81699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060743721.1|81770_83447_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002833550.1|83458_83917_-	arginine repressor, DNA-binding domain protein	NA	NA	NA	NA	NA
WP_146419253.1|83925_84744_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_023440278.1|84757_85648_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002833547.1|85640_85877_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002833546.1|85876_87220_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	30.9	2.1e-43
WP_002833545.1|87220_88072_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	4.9e-38
WP_002833544.1|88197_88599_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002833543.1|88598_89027_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002833542.1|89044_89608_-	elongation factor P	NA	NA	NA	NA	NA
WP_002833541.1|89732_90020_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011673282.1|90043_90370_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002833539.1|90391_90700_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011673281.1|90829_91459_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146419254.1|91791_92304_-	hypothetical protein	NA	NA	NA	NA	NA
92569:92593	attL	TCTCTCCCGAATCATATTAATATAG	NA	NA	NA	NA
WP_146419255.1|92869_93481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419256.1|93505_94645_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	49.0	7.1e-93
WP_146419257.1|94628_94868_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	54.4	5.0e-09
WP_146419683.1|94867_95152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419258.1|95201_95348_-	XkdX family protein	NA	NA	NA	NA	NA
WP_146419259.1|95347_95656_-	DUF2977 domain-containing protein	NA	Q7M292	Lactobacillus_phage	52.0	6.7e-14
WP_146419260.1|95667_96435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419261.1|96424_98248_-	hypothetical protein	NA	A0A2K9VBY4	Lactobacillus_phage	27.6	3.8e-24
WP_146419262.1|98249_98576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419263.1|98572_99343_-	hypothetical protein	NA	D2KRC0	Lactobacillus_phage	28.2	2.5e-17
WP_146419264.1|99326_101300_-	hypothetical protein	NA	E9LUJ4	Lactobacillus_phage	33.9	1.0e-99
WP_005917197.1|101296_102133_-|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	35.8	3.4e-44
WP_146419684.1|102144_106128_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	53.3	1.6e-152
WP_146419265.1|106634_106847_-|tail	phage tail tape measure protein	tail	A0A2P0ZLD9	Lactobacillus_phage	60.9	8.4e-16
WP_146419266.1|106888_107200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419267.1|107257_107551_-	collagen-like protein	NA	NA	NA	NA	NA
WP_146419268.1|107563_108217_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	67.2	9.7e-71
WP_146419269.1|108229_108643_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	45.0	2.1e-26
WP_146419270.1|108639_109047_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	60.9	2.7e-39
WP_146419271.1|109022_109424_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	45.9	6.9e-27
WP_146419272.1|109389_109698_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A8ATA0	Listeria_phage	45.7	3.9e-14
WP_146419273.1|109834_111019_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	56.9	4.4e-114
WP_146419274.1|111043_111802_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	71.6	1.9e-94
WP_146419275.1|111785_112931_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	53.2	1.3e-110
WP_146419276.1|112952_114635_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	60.0	1.9e-198
WP_146419277.1|114631_114952_-|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	44.6	2.5e-11
WP_158632715.1|115296_115440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419685.1|115430_115757_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	59.1	7.3e-27
WP_146419279.1|115741_116170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158632716.1|116173_116332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099299940.1|116328_116511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419280.1|116572_116986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419686.1|117411_117819_-	DUF1492 domain-containing protein	NA	A0A2P0ZLC0	Lactobacillus_phage	64.7	7.7e-42
WP_146419281.1|118204_120076_-	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	60.7	7.3e-228
WP_146419282.1|120084_120414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419283.1|120491_122177_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	58.4	2.7e-197
WP_146419284.1|122182_122383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419285.1|122383_122662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419286.1|122662_122971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419287.1|123004_124126_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_146419288.1|124297_124492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419289.1|124488_124728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419290.1|124727_124946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419291.1|124938_125484_-	DUF1642 domain-containing protein	NA	NA	NA	NA	NA
WP_146419292.1|125487_125682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419293.1|125683_125878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419294.1|125937_126414_-	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	52.2	7.4e-36
WP_146419295.1|126413_126689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419296.1|126681_126948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419297.1|126947_128771_-	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	56.0	9.4e-164
WP_146419298.1|129103_129436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419299.1|129438_130671_-	DEAD/DEAH box helicase	NA	A0A1B1P7L4	Bacillus_phage	69.8	8.6e-169
WP_146419300.1|130798_131338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419301.1|131415_131661_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	60.3	2.4e-14
WP_158632717.1|131763_132105_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_146419303.1|132250_132439_-	XRE family transcriptional regulator	NA	A0A2P0ZL97	Lactobacillus_phage	43.5	2.8e-07
WP_069824988.1|132739_133081_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEP7	Streptococcus_phage	40.7	2.6e-19
WP_146419304.1|133090_133525_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	30.2	8.0e-05
WP_146419305.1|133585_134242_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_146419306.1|134388_135528_+|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	49.6	1.6e-89
WP_023440273.1|135865_136069_+	membrane protein	NA	NA	NA	NA	NA
135629:135653	attR	TCTCTCCCGAATCATATTAATATAG	NA	NA	NA	NA
WP_002833535.1|136208_136436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419307.1|136739_137279_-	2-deoxyuridine 5-triphosphate nucleotidohydrolase	NA	A0A290GJJ6	Caldibacillus_phage	25.7	2.8e-07
WP_002833533.1|137288_138206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002833532.1|138198_139074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002833531.1|139222_140563_-	type I glutamate--ammonia ligase	NA	M1NM71	Moumouvirus	22.8	2.5e-12
WP_023440271.1|140597_140963_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146419308.1|141043_142300_-	aluminum resistance protein	NA	NA	NA	NA	NA
WP_060743724.1|142283_143216_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_055126203.1|143217_143952_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	35.2	1.2e-13
WP_002833525.1|144034_144211_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002833524.1|144264_144684_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002833523.1|144715_145678_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002833522.1|145695_145908_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_060743725.1|145940_146630_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	311942	321083	1842476	integrase	Brochothrix_phage(14.29%)	13	305416:305430	327721:327735
305416:305430	attL	TTCACGCGTCATCCC	NA	NA	NA	NA
WP_061812609.1|311942_312134_-	hypothetical protein	NA	D7RWL9	Brochothrix_phage	42.6	6.0e-05
WP_061812608.1|312136_312442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061812607.1|312709_313030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158632718.1|313043_313676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419371.1|313672_314548_-	ATP-binding protein	NA	A0A2D1GQF9	Lysinibacillus_phage	24.7	1.2e-12
WP_146419372.1|314550_315495_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	27.3	2.6e-16
WP_146419373.1|315507_315975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419374.1|316191_316797_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.3	8.2e-40
WP_061812601.1|316860_317127_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055126102.1|317142_317370_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064635649.1|317536_318184_+	helix-turn-helix transcriptional regulator	NA	Q8LTN5	Lactococcus_phage	50.7	6.6e-11
WP_055126101.1|318449_319598_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.7	9.4e-61
WP_146419375.1|319928_321083_-|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	36.6	6.8e-59
327721:327735	attR	GGGATGACGCGTGAA	NA	NA	NA	NA
>prophage 4
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	397021	406260	1842476		Streptococcus_phage(33.33%)	7	NA	NA
WP_002834073.1|397021_397615_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	1.6e-56
WP_002834074.1|397662_397935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146419413.1|398019_400314_-	N-acetylmuramidase	NA	A0A0N7IR99	Lactobacillus_phage	47.4	5.0e-37
WP_002834077.1|400490_401420_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	4.0e-54
WP_023440059.1|401432_402434_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	56.7	3.9e-95
WP_002834080.1|402430_403318_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.1	1.1e-11
WP_023440058.1|403416_406260_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.9	1.9e-304
>prophage 5
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	417462	425080	1842476		Bacillus_phage(33.33%)	8	NA	NA
WP_023440049.1|417462_418221_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.7e-18
WP_060743357.1|418234_419035_-	phosphate ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.0	3.4e-09
WP_002834456.1|419052_419940_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011673073.1|419940_420849_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_060743355.1|420848_421730_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	25.5	2.7e-07
WP_146419418.1|421891_423277_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.3e-27
WP_002834460.1|423248_423953_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	6.9e-38
WP_146419419.1|423963_425080_-	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	47.1	1.9e-05
>prophage 6
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	795132	841838	1842476	integrase,bacteriocin,transposase	Enterococcus_phage(33.33%)	33	788449:788463	825940:825954
788449:788463	attL	ACTTCTTAATATTGG	NA	NA	NA	NA
WP_146419488.1|795132_795990_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.4	1.1e-146
WP_146419489.1|796810_798487_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_011673114.1|798507_799488_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	9.3e-17
WP_146419490.1|799468_800974_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_055126657.1|801229_803185_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_055126658.1|803204_805364_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_055126659.1|805443_806310_+	ROK family protein	NA	NA	NA	NA	NA
WP_021730470.1|806387_806594_-	integral membrane protein	NA	NA	NA	NA	NA
WP_146419491.1|806691_807621_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
WP_055126660.1|808861_811063_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_011673107.1|811120_813049_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_011673106.1|813284_814115_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_055126661.1|814561_814786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003606447.1|815377_815626_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_146419492.1|817116_818490_-	MFS transporter	NA	NA	NA	NA	NA
WP_056979404.1|818529_820059_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_055126665.1|820185_820377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419493.1|822053_822728_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	31.8	8.1e-12
WP_060743983.1|822783_823734_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	9.4e-99
WP_060743984.1|823748_824675_-	ribonucleoside-diphosphate reductase	NA	A0A096XT60	Enterococcus_phage	33.0	4.3e-40
WP_146419494.1|824782_826951_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.2	3.6e-255
825940:825954	attR	ACTTCTTAATATTGG	NA	NA	NA	NA
WP_146419495.1|826957_827410_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_146419496.1|828284_829622_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_146419497.1|829687_831160_-	amino acid permease	NA	NA	NA	NA	NA
WP_146419498.1|831326_831638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146419499.1|832450_833044_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_060743990.1|833556_834507_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_146419500.1|836732_837662_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	28.9	7.4e-24
WP_002834573.1|837808_838147_-	pediocin PA-1 immunity protein	NA	NA	NA	NA	NA
WP_146419695.1|838184_838373_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_146419502.1|838888_840238_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094104182.1|840303_840741_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146419503.1|840968_841838_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	31.2	3.2e-29
>prophage 7
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	1060649	1068905	1842476		Bacillus_phage(33.33%)	9	NA	NA
WP_023440818.1|1060649_1061501_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	34.9	2.1e-12
WP_002834122.1|1061514_1061700_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_060743550.1|1061916_1063023_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_023440817.1|1063051_1063756_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_146419697.1|1063777_1064920_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	33.8	5.3e-64
WP_146419545.1|1065050_1065548_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	38.1	2.2e-14
WP_002834114.1|1065630_1066320_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	5.7e-37
WP_011673829.1|1066331_1067468_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	2.8e-25
WP_060743552.1|1067648_1068905_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	23.1	3.8e-07
>prophage 8
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	1292246	1301113	1842476		Streptococcus_phage(33.33%)	10	NA	NA
WP_146419581.1|1292246_1294412_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.9	1.1e-248
WP_011673696.1|1294513_1294744_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	48.1	8.0e-12
WP_146419582.1|1294955_1295561_+	methyltransferase	NA	NA	NA	NA	NA
WP_060743850.1|1295553_1296039_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	31.6	1.8e-05
WP_060743849.1|1296250_1297996_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	48.4	2.8e-56
WP_002833269.1|1298011_1298326_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002833270.1|1298352_1298952_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002833271.1|1299116_1299746_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	2.0e-52
WP_002833272.1|1299761_1300097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060743848.1|1300096_1301113_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.8	4.3e-33
>prophage 9
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	1309942	1318506	1842476		Synechococcus_phage(33.33%)	9	NA	NA
WP_011673684.1|1309942_1310425_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	2.6e-20
WP_060743844.1|1310408_1311548_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_060743843.1|1311547_1312276_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.0	3.6e-42
WP_011673681.1|1312268_1312523_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_060743842.1|1312525_1313200_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_146419585.1|1313217_1315425_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	1.3e-146
WP_023440671.1|1315409_1316879_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	1.1e-56
WP_060743839.1|1316878_1317928_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	40.2	5.2e-58
WP_060743838.1|1317924_1318506_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	6.7e-23
>prophage 10
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	1682438	1692056	1842476	tRNA	Staphylococcus_phage(37.5%)	9	NA	NA
WP_002833201.1|1682438_1682909_+	nucleoside deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	40.1	3.8e-16
WP_002833200.1|1682963_1683848_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	2.1e-52
WP_060743606.1|1684101_1685310_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	30.5	3.8e-36
WP_146419638.1|1685312_1687190_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	2.9e-51
WP_011673474.1|1687202_1688153_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.7	3.4e-117
WP_146419639.1|1688181_1688667_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	39.6	6.0e-25
WP_060743608.1|1688788_1690240_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023440467.1|1690236_1690974_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.3e-34
WP_060743609.1|1691210_1692056_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.4	2.3e-16
>prophage 11
NZ_CP039378	Pediococcus pentosaceus strain SL001 chromosome, complete genome	1842476	1811599	1817953	1842476		Lactobacillus_phage(16.67%)	8	NA	NA
WP_002833631.1|1811599_1812121_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	57.1	4.0e-43
WP_060744016.1|1812244_1812985_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	4.9e-18
WP_060744015.1|1812985_1813207_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	32.6	3.9e-08
WP_011673329.1|1813223_1813706_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.0	4.9e-11
WP_002833627.1|1813942_1814413_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_146419673.1|1814541_1814769_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_060744014.1|1814872_1815997_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.2	1.3e-22
WP_011673326.1|1816093_1817953_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	5.3e-138
