The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	689695	698167	2851771		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|689695_690340_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|690354_690684_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_146419950.1|690697_691636_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	8.6e-36
WP_002288073.1|691671_692496_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|692488_692836_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|692904_693777_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|693885_695007_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|695060_695663_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|695977_698167_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 2
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	717252	755415	2851771	capsid,holin,portal,terminase,protease,head,transposase,integrase,tail	Enterococcus_phage(31.03%)	53	717869:717904	758705:758740
WP_002289451.1|717252_717597_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289452.1|717609_717903_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
717869:717904	attL	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
WP_002301539.1|717995_719144_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|719155_719467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|719519_719915_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|719950_720295_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|720595_720817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|720943_721720_+	phage antirepressor KilAC domain-containing protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_010729259.1|721722_721911_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	8.8e-09
WP_002349273.1|721912_722197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|722217_722406_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|722731_722971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|722976_723663_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|723665_724496_+	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|724512_725364_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|725360_725720_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|725734_725896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|725892_726198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|726197_726554_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|726540_726759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|726943_727411_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002349267.1|727685_727922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305389.1|727945_728287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305388.1|728279_728471_-	YegP family protein	NA	NA	NA	NA	NA
WP_002305387.1|728680_729328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|729587_729932_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|729936_730218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|730320_730635_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|730612_732307_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|732326_733505_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|733467_734154_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|734153_735314_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_010729262.1|735323_736199_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	1.6e-129
WP_002286523.1|736195_736507_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|736496_736850_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|736839_737241_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|737233_737638_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002297404.1|737773_739024_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305379.1|739432_740038_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|740057_740420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|740422_740605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305374.1|740621_744041_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305373.1|744091_744829_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305372.1|744838_747130_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_010729263.1|747153_749256_+	hypothetical protein	NA	A0A0M4RT83	Enterococcus_phage	39.0	1.3e-63
WP_002290627.1|749272_749422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|749418_749865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|749866_750004_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|750041_750335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|750331_750556_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|750552_751578_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|752517_753679_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002302440.1|754113_755415_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
758705:758740	attR	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
>prophage 3
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	792013	892876	2851771	capsid,holin,portal,terminase,plate,head,protease,transposase,integrase,tail,tRNA	Enterococcus_phage(11.36%)	116	841285:841303	877253:877271
WP_002286621.1|792013_794812_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|794860_796387_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|796401_797049_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|797232_797562_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|797738_798467_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|798482_799496_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|799495_800773_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|800835_803538_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|803689_804007_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|804036_804357_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|804464_805925_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|805992_806214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|806244_806427_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|806426_806840_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|806962_808144_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|808214_808379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|808674_809814_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002303012.1|810112_810748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|810860_811496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|811529_811991_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|812120_812552_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|812569_812890_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|813188_813965_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|813979_814183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|814198_814537_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|814523_814703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|814745_815216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|815302_816001_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|816178_816520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|816512_817184_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|817189_817876_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|817878_818628_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|818639_818909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|818914_819079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|819071_819371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|819370_819673_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|819712_820078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303019.1|820567_820708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303020.1|820704_820893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|820900_821095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|821127_821340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303023.1|821464_821668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|821664_821937_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|821937_822123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|822109_822457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|822416_822893_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|823038_823767_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|823814_824093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|824094_824481_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|824477_824858_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|824969_825422_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|825418_827146_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002304437.1|827209_828397_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	65.5	1.3e-142
WP_002303035.1|828368_828938_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|828950_830315_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|830316_830598_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|830575_830902_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|830891_831230_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|831219_831585_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|831591_832218_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|832217_832682_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|832876_835186_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|835197_835902_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|835898_838658_+|tail	phage tail protein	tail	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002332773.1|838670_839579_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002301866.1|839578_840196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|840199_840649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|840648_841143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|841156_841588_+	hypothetical protein	NA	NA	NA	NA	NA
841285:841303	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|841589_841727_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|841763_842057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|842053_842278_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002303477.1|842274_843294_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|844070_844370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|844375_844606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|844855_845056_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|845372_846560_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|846834_848067_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|848321_848891_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|849068_849509_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|849666_850431_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|850462_851386_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|851461_852601_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|852593_853394_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|853393_854221_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|854198_854933_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|855032_855899_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|855912_856485_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|856506_857535_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|857632_858484_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|858517_860551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289081.1|862083_862890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|862901_864122_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|864111_865698_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289076.1|865736_867875_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|868242_869226_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002302725.1|869603_870995_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|871010_872051_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|872069_873155_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|873187_874150_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002347167.1|874142_875576_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|875572_876643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|876629_878051_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
877253:877271	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002289359.1|878063_879071_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|879082_880087_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|880083_881232_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|881204_881882_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|881871_883014_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|883026_884004_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|884003_884912_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|884912_885665_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|885669_886617_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002296623.1|886790_888086_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002286097.1|888574_889528_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|890600_891779_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002301399.1|891916_892876_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 4
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1164079	1173140	2851771		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1164079_1165375_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1165554_1165932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1166187_1166916_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1166915_1167170_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1167171_1167843_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1167843_1170066_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1170050_1171490_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1171512_1172565_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1172561_1173140_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1441283	1490645	2851771	transposase,protease	Streptococcus_phage(30.77%)	58	NA	NA
WP_002296623.1|1441283_1442579_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002303262.1|1443029_1443272_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_002303421.1|1443817_1444348_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002303420.1|1444529_1445186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303419.1|1445312_1445786_-	trimethoprim-resistant dihydrofolate reductase DfrF	NA	F8SJN4	Pseudomonas_phage	45.1	3.0e-21
WP_002296683.1|1446453_1447668_-	ammonium transporter	NA	NA	NA	NA	NA
WP_002290686.1|1448008_1448251_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1448282_1448840_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1448852_1449041_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1449053_1449620_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002291299.1|1450036_1450210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295138.1|1450850_1451324_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1451332_1451560_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002347126.1|1451993_1453529_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.3e-125
WP_002295142.1|1453752_1454124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1454379_1454622_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1454653_1455556_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1455568_1455757_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1455770_1456334_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1456371_1457265_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002303839.1|1457342_1458266_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1458314_1458665_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1458697_1459600_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1459592_1460450_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1460783_1461593_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1461632_1462130_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1462774_1463098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1463261_1463516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1463585_1463831_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1463906_1464272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1464332_1464896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1465547_1466843_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1467981_1469283_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1469443_1469644_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1470039_1470189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1470395_1471109_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1471101_1472187_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1472203_1472647_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1472680_1473034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1473145_1473547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1473583_1474093_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_146419957.1|1474114_1474972_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1474989_1475823_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1475836_1476634_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1476666_1476951_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1476947_1477949_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002321675.1|1477950_1479018_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.9e-53
WP_002296639.1|1479016_1479865_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202380.1|1480300_1481620_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002296638.1|1482194_1482401_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1482602_1483604_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1483608_1485522_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_002296634.1|1485689_1486196_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1486355_1486796_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1486821_1487979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296631.1|1487981_1488338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1488635_1489610_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1489805_1490645_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1493796	1523262	2851771	transposase,integrase	Streptococcus_phage(28.57%)	27	1498087:1498102	1507808:1507823
WP_002297404.1|1493796_1495047_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1495188_1496184_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1496201_1496756_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1496743_1497235_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|1497227_1499096_-	HTH domain-containing protein	NA	NA	NA	NA	NA
1498087:1498102	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_002289420.1|1499114_1499915_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1500138_1500354_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1500492_1500978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1501433_1501847_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_000997695.1|1502897_1504076_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002286097.1|1504231_1505185_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1505241_1506369_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1506586_1507729_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1507733_1507919_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1507808:1507823	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1508272_1508518_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1508511_1508913_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010729345.1|1509099_1510908_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729344.1|1510930_1512697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1512709_1513504_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729700.1|1513513_1514890_-	MFS transporter	NA	NA	NA	NA	NA
WP_010729341.1|1515009_1515657_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1515740_1517168_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1517241_1518321_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1518323_1519955_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729337.1|1520258_1520930_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729336.1|1521648_1521819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|1521942_1523262_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
>prophage 7
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1668211	1677371	2851771		Streptococcus_phage(83.33%)	12	NA	NA
WP_002341493.1|1668211_1668418_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
WP_010729705.1|1668410_1669553_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_008788621.1|1670064_1670700_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001814923.1|1671175_1671292_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|1671307_1673227_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_000336323.1|1673345_1673513_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1673572_1673926_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_022278534.1|1674429_1674849_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025481129.1|1674874_1675081_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296523.1|1675308_1675482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158003447.1|1675457_1676123_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002289374.1|1676204_1677371_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
>prophage 8
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1695414	1805026	2851771	transposase,integrase,protease,tRNA	Streptococcus_phage(19.23%)	109	1791732:1791747	1802467:1802482
WP_002297218.1|1695414_1696710_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288513.1|1696904_1697252_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|1697278_1699585_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1699597_1699909_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1699905_1700199_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1700220_1701396_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1701418_1701892_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|1702036_1706395_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002294137.1|1706606_1708316_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1708383_1709652_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1709812_1710613_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1710609_1711422_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1711830_1713081_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1713399_1713957_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1713959_1714682_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1714817_1715699_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1715797_1716580_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1716938_1717418_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1717634_1718726_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1718718_1718847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1718850_1719396_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1719849_1721541_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1721960_1722908_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1723022_1724042_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1724132_1725362_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1725822_1726524_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301319.1|1727132_1728149_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1728145_1728610_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1728616_1729159_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1729142_1729967_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1730055_1731036_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1731059_1732544_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1732555_1733545_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1733792_1733960_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_010729586.1|1734021_1735833_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1735829_1736195_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1736357_1736753_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1736770_1737733_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1737732_1737945_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1737965_1738664_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1738683_1739226_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1739357_1740362_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1740358_1741348_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1741344_1742151_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1742316_1743273_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1743349_1743868_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1743955_1744105_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1744332_1744779_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002305724.1|1744973_1746869_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1747193_1748168_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1748733_1749300_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1749555_1750887_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1750852_1751203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1751714_1752059_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1752324_1753284_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1753473_1754070_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1754193_1755993_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1756270_1756483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1756944_1757094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1757346_1758306_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1758518_1759427_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1759475_1759862_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|1760169_1761516_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1761627_1762977_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1763093_1764347_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1764417_1764903_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002305727.1|1764925_1765684_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1765699_1766878_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1767107_1769228_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1769450_1770176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1770165_1770675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1770744_1772193_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1772192_1772909_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1772889_1773240_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1773383_1774157_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297218.1|1774821_1776117_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302293.1|1776435_1776738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1777881_1778196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033613710.1|1778288_1779491_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1779827_1780067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1780428_1780689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1780873_1781371_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1781500_1782211_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1782223_1783888_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1784092_1784755_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1784764_1785580_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1785841_1786285_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1786418_1786757_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1786744_1787122_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1787345_1788539_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1788704_1789127_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1789521_1789716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1789712_1790207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1790368_1791541_-	class C sortase	NA	NA	NA	NA	NA
1791732:1791747	attL	TTTGTTTCCAATAGTT	NA	NA	NA	NA
WP_002288981.1|1791746_1792562_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1792711_1793158_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1793154_1794159_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1794198_1794528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1794653_1796981_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1797823_1798117_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1798519_1799698_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1799801_1800116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1800222_1800438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1800737_1800980_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1800966_1801395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296127.1|1801546_1803094_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
1802467:1802482	attR	TTTGTTTCCAATAGTT	NA	NA	NA	NA
WP_002287659.1|1803195_1803549_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1803538_1803733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|1803863_1805026_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 9
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	1818374	1852707	2851771	transposase,tRNA	Streptococcus_phage(70.59%)	31	NA	NA
WP_086956705.1|1818374_1819537_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1819629_1820139_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287760.1|1820477_1821431_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1821383_1821620_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002305709.1|1822039_1823161_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1823488_1824898_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1824894_1825623_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_146419960.1|1825750_1826662_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	8.3e-60
WP_002289057.1|1826678_1827686_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002305708.1|1827682_1829812_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002296840.1|1830112_1831300_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002349083.1|1831392_1832211_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	81.0	2.0e-118
WP_002298631.1|1832344_1834171_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_010729754.1|1834568_1835477_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002288938.1|1837453_1837843_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002305705.1|1837892_1838789_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1838791_1840639_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1840735_1841236_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002298822.1|1841248_1841470_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002305703.1|1841474_1841612_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1841608_1842793_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1843048_1843303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1843327_1844470_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002349191.1|1844529_1845882_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286928.1|1845952_1846297_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286926.1|1846306_1846681_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1846693_1847008_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002305699.1|1847121_1850349_-	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286921.1|1850427_1851090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286913.1|1851462_1851810_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1851945_1852707_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	2088876	2182417	2851771	capsid,holin,portal,terminase,plate,transposase,tail,tRNA	Enterococcus_phage(25.71%)	103	NA	NA
WP_002303350.1|2088876_2089836_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297185.1|2090180_2091476_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295061.1|2091578_2092682_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_002295059.1|2092903_2093374_-	DUF4809 family protein	NA	NA	NA	NA	NA
WP_000202380.1|2093630_2094950_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002302982.1|2095390_2097031_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002302984.1|2097184_2098507_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002295053.1|2098568_2099000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302985.1|2099063_2099900_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002295049.1|2100089_2100392_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002290886.1|2100417_2100849_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290885.1|2100845_2101112_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002290883.1|2101365_2102091_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002289867.1|2102643_2103396_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289868.1|2103411_2103891_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296509.1|2104141_2105722_-	ABC transporter	NA	NA	NA	NA	NA
WP_060811100.1|2105714_2106458_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	5.2e-28
WP_060811099.1|2106633_2107410_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287743.1|2107657_2108494_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287744.1|2108504_2109434_-	permease	NA	NA	NA	NA	NA
WP_002287745.1|2109625_2109979_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287746.1|2110052_2110709_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287747.1|2110934_2112869_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002321414.1|2112954_2114178_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002321415.1|2114171_2116070_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002287753.1|2116063_2117182_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002302991.1|2117264_2118098_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287755.1|2118090_2119008_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287756.1|2119030_2119210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287757.1|2119234_2120359_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002296511.1|2120541_2121450_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287759.1|2121590_2123204_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000222572.1|2123854_2124808_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2124841_2126071_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2126072_2126990_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2126993_2127731_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2127821_2128349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2128528_2129122_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2129225_2129711_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2129863_2130061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2130155_2131916_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2131912_2133643_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2134035_2134248_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2134249_2135929_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2136182_2136383_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_010726559.1|2137337_2138348_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_010726558.1|2138344_2138764_-|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	68.7	5.0e-44
WP_002302750.1|2138833_2138974_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.8	1.1e-08
WP_002332774.1|2138966_2139314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|2139327_2139822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|2139821_2140271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2140274_2140892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2140891_2141800_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2141812_2144575_-|tail	phage tail protein	tail	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2144571_2145312_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002305859.1|2145301_2148091_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303297.1|2148332_2148674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|2148673_2149282_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2149282_2149660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2149661_2150057_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2150049_2150421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2150420_2150762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2150773_2150989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2151011_2151902_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002312520.1|2151916_2152540_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2152666_2152984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2152985_2153864_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002343932.1|2153943_2155479_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2155490_2156909_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2156886_2157315_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2157332_2157557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2158107_2158494_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2158506_2158920_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2158996_2159293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2159289_2159493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2159499_2159730_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2159726_2160038_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2160176_2160992_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2160988_2161315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2161311_2161473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2161487_2161847_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2161843_2162695_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2162709_2163510_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2163552_2164443_-	recombinase RecT	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2164444_2165386_-	YqaJ viral recombinase family protein	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2165618_2165954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299325.1|2166220_2166445_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002303270.1|2166441_2166597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299038.1|2166753_2166909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2166980_2167211_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303268.1|2167207_2167366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303266.1|2167378_2167645_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2167844_2168549_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2168635_2169925_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2169990_2171343_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2171237_2171909_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2171963_2172617_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2172606_2173920_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2174229_2176875_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2177267_2177915_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2178487_2179699_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2179714_2180857_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002297218.1|2181121_2182417_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 11
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	2193642	2266131	2851771	transposase,tRNA	Streptococcus_phage(37.5%)	59	NA	NA
WP_086956687.1|2193642_2194804_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002302440.1|2195195_2196497_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287172.1|2202478_2202841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287231.1|2202914_2203295_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002311494.1|2203358_2204552_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287167.1|2204628_2205213_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002297404.1|2205621_2206872_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287165.1|2207196_2208195_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002287163.1|2208306_2208816_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002302440.1|2208994_2210296_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_146419963.1|2210331_2211006_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287159.1|2211007_2211772_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287156.1|2211779_2212457_-	YutD family protein	NA	NA	NA	NA	NA
WP_002287155.1|2212493_2213879_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002287154.1|2214195_2214711_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002305494.1|2214817_2215675_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287147.1|2215755_2216091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287145.1|2216157_2217528_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002287143.1|2217605_2218142_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287140.1|2218450_2219932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297185.1|2220096_2221392_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287139.1|2221556_2222264_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002287137.1|2222342_2222681_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287135.1|2222791_2223754_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002287134.1|2223768_2225100_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287133.1|2225107_2225788_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287132.1|2226006_2226486_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287130.1|2226612_2228292_-	ribonuclease J	NA	NA	NA	NA	NA
WP_010729408.1|2228839_2230342_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287128.1|2230354_2231017_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_002287127.1|2231117_2231321_-	CsbD family protein	NA	NA	NA	NA	NA
WP_002287126.1|2231431_2232616_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002294022.1|2232772_2234512_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287124.1|2235284_2235899_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294021.1|2236504_2236882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287122.1|2237181_2238063_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002297404.1|2238472_2239723_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287121.1|2239888_2240908_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002287119.1|2241540_2242545_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287118.1|2242557_2243607_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287116.1|2243623_2244445_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002287115.1|2244431_2245211_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287114.1|2245227_2245698_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287112.1|2245709_2246129_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287111.1|2246209_2248987_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002294014.1|2249177_2249402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|2250059_2251379_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002294013.1|2251864_2253580_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.7e-50
WP_002289511.1|2253582_2255346_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-44
WP_002289509.1|2255385_2255922_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002289508.1|2256244_2256667_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002289507.1|2256875_2257985_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.0	1.2e-20
WP_002294011.1|2258108_2258738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294004.1|2259188_2260073_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002305490.1|2260065_2260635_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_002294001.1|2260627_2261404_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002294000.1|2261558_2262881_-	amino acid permease	NA	NA	NA	NA	NA
WP_002293998.1|2263055_2263643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289325.1|2264121_2266131_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
>prophage 12
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	2513809	2592764	2851771	transposase,tRNA	Bacillus_phage(33.33%)	52	NA	NA
WP_002297218.1|2513809_2515105_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2515259_2515943_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2515944_2516781_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_010729265.1|2516791_2518546_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	2.4e-39
WP_002285994.1|2518821_2519163_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2519230_2521402_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002348711.1|2521570_2522470_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2522540_2523398_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2523382_2526085_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2526097_2527387_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2527536_2528583_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002302560.1|2528584_2530738_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_002304851.1|2531210_2532662_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2532658_2534383_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002285975.1|2534375_2534990_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2535334_2536792_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2536832_2537753_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2537764_2538712_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2539190_2539910_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285966.1|2539958_2541605_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2541783_2542374_+	YitT family protein	NA	NA	NA	NA	NA
WP_002294486.1|2542465_2543971_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2544054_2545407_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2545406_2545925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2545940_2546267_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2546279_2548259_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2548279_2548594_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2548761_2549055_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2549132_2550245_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2550397_2550622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2550631_2550811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2551004_2551175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161571196.1|2551598_2552627_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_016249808.1|2552764_2555836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2557742_2558504_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302440.1|2558602_2559904_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002285920.1|2560104_2561826_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_146419965.1|2561840_2563625_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	3.5e-46
WP_002285917.1|2564005_2565559_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2565906_2568321_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2568747_2570766_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2571135_2571792_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2571791_2572748_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2572747_2573314_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002303072.1|2573518_2575288_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.7e-54
WP_002285883.1|2575290_2577003_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002303070.1|2577117_2577786_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002295567.1|2577852_2578641_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2578723_2580196_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2580325_2581519_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2581852_2583148_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297218.1|2591468_2592764_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 13
NZ_CP041270	Enterococcus faecium strain VVEswe-S chromosome, complete genome	2851771	2721253	2738148	2851771		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2721253_2721568_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2721580_2721955_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2721964_2722300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2722382_2723723_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2723800_2724475_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2724467_2724632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2724707_2725142_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2725142_2725850_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2725839_2726130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2726388_2727573_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2727569_2727707_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2728451_2730362_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2730465_2730690_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2730702_2731206_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2731265_2731655_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2731641_2734089_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2734093_2736217_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2736213_2737218_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2737236_2738148_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	194168	25322	123664	194168	holin,transposase,integrase	Streptococcus_phage(21.21%)	94	64820:64836	119794:119810
WP_002340487.1|25322_26282_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	1.1e-35
WP_002311552.1|27080_27503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033583488.1|27522_29115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002316755.1|29370_29565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|29700_30951_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002311557.1|31360_33733_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	28.9	1.1e-10
WP_002353044.1|33793_35254_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002353045.1|35264_35708_+	topoisomerase	NA	NA	NA	NA	NA
WP_002340482.1|35792_37469_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.1	2.1e-117
WP_002295632.1|37484_37634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295629.1|37714_38311_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002340481.1|38323_39223_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002295625.1|39731_39989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311565.1|40147_40282_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|40424_40685_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002295619.1|41133_41340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293542.1|41339_41591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311567.1|41606_42044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060804903.1|42479_42668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002314432.1|42725_42992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340480.1|43001_43235_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_002335346.1|43577_43760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340479.1|43749_43971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|44011_45173_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002290556.1|45964_46732_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|47219_47645_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|47661_48177_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002340477.1|48187_49120_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290551.1|49122_50103_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290550.1|50130_50448_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002340476.1|50447_52154_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290548.1|52295_53702_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|53724_53997_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|54017_54917_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_086956687.1|55388_56551_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_000997695.1|57247_58426_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002295743.1|58550_59459_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300833.1|59861_61808_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300835.1|61810_62266_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|62279_63608_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|63641_63926_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|63927_64443_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|64458_65121_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
64820:64836	attL	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_002300842.1|65127_65700_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|65886_67407_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|67649_67835_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|67818_68001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|68954_69554_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|69617_70217_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002292418.1|71232_72105_-	ROK family protein	NA	NA	NA	NA	NA
WP_002293868.1|72368_74315_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|74499_75939_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|75940_76903_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|77072_78499_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|78741_79197_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|79782_80013_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|80242_81061_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|81221_81911_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|81924_83427_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|83439_83916_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|84413_85576_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|86693_87212_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|89287_90373_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|90480_91434_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|91564_92815_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|92833_93760_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|93838_94834_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|94849_96019_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|96034_96769_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956687.1|97539_98702_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002301811.1|99270_100563_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|100836_101097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|101347_102526_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_065305666.1|102877_103087_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	61.7	5.9e-14
WP_001015311.1|103563_104244_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000195429.1|104787_105960_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001028141.1|106089_107529_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_025189010.1|107529_107922_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_000202380.1|108165_109485_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002303110.1|111215_112253_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002387940.1|112249_112762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002319817.1|113429_114110_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002303113.1|114654_115206_+	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_010729368.1|115500_115674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|115673_116354_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|116613_117219_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|117263_117431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|117464_117764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|117804_118422_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|118746_119142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|119221_121573_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
119794:119810	attR	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_000718009.1|121697_122387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|122400_122853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|122983_123664_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
>prophage 1
NZ_CP041272	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2	89798	11767	62293	89798	transposase,protease	Staphylococcus_phage(25.0%)	45	NA	NA
WP_000997695.1|11767_12946_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_010729683.1|13858_14662_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320776.1|15246_15702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729682.1|15820_16879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729681.1|16920_18870_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.3e-30
WP_010729680.1|18872_22514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|22913_23252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347429.1|23602_25759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|25770_26004_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002320767.1|25993_26860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|26874_28845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|29354_29759_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|29775_30924_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_010729677.1|31130_31466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080441776.1|31722_33054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|33243_34416_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002347505.1|34759_35344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347506.1|35354_35600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347507.1|35605_36328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347508.1|36458_37202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347509.1|37207_37573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347720.1|37588_38119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060804948.1|38280_38589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730980.1|39140_39941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347439.1|39977_40160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347440.1|40270_40588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347443.1|40937_41417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002352866.1|41536_42874_+	CHAP domain-containing protein	NA	Q859L3	Staphylococcus_phage	54.0	6.5e-37
WP_002321012.1|42896_43424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347445.1|43410_43974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347446.1|44395_45133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347447.1|45149_45566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025478707.1|45958_47206_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_002347449.1|47473_49864_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_002350584.1|49912_51748_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002350583.1|51816_52680_+	class C sortase	NA	NA	NA	NA	NA
WP_002350582.1|52669_53779_+	class C sortase	NA	NA	NA	NA	NA
WP_010730977.1|54117_54918_+	hypothetical protein	NA	U5PTP5	Bacillus_phage	36.3	9.3e-07
WP_002320858.1|55005_55812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729859.1|56043_56913_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002320856.1|56932_57280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320855.1|57292_58555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320854.1|58634_60011_+	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	42.2	3.8e-48
WP_002320853.1|60007_60637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016922336.1|61693_62293_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP041273	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence	65253	32547	63473	65253	holin,transposase	Streptococcus_phage(53.85%)	38	NA	NA
WP_002297404.1|32547_33798_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_060797393.1|34207_36580_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.2	2.9e-11
WP_060809967.1|36640_38101_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305772.1|38111_40316_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303309.1|40331_40481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303311.1|40556_41150_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303312.1|41162_42062_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|42064_42550_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|42690_42894_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|42968_43229_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002347218.1|43665_43872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|43871_44123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|44137_44575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|44567_45275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|45655_45835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|45965_46235_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|46227_46485_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002347142.1|46943_47099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809248.1|47122_47947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|48111_48726_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002303116.1|48963_49386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|49395_49599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|49810_50395_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_060811353.1|51538_53401_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.6	5.3e-37
WP_060811354.1|53482_54778_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	42.4	5.8e-91
WP_002303114.1|54770_55121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|55384_56680_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_060475447.1|56705_57380_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.0	1.6e-116
WP_002347151.1|57433_57652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303415.1|57699_57972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303414.1|57961_58171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349053.1|58301_58622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303412.1|58884_59193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347150.1|59366_59735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347149.1|59848_60664_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001015311.1|60747_61428_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000026576.1|61799_62090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|62294_63473_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
>prophage 1
NZ_CP041279	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S4	34466	8691	33855	34466	transposase	Streptococcus_phage(60.0%)	30	NA	NA
WP_146419990.1|8691_9345_-	VanR-ABDEGLN family response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	7.5e-31
WP_001015311.1|9386_10067_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_106913803.1|11113_11209_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002311817.1|11511_11757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002328852.1|12243_12924_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.6e-127
WP_000527318.1|13218_13428_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_000301765.1|13444_13717_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|13718_14582_+	toxin zeta	NA	NA	NA	NA	NA
WP_001038796.1|14844_15582_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|15706_15790_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|16331_17126_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002297218.1|17714_19010_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002324522.1|19110_20019_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002347175.1|20021_20270_-	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_060810973.1|20266_21175_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	99.7	1.1e-176
WP_060810974.1|21207_21945_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	99.6	3.8e-140
WP_002303392.1|21925_22795_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.3	5.7e-151
WP_002303393.1|22809_23034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001015311.1|25228_25909_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000357244.1|26157_26676_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|26682_27195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|27465_28089_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_000599739.1|28300_28906_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|28921_29494_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|29966_30539_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|30639_31802_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322130.1|31842_32097_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|32207_32462_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|32654_32930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|32901_33855_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
