The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	689695	698167	2851579		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|689695_690340_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|690354_690684_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_146419950.1|690697_691636_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	8.6e-36
WP_002288073.1|691671_692496_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|692488_692836_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|692904_693777_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|693885_695007_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|695060_695663_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|695977_698167_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 2
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	717252	755415	2851579	portal,holin,protease,terminase,head,tail,capsid,integrase,transposase	Enterococcus_phage(31.03%)	53	717869:717904	758705:758740
WP_002289451.1|717252_717597_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289452.1|717609_717903_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
717869:717904	attL	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
WP_002301539.1|717995_719144_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|719155_719467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|719519_719915_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|719950_720295_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|720595_720817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|720943_721720_+	phage antirepressor KilAC domain-containing protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_010729259.1|721722_721911_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	8.8e-09
WP_002349273.1|721912_722197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|722217_722406_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|722731_722971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|722976_723663_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|723665_724496_+	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|724512_725364_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|725360_725720_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|725734_725896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|725892_726198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|726197_726554_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|726540_726759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|726943_727411_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002349267.1|727685_727922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305389.1|727945_728287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305388.1|728279_728471_-	YegP family protein	NA	NA	NA	NA	NA
WP_002305387.1|728680_729328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|729587_729932_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|729936_730218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|730320_730635_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|730612_732307_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|732326_733505_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|733467_734154_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|734153_735314_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_010729262.1|735323_736199_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	1.6e-129
WP_002286523.1|736195_736507_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|736496_736850_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|736839_737241_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|737233_737638_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002297404.1|737773_739024_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305379.1|739432_740038_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|740057_740420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|740422_740605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305374.1|740621_744041_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305373.1|744091_744829_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305372.1|744838_747130_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_010729263.1|747153_749256_+	hypothetical protein	NA	A0A0M4RT83	Enterococcus_phage	39.0	1.3e-63
WP_002290627.1|749272_749422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|749418_749865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|749866_750004_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|750041_750335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|750331_750556_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|750552_751578_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|752517_753679_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002302440.1|754113_755415_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
758705:758740	attR	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
>prophage 3
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	792013	892873	2851579	portal,holin,protease,terminase,head,tRNA,plate,tail,capsid,integrase,transposase	Enterococcus_phage(11.36%)	115	841285:841303	877253:877271
WP_002286621.1|792013_794812_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|794860_796387_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|796401_797049_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|797232_797562_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|797738_798467_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|798482_799496_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|799495_800773_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|800835_803538_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|803689_804007_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|804036_804357_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|804464_805925_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|805992_806214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|806244_806427_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|806426_806840_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|806962_808144_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|808214_808379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|808674_809814_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002303012.1|810112_810748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|810860_811496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|811529_811991_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|812120_812552_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|812569_812890_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|813188_813965_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|813979_814183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|814198_814537_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|814523_814703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|814745_815216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|815302_816001_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|816178_816520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|816512_817184_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|817189_817876_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|817878_818628_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002304429.1|818639_818909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|818914_819079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303016.1|819071_819371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|819370_819673_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303018.1|819712_820078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303019.1|820567_820708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303020.1|820704_820893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|820900_821095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|821127_821340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303023.1|821464_821668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|821664_821937_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303025.1|821937_822123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123838300.1|822109_822457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303026.1|822416_822893_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002349221.1|823038_823767_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303029.1|823814_824093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303030.1|824094_824481_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002304435.1|824477_824858_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303032.1|824969_825422_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002303033.1|825418_827146_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002304437.1|827209_828397_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	65.5	1.3e-142
WP_002303035.1|828368_828938_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303037.1|828950_830315_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002303039.1|830316_830598_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303041.1|830575_830902_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303043.1|830891_831230_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303045.1|831219_831585_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303047.1|831591_832218_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303049.1|832217_832682_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303051.1|832876_835186_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002349218.1|835197_835902_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002347164.1|835898_838658_+|tail	phage tail protein	tail	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002350776.1|838670_839579_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002301866.1|839578_840196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|840199_840649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|840648_841143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|841156_841588_+	hypothetical protein	NA	NA	NA	NA	NA
841285:841303	attL	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002303475.1|841589_841727_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|841763_842057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|842053_842278_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002303477.1|842274_843294_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002302747.1|844070_844370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302745.1|844375_844606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|844855_845056_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002296840.1|845372_846560_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286469.1|846834_848067_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|848321_848891_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|849068_849509_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|849666_850431_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|850462_851386_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|851461_852601_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|852593_853394_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|853393_854221_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|854198_854933_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|855032_855899_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|855912_856485_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|856506_857535_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|857632_858484_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002302719.1|858517_860551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289081.1|862083_862890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289079.1|862901_864122_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289078.1|864111_865698_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289076.1|865736_867875_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|868242_869226_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002302725.1|869603_870995_+	sugar transferase	NA	NA	NA	NA	NA
WP_002289071.1|871010_872051_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|872069_873155_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|873187_874150_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002347167.1|874142_875576_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002302730.1|875572_876643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|876629_878051_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
877253:877271	attR	TTTTGATAAAAAACAGTGG	NA	NA	NA	NA
WP_002289359.1|878063_879071_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|879082_880087_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|880083_881232_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|881204_881882_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|881871_883014_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|883026_884004_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|884003_884912_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|884912_885665_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|885669_886617_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002296623.1|886790_888086_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002286097.1|888574_889528_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002301399.1|891913_892873_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 4
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	1163975	1173036	2851579		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1163975_1165271_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1165450_1165828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1166083_1166812_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1166811_1167066_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1167067_1167739_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1167739_1169962_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1169946_1171386_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1171408_1172461_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1172457_1173036_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	1451889	1503972	2851579	protease,transposase	Streptococcus_phage(28.57%)	57	NA	NA
WP_002347126.1|1451889_1453425_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.3e-125
WP_002295142.1|1453648_1454020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1454275_1454518_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1454549_1455452_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1455464_1455653_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1455666_1456230_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1456267_1457161_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002303839.1|1457238_1458162_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1458210_1458561_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1458593_1459496_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1459488_1460346_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1460679_1461489_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1461528_1462026_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1462670_1462994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1463157_1463412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1463481_1463727_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1463802_1464168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1464228_1464792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|1467877_1469179_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1469339_1469540_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1469935_1470085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296656.1|1470291_1471005_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1470997_1472083_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1472099_1472543_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1472576_1472930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1473041_1473443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1473479_1473989_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_146419957.1|1474010_1474868_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1474885_1475719_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1475732_1476530_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1476562_1476847_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1476843_1477845_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002321675.1|1477846_1478914_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.9e-53
WP_002296639.1|1478912_1479761_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202380.1|1480196_1481516_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002296638.1|1482090_1482297_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1482498_1483500_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1483504_1485418_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_002296634.1|1485585_1486092_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1486251_1486692_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1486717_1487875_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296631.1|1487877_1488234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1488531_1489506_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1489701_1490541_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1490725_1491613_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002311093.1|1492206_1492902_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1492885_1493284_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002297404.1|1493692_1494943_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1495084_1496080_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1496097_1496652_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1496639_1497131_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|1497123_1498992_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1499010_1499811_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1500034_1500250_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1500388_1500874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1501329_1501743_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_000997695.1|1502793_1503972_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	1668107	1677267	2851579		Streptococcus_phage(83.33%)	12	NA	NA
WP_002341493.1|1668107_1668314_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
WP_010729705.1|1668306_1669449_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_008788621.1|1669960_1670596_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001814923.1|1671071_1671188_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|1671203_1673123_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_000336323.1|1673241_1673409_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1673468_1673822_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_022278534.1|1674325_1674745_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025481129.1|1674770_1674977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296523.1|1675204_1675378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158003447.1|1675353_1676019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002289374.1|1676100_1677267_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
>prophage 7
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	1695310	1804922	2851579	integrase,tRNA,protease,transposase	Streptococcus_phage(19.23%)	109	1791628:1791643	1802363:1802378
WP_002297218.1|1695310_1696606_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288513.1|1696800_1697148_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|1697174_1699481_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1699493_1699805_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1699801_1700095_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|1700116_1701292_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1701314_1701788_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|1701932_1706291_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002294137.1|1706502_1708212_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1708279_1709548_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1709708_1710509_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1710505_1711318_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1711726_1712977_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1713295_1713853_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1713855_1714578_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1714713_1715595_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1715693_1716476_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1716834_1717314_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1717530_1718622_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1718614_1718743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1718746_1719292_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1719745_1721437_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1721856_1722804_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1722918_1723938_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1724028_1725258_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1725718_1726420_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301319.1|1727028_1728045_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1728041_1728506_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1728512_1729055_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1729038_1729863_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1729951_1730932_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1730955_1732440_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1732451_1733441_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1733688_1733856_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_010729586.1|1733917_1735729_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1735725_1736091_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1736253_1736649_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1736666_1737629_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1737628_1737841_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1737861_1738560_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1738579_1739122_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1739253_1740258_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1740254_1741244_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1741240_1742047_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1742212_1743169_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1743245_1743764_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1743851_1744001_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1744228_1744675_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002305724.1|1744869_1746765_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1747089_1748064_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1748629_1749196_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1749451_1750783_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1750748_1751099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1751610_1751955_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1752220_1753180_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1753369_1753966_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1754089_1755889_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1756166_1756379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1756840_1756990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1757242_1758202_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002295743.1|1758414_1759323_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1759371_1759758_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|1760065_1761412_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1761523_1762873_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1762989_1764243_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1764313_1764799_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002305727.1|1764821_1765580_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1765595_1766774_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1767003_1769124_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1769346_1770072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1770061_1770571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1770640_1772089_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1772088_1772805_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1772785_1773136_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1773279_1774053_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297218.1|1774717_1776013_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302293.1|1776331_1776634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1777777_1778092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033613710.1|1778184_1779387_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1779723_1779963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1780324_1780585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1780769_1781267_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1781396_1782107_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1782119_1783784_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1783988_1784651_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1784660_1785476_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1785737_1786181_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1786314_1786653_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1786640_1787018_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1787241_1788435_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1788600_1789023_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1789417_1789612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1789608_1790103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1790264_1791437_-	class C sortase	NA	NA	NA	NA	NA
1791628:1791643	attL	TTTGTTTCCAATAGTT	NA	NA	NA	NA
WP_002288981.1|1791642_1792458_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1792607_1793054_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|1793050_1794055_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|1794094_1794424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|1794549_1796877_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1797719_1798013_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1798415_1799594_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1799697_1800012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1800118_1800334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1800633_1800876_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1800862_1801291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296127.1|1801442_1802990_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
1802363:1802378	attR	TTTGTTTCCAATAGTT	NA	NA	NA	NA
WP_002287659.1|1803091_1803445_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1803434_1803629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086953888.1|1803759_1804922_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 8
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	1818270	1852603	2851579	tRNA,transposase	Streptococcus_phage(70.59%)	31	NA	NA
WP_086956705.1|1818270_1819433_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1819525_1820035_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002325884.1|1820373_1821327_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1821279_1821516_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002305709.1|1821935_1823057_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|1823384_1824794_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1824790_1825519_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_146419960.1|1825646_1826558_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	8.3e-60
WP_002289057.1|1826574_1827582_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002305708.1|1827578_1829708_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002296840.1|1830008_1831196_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002349083.1|1831288_1832107_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	81.0	2.0e-118
WP_002298631.1|1832240_1834067_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_010729754.1|1834464_1835373_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002288938.1|1837349_1837739_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002305705.1|1837788_1838685_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1838687_1840535_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1840631_1841132_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002298822.1|1841144_1841366_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002305703.1|1841370_1841508_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|1841504_1842689_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|1842944_1843199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1843223_1844366_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002349191.1|1844425_1845778_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286928.1|1845848_1846193_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286926.1|1846202_1846577_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1846589_1846904_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002305699.1|1847017_1850245_-	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286921.1|1850323_1850986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286913.1|1851358_1851706_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1851841_1852603_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	2088687	2182221	2851579	portal,holin,terminase,plate,tRNA,tail,capsid,transposase	Enterococcus_phage(26.47%)	102	NA	NA
WP_002303350.1|2088687_2089647_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295061.1|2091382_2092486_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_002295059.1|2092707_2093178_-	DUF4809 family protein	NA	NA	NA	NA	NA
WP_000202380.1|2093434_2094754_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002302982.1|2095194_2096835_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002302984.1|2096988_2098311_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002295053.1|2098372_2098804_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302985.1|2098867_2099704_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002295049.1|2099893_2100196_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002290886.1|2100221_2100653_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290885.1|2100649_2100916_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002290883.1|2101169_2101895_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002289867.1|2102447_2103200_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289868.1|2103215_2103695_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296509.1|2103945_2105526_-	ABC transporter	NA	NA	NA	NA	NA
WP_060811100.1|2105518_2106262_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	5.2e-28
WP_060811099.1|2106437_2107214_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287743.1|2107461_2108298_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287744.1|2108308_2109238_-	permease	NA	NA	NA	NA	NA
WP_002287745.1|2109429_2109783_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287746.1|2109856_2110513_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287747.1|2110738_2112673_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002321414.1|2112758_2113982_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002321415.1|2113975_2115874_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002287753.1|2115867_2116986_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002302991.1|2117068_2117902_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287755.1|2117894_2118812_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287756.1|2118834_2119014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287757.1|2119038_2120163_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002296511.1|2120345_2121254_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287759.1|2121394_2123008_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000222572.1|2123658_2124612_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2124645_2125875_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2125876_2126794_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2126797_2127535_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2127625_2128153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2128332_2128926_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2129029_2129515_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2129667_2129865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2129959_2131720_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2131716_2133447_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2133839_2134052_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2134053_2135733_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2135986_2136187_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_010726559.1|2137141_2138152_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_010726558.1|2138148_2138568_-|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	68.7	5.0e-44
WP_002302750.1|2138637_2138778_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.8	1.1e-08
WP_002332774.1|2138770_2139118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|2139131_2139626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|2139625_2140075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2140078_2140696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2140695_2141604_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2141616_2144379_-|tail	phage tail protein	tail	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2144375_2145116_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002305859.1|2145105_2147895_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303297.1|2148136_2148478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|2148477_2149086_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2149086_2149464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2149465_2149861_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2149853_2150225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2150224_2150566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2150577_2150793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2150815_2151706_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002312520.1|2151720_2152344_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2152470_2152788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2152789_2153668_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002343932.1|2153747_2155283_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2155294_2156713_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2156690_2157119_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2157136_2157361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2157911_2158298_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2158310_2158724_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2158800_2159097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2159093_2159297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2159303_2159534_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2159530_2159842_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2159980_2160796_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2160792_2161119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2161115_2161277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2161291_2161651_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2161647_2162499_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2162513_2163314_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2163356_2164247_-	recombinase RecT	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2164248_2165190_-	YqaJ viral recombinase family protein	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2165422_2165758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299325.1|2166024_2166249_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002303270.1|2166245_2166401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299038.1|2166557_2166713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2166784_2167015_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303268.1|2167011_2167170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303266.1|2167182_2167449_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2167648_2168353_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2168439_2169729_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2169794_2171147_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2171041_2171713_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2171767_2172421_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2172410_2173724_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2174033_2176679_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2177071_2177719_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2178291_2179503_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2179518_2180661_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002297218.1|2180925_2182221_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 10
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	2193446	2265935	2851579	tRNA,transposase	Streptococcus_phage(37.5%)	59	NA	NA
WP_086953888.1|2193446_2194608_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002302440.1|2194999_2196301_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287172.1|2202282_2202645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287231.1|2202718_2203099_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002311494.1|2203162_2204356_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287167.1|2204432_2205017_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002297404.1|2205425_2206676_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287165.1|2207000_2207999_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002287163.1|2208110_2208620_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002302440.1|2208798_2210100_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_146419963.1|2210135_2210810_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287159.1|2210811_2211576_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287156.1|2211583_2212261_-	YutD family protein	NA	NA	NA	NA	NA
WP_002287155.1|2212297_2213683_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002287154.1|2213999_2214515_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002305494.1|2214621_2215479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287147.1|2215559_2215895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287145.1|2215961_2217332_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002287143.1|2217409_2217946_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287140.1|2218254_2219736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297185.1|2219900_2221196_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287139.1|2221360_2222068_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002287137.1|2222146_2222485_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287135.1|2222595_2223558_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002287134.1|2223572_2224904_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287133.1|2224911_2225592_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287132.1|2225810_2226290_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287130.1|2226416_2228096_-	ribonuclease J	NA	NA	NA	NA	NA
WP_010729408.1|2228643_2230146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287128.1|2230158_2230821_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_002287127.1|2230921_2231125_-	CsbD family protein	NA	NA	NA	NA	NA
WP_002287126.1|2231235_2232420_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002294022.1|2232576_2234316_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287124.1|2235088_2235703_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294021.1|2236308_2236686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287122.1|2236985_2237867_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002297404.1|2238276_2239527_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287121.1|2239692_2240712_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002287119.1|2241344_2242349_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287118.1|2242361_2243411_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287116.1|2243427_2244249_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002287115.1|2244235_2245015_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287114.1|2245031_2245502_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287112.1|2245513_2245933_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287111.1|2246013_2248791_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002294014.1|2248981_2249206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|2249863_2251183_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002294013.1|2251668_2253384_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.7e-50
WP_002289511.1|2253386_2255150_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-44
WP_002289509.1|2255189_2255726_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002289508.1|2256048_2256471_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002289507.1|2256679_2257789_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.0	1.2e-20
WP_002294011.1|2257912_2258542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294004.1|2258992_2259877_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002305490.1|2259869_2260439_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_002294001.1|2260431_2261208_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002294000.1|2261362_2262685_-	amino acid permease	NA	NA	NA	NA	NA
WP_002293998.1|2262859_2263447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289325.1|2263925_2265935_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
>prophage 11
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	2513613	2592569	2851579	tRNA,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_002297218.1|2513613_2514909_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2515063_2515747_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2515748_2516585_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_010729265.1|2516595_2518350_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	2.4e-39
WP_002285994.1|2518625_2518967_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2519034_2521206_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002348711.1|2521374_2522274_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2522344_2523202_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2523186_2525889_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2525901_2527191_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2527340_2528387_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002302560.1|2528388_2530542_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_002304851.1|2531014_2532466_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2532462_2534187_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002285975.1|2534179_2534794_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2535138_2536596_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2536636_2537557_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2537568_2538516_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2538994_2539714_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285966.1|2539762_2541409_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2541587_2542178_+	YitT family protein	NA	NA	NA	NA	NA
WP_002294486.1|2542269_2543775_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2543858_2545211_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2545210_2545729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2545744_2546071_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2546083_2548063_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2548083_2548398_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2548565_2548859_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2548936_2550049_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2550201_2550426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2550435_2550615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2550808_2550979_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002303189.1|2557547_2558309_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302440.1|2558407_2559709_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002285920.1|2559909_2561631_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_146419965.1|2561645_2563430_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	3.5e-46
WP_002285917.1|2563810_2565364_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2565711_2568126_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2568552_2570571_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2570940_2571597_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2571596_2572553_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2572552_2573119_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002303072.1|2573323_2575093_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.7e-54
WP_002285883.1|2575095_2576808_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002303070.1|2576922_2577591_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002295567.1|2577657_2578446_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2578528_2580001_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2580130_2581324_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2581657_2582953_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297218.1|2591273_2592569_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 12
NZ_CP041261	Enterococcus faecium strain VVEswe-R chromosome, complete genome	2851579	2721058	2737953	2851579		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2721058_2721373_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2721385_2721760_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2721769_2722105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2722187_2723528_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2723605_2724280_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2724272_2724437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2724512_2724947_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2724947_2725655_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2725644_2725935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2726193_2727378_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2727374_2727512_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2728256_2730167_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2730270_2730495_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2730507_2731011_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2731070_2731460_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2731446_2733894_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2733898_2736022_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2736018_2737023_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2737041_2737953_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	195404	25323	59460	195404	holin,transposase	Streptococcus_phage(20.0%)	36	NA	NA
WP_060811263.1|25323_26283_+|transposase	IS30-like element IS6770 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.0e-36
WP_002311552.1|27081_27504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033583488.1|27523_29116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002316755.1|29371_29566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|29701_30952_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002311557.1|31361_33734_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	28.9	1.1e-10
WP_146419978.1|33794_35255_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_146419980.1|35265_37470_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	51.3	1.6e-117
WP_002295632.1|37485_37635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295629.1|37715_38312_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002340481.1|38324_39224_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002295625.1|39732_39990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311565.1|40148_40283_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|40425_40686_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002295619.1|41134_41341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293542.1|41340_41592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311567.1|41607_42045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060804903.1|42480_42669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002314432.1|42726_42993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340480.1|43002_43236_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_002335346.1|43578_43761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340479.1|43750_43972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086953888.1|44012_45174_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002290556.1|45965_46733_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|47220_47646_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|47662_48178_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002340477.1|48188_49121_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290551.1|49123_50104_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290550.1|50131_50449_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002340476.1|50448_52155_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290548.1|52296_53703_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|53725_53998_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|54018_54918_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_086956687.1|55389_56552_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_000997695.1|57248_58427_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002295743.1|58551_59460_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	195404	65887	127288	195404	integrase,transposase	Bacillus_phage(22.73%)	49	64821:64837	119785:119801
64821:64837	attL	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_002300843.1|65887_67408_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|67650_67836_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|67819_68002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|68955_69555_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|69618_70218_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002292418.1|71233_72106_-	ROK family protein	NA	NA	NA	NA	NA
WP_002293868.1|72369_74316_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|74500_75940_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|75941_76904_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|77073_78500_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|78742_79198_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|79783_80014_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|80243_81062_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|81222_81912_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|81925_83428_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|83440_83917_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|84414_85577_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|86694_87213_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|89288_90374_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|90481_91435_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|91565_92816_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|92834_93761_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|93839_94835_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|94850_96020_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|96035_96770_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086953888.1|97540_98703_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002301811.1|99271_100564_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|100837_101098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|101348_102527_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_065305666.1|102878_103088_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	61.7	5.9e-14
WP_001015311.1|103564_104245_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_025189010.1|107522_107915_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_002303110.1|111206_112244_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002387940.1|112240_112753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002319817.1|113420_114101_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002303113.1|114645_115197_+	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|115664_116345_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|116604_117210_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|117254_117422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|117455_117755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|117795_118413_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|118737_119133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|119212_121564_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
119785:119801	attR	TTATTGAACCAGTATTA	NA	NA	NA	NA
WP_000718009.1|121688_122378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|122391_122844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|122974_123655_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|123756_125076_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|125072_125726_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729371.1|126013_127288_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
>prophage 1
NZ_CP041263	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2	89846	27508	78034	89846	protease,transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_016922336.1|27508_28108_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002320853.1|29164_29794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320854.1|29790_31167_-	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	42.2	3.8e-48
WP_002320855.1|31246_32509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320856.1|32521_32869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729859.1|32888_33758_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002320858.1|33989_34796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730977.1|34883_35684_-	hypothetical protein	NA	U5PTP5	Bacillus_phage	36.3	9.3e-07
WP_002350582.1|36022_37132_-	class C sortase	NA	NA	NA	NA	NA
WP_002350583.1|37121_37985_-	class C sortase	NA	NA	NA	NA	NA
WP_002350584.1|38053_39889_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002347449.1|39937_42328_-	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_025478707.1|42595_43843_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_002347447.1|44235_44652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347446.1|44668_45406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347445.1|45827_46391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321012.1|46377_46905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002352866.1|46927_48265_-	CHAP domain-containing protein	NA	Q859L3	Staphylococcus_phage	54.0	6.5e-37
WP_002347443.1|48384_48864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347440.1|49213_49531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347439.1|49641_49824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730980.1|49860_50661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060804948.1|51212_51521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347720.1|51682_52213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347509.1|52228_52594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347508.1|52599_53343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347507.1|53473_54196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347506.1|54201_54447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347505.1|54457_55042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|55385_56558_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_080441776.1|56747_58079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729677.1|58335_58671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|58877_60026_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|60042_60447_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002320766.1|60956_62927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320767.1|62941_63808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|63797_64031_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002347429.1|64042_66199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|66549_66888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729680.1|67287_70929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729681.1|70931_72881_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.3e-30
WP_010729682.1|72922_73981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320776.1|74099_74555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729683.1|75139_75943_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000997695.1|76855_78034_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
>prophage 1
NZ_CP041264	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence	65253	32548	63474	65253	transposase,holin	Streptococcus_phage(53.85%)	38	NA	NA
WP_002297404.1|32548_33799_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_060797393.1|34208_36581_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.2	2.9e-11
WP_060809967.1|36641_38102_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305772.1|38112_40317_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303309.1|40332_40482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303311.1|40557_41151_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303312.1|41163_42063_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|42065_42551_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|42691_42895_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|42969_43230_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002347218.1|43666_43873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|43872_44124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|44138_44576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|44568_45276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|45656_45836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388479.1|45966_46236_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|46228_46486_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002347142.1|46944_47100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809248.1|47123_47948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|48112_48727_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002303116.1|48964_49387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|49396_49600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|49811_50396_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_060811353.1|51539_53402_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.6	5.3e-37
WP_060811354.1|53483_54779_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	42.4	5.8e-91
WP_002303114.1|54771_55122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|55385_56681_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_060475447.1|56706_57381_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.0	1.6e-116
WP_002347151.1|57434_57653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303415.1|57700_57973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303414.1|57962_58172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349053.1|58302_58623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303412.1|58885_59194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347150.1|59367_59736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347149.1|59849_60665_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001015311.1|60748_61429_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000026576.1|61800_62091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|62295_63474_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
>prophage 1
NZ_CP041269	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R4, complete sequence	35172	8648	34562	35172	transposase	Streptococcus_phage(61.9%)	31	NA	NA
WP_146419990.1|8648_9302_-	VanR-ABDEGLN family response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	7.5e-31
WP_001015311.1|9343_10024_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_106913803.1|11070_11166_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002311817.1|11468_11714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002328852.1|12200_12881_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.6e-127
WP_000527318.1|13175_13385_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_000301765.1|13401_13674_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|13675_14539_+	toxin zeta	NA	NA	NA	NA	NA
WP_001038796.1|14801_15539_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|15663_15747_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|16288_17083_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002297218.1|17671_18967_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002324522.1|19067_19976_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002347175.1|19978_20227_-	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_060810973.1|20223_21132_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	99.7	1.1e-176
WP_060810974.1|21164_21902_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	99.6	3.8e-140
WP_002303392.1|21882_22752_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.3	5.7e-151
WP_002303393.1|22766_22991_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001015311.1|25185_25866_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000357244.1|26114_26633_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|26639_27152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|27422_28046_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_001015311.1|28141_28822_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000599739.1|29007_29613_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|29628_30201_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|30673_31246_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|31346_32509_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322130.1|32549_32804_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|32914_33169_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|33361_33637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|33608_34562_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
