The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	344633	353804	4704113	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|344633_345581_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|345564_346296_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|346276_346384_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|346443_347175_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023236969.1|347397_349083_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598637.1|349079_349799_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|349845_350313_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001197951.1|350369_350900_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|351071_351530_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023236968.1|351770_353804_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	1.4e-54
>prophage 2
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	509837	520440	4704113		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|509837_510311_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|510958_511249_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|511620_512418_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|512898_513060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|513186_513606_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457665.1|513608_514877_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|515331_515544_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|515554_515743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023237033.1|516003_517200_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
WP_000107435.1|517849_518161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377053.1|518240_518936_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	9.5e-08
WP_001157317.1|519009_520440_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 3
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	2892500	2937433	4704113	plate,tail,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182233.1|2892500_2893499_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|2893586_2894897_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|2895143_2895659_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|2895758_2895968_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|2895989_2896103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|2896099_2897425_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|2897603_2898212_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|2898320_2898689_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|2898859_2901280_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|2901378_2902251_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|2902264_2902762_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|2902942_2903860_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973644.1|2904023_2905382_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|2905470_2906580_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|2906941_2908132_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|2908263_2909808_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|2909822_2910713_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|2910878_2911289_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023236909.1|2911431_2913528_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023236910.1|2913527_2914265_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000824803.1|2914261_2914900_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|2914963_2915206_-	outer membrane protein	NA	NA	NA	NA	NA
WP_023236911.1|2915649_2917299_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_023236912.1|2917643_2918993_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|2919123_2919471_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|2920045_2920333_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_020437576.1|2920335_2920941_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_000777268.1|2920953_2921268_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_023236914.1|2921878_2922076_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.7	4.6e-08
WP_023236915.1|2922065_2923493_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.5	3.4e-193
WP_000907495.1|2923492_2924017_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|2924068_2924386_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185655.1|2924345_2924474_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023236916.1|2924570_2926925_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.1	6.4e-64
WP_023236917.1|2926924_2927878_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269717.1|2927877_2928087_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023236918.1|2928074_2929118_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.3	1.5e-76
WP_023236919.1|2929127_2929850_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
WP_071786937.1|2929858_2930101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|2930176_2930539_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|2930535_2931465_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_023236920.1|2931464_2933012_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	8.5e-49
WP_001093501.1|2933175_2933535_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951725.1|2933525_2934641_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	6.9e-101
WP_000359503.1|2934633_2935266_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023236921.1|2935268_2936729_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	38.8	2.0e-76
WP_000493812.1|2936731_2937433_+	DUF4376 domain-containing protein	NA	X2KPE1	Enterobacteria_phage	38.6	2.1e-23
>prophage 4
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	3055163	3120247	4704113	portal,protease,holin,tail,capsid,lysis,head,plate,integrase,terminase	Salmonella_phage(76.74%)	78	3085027:3085073	3115622:3115668
WP_000208240.1|3055163_3055694_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|3055703_3057035_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|3057101_3058031_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|3058123_3058609_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|3058830_3059070_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|3059468_3060314_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|3060334_3061843_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|3061954_3062965_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|3063061_3063808_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155239.1|3063914_3064343_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|3064443_3065040_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|3065152_3065920_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088049.1|3066011_3066776_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|3066785_3067076_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774147.1|3067158_3068034_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|3068062_3069085_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|3069113_3070115_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|3070111_3071155_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|3071148_3072684_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|3072939_3073899_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|3073985_3075578_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|3075591_3075942_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621105.1|3076031_3076163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060995.1|3076178_3076349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023193107.1|3076446_3077169_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023237255.1|3077231_3078272_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_023237254.1|3078281_3079241_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777314.1|3079251_3080586_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750755.1|3080849_3081605_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|3081705_3082695_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|3082898_3083861_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|3084045_3084948_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3085027:3085073	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468356.1|3085234_3085642_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_000468311.1|3085692_3085911_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_023237579.1|3085982_3087158_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	100.0	2.7e-212
WP_001605882.1|3087154_3087640_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	100.0	7.9e-86
WP_001605885.1|3087652_3090094_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	100.0	0.0e+00
WP_085984508.1|3090086_3090242_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029726.1|3090238_3090574_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_001207675.1|3090636_3091155_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001605888.1|3091170_3092349_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	100.0	9.9e-223
WP_000122996.1|3092483_3093032_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
WP_001605891.1|3093044_3095021_-|tail	phage tail fiber protein	tail	S4TP62	Salmonella_phage	100.0	0.0e+00
WP_001000068.1|3095031_3095562_-|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_000246677.1|3095554_3096463_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_000127148.1|3096469_3096817_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_023237572.1|3096813_3097455_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	100.0	2.2e-115
WP_001293096.1|3097523_3097973_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|3097965_3098433_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001394645.1|3098395_3098569_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_000866102.1|3098540_3098954_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001818462.1|3098950_3099448_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	100.0	1.4e-93
WP_000134659.1|3099434_3099731_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_010835754.1|3099734_3099938_-	phage Tail protein X	NA	S4TTA0	Salmonella_phage	100.0	6.1e-32
WP_000214255.1|3099937_3100444_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_023237571.1|3100537_3101287_-|terminase	terminase endonuclease subunit	terminase	S4TRV8	Salmonella_phage	100.0	3.8e-127
WP_023237570.1|3101290_3102358_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	100.0	1.8e-199
WP_023237569.1|3102434_3103289_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	100.0	4.3e-159
WP_000156056.1|3103454_3105224_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	100.0	0.0e+00
WP_023237568.1|3105223_3106270_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	100.0	3.0e-191
WP_024160514.1|3106705_3107770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398851.1|3107766_3108879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023236927.1|3108890_3109562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023262366.1|3109727_3112007_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.8	0.0e+00
WP_001609311.1|3111996_3112272_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	100.0	3.8e-45
WP_001113264.1|3112268_3112493_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277891.1|3112495_3112795_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_000557703.1|3112794_3113019_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|3113082_3113583_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001308179.1|3113752_3114025_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|3114161_3114455_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|3114524_3115505_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|3115690_3116191_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3115622:3115668	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|3116341_3117040_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|3117036_3118410_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|3118460_3118856_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077910795.1|3118867_3119620_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_023237330.1|3119626_3120247_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
>prophage 5
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	3423929	3439259	4704113	integrase	Enterobacteria_phage(75.0%)	14	3429111:3429131	3439421:3439441
WP_023262402.1|3423929_3426797_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	1.5e-94
WP_000984806.1|3426871_3427489_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3429111:3429131	attL	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_023237520.1|3429427_3431761_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.6	0.0e+00
WP_000743150.1|3431775_3432096_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|3432092_3432320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237521.1|3432316_3432868_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	1.0e-33
WP_014344397.1|3433469_3433745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000149860.1|3433670_3434408_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000984209.1|3434404_3434647_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_023237522.1|3434663_3435230_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.1e-57
WP_071737793.1|3435193_3435379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023262400.1|3435444_3436542_-	protein kinase	NA	A0A2I2L4W4	Orpheovirus	29.0	9.4e-10
WP_023237524.1|3436596_3438084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237525.1|3438080_3439259_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	94.1	1.6e-212
3439421:3439441	attR	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
>prophage 6
NZ_CP032304	Salmonella enterica subsp. enterica serovar Braenderup strain FORC93 chromosome, complete genome	4704113	4482895	4547884	4704113	tRNA,plate,portal,tail,holin,capsid,lysis,head,integrase,terminase	Salmonella_phage(90.7%)	62	4482733:4482779	4518836:4518882
4482733:4482779	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237380.1|4482895_4484086_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	48.6	6.7e-102
WP_023237379.1|4484109_4485123_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.4	4.4e-187
WP_023237378.1|4485125_4485758_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|4485879_4486122_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_023237377.1|4486154_4486664_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_023237376.1|4486671_4486872_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.2e-32
WP_000963473.1|4486835_4487177_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_023237375.1|4487244_4487478_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_023232905.1|4487477_4487705_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	6.0e-36
WP_023237374.1|4487701_4488559_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	8.6e-160
WP_023232907.1|4488555_4490955_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.2	0.0e+00
WP_023232908.1|4491123_4491312_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_023232911.1|4491669_4492089_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023232912.1|4492358_4492742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023232913.1|4492943_4493279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237373.1|4494389_4495430_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.6	2.1e-192
WP_023138927.1|4498184_4499249_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	2.7e-195
WP_000059172.1|4499252_4499903_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_000673535.1|4499996_4500461_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_023138925.1|4500460_4500664_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_023138924.1|4500667_4500883_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	98.6	1.3e-32
WP_000731036.1|4501376_4501754_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001201940.1|4501753_4502179_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
WP_086007072.1|4502108_4502312_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	95.5	2.2e-29
WP_001039961.1|4502274_4502706_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_023138923.1|4502698_4503145_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.4	1.5e-59
WP_023138922.1|4503163_4504255_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.2	1.4e-18
WP_024148874.1|4504256_4504901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001672413.1|4504974_4505553_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000177408.1|4505549_4505909_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_023138920.1|4505895_4506804_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.3	2.2e-158
WP_023237372.1|4506796_4507402_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	7.5e-118
WP_023262363.1|4507398_4509054_+|tail	phage tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	98.9	0.0e+00
WP_023138916.1|4509056_4509596_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.2	6.1e-95
WP_077908642.1|4509599_4510217_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	98.5	1.4e-111
WP_023262362.1|4510186_4511176_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.7	4.3e-187
WP_001165558.1|4511205_4511763_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_000046109.1|4511865_4513038_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207653.1|4513047_4513563_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280967.1|4513617_4513920_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763316.1|4513934_4514054_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_023237099.1|4514046_4516854_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_023237098.1|4516850_4517336_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.9e-71
WP_023225979.1|4517332_4518433_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.9	1.1e-194
WP_000980499.1|4518501_4518720_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
WP_072095627.1|4519271_4520435_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
4518836:4518882	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237097.1|4520442_4522623_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533846.1|4522619_4524029_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001518569.1|4536178_4536661_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|4536810_4537287_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|4537276_4537567_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|4537732_4538071_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|4538219_4539881_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|4539966_4540845_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|4540967_4541558_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|4541592_4542198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|4542318_4543605_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|4543624_4544416_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_023237095.1|4544581_4545943_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|4546256_4546505_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|4546523_4547072_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|4547116_4547884_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
