The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	548505	556285	6368486		Planktothrix_phage(16.67%)	10	NA	NA
WP_016485043.1|548505_549315_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-25
WP_016485042.1|549563_550538_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.3e-34
WP_023046949.1|550549_551074_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	48.1	9.0e-27
WP_016485040.1|551082_551655_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016485039.1|551641_552166_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003255132.1|552166_552892_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.4e-23
WP_024717623.1|553069_554563_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016485037.1|554642_554951_+	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QH33	Escherichia_phage	34.1	4.4e-05
WP_016485036.1|554963_555428_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_145913318.1|555430_556285_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.0	1.2e-07
>prophage 2
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	1237894	1283742	6368486	protease,holin,transposase	Tupanvirus(25.0%)	39	NA	NA
WP_016484545.1|1237894_1238395_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_016484544.1|1238577_1239465_+	acyltransferase	NA	NA	NA	NA	NA
WP_060518018.1|1239707_1241057_+	amino acid permease	NA	NA	NA	NA	NA
WP_016484542.1|1241172_1241748_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_145913453.1|1241941_1242703_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_016484541.1|1242893_1244093_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.7	2.6e-13
WP_016484540.1|1244364_1245222_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016484539.1|1245234_1245867_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_016484538.1|1246048_1249063_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_016484537.1|1249059_1249395_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_016484536.1|1249409_1250660_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_016484535.1|1250675_1251929_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	8.6e-100
WP_016484534.1|1252248_1253289_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_016484533.1|1253394_1255332_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016484532.1|1255452_1255755_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_016484531.1|1255751_1255982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060518026.1|1256258_1257884_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.7	4.9e-71
WP_016484529.1|1258492_1258948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016484528.1|1259069_1260170_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_016484527.1|1260478_1261771_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_145913454.1|1261849_1262671_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_016484524.1|1263423_1264194_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_016484523.1|1264204_1265437_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_145913455.1|1265436_1267389_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_016484521.1|1267553_1269614_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_012316656.1|1269629_1270160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003255700.1|1270236_1271214_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_060518030.1|1271497_1271899_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_060518032.1|1272060_1273005_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_145913456.1|1273151_1274096_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_016484517.1|1274219_1275104_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_016484516.1|1275122_1276088_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_016484515.1|1276098_1276569_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016484514.1|1276839_1277097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016484513.1|1277259_1278366_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016484512.1|1278859_1280236_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016484511.1|1280689_1281637_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_016484510.1|1281721_1282567_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_016484509.1|1282563_1283742_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.7	1.1e-24
>prophage 3
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	1699654	1707572	6368486		uncultured_Caudovirales_phage(85.71%)	9	NA	NA
WP_060519748.1|1699654_1700011_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	68.4	1.1e-39
WP_060519746.1|1700038_1701322_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	85.5	3.0e-201
WP_031314387.1|1701336_1701807_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	82.1	2.7e-67
WP_060519744.1|1701830_1702544_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	88.6	6.8e-118
WP_082422063.1|1702548_1703052_+	protein phosphatase	NA	NA	NA	NA	NA
WP_101195987.1|1703077_1704160_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	66.4	8.2e-107
WP_060519738.1|1704152_1704713_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	69.6	2.1e-58
WP_060519736.1|1704877_1705876_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_016489887.1|1706171_1707572_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	3.2e-47
>prophage 4
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	2253802	2263877	6368486		Escherichia_phage(16.67%)	7	NA	NA
WP_023046912.1|2253802_2255200_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	57.3	2.9e-141
WP_145913615.1|2255371_2256976_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.7	3.0e-12
WP_031311556.1|2257910_2260211_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	94.6	7.5e-134
WP_016489428.1|2260339_2260927_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	24.4	3.1e-07
WP_024717363.1|2261276_2261726_+	azurin	NA	NA	NA	NA	NA
WP_016489425.1|2261840_2262668_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	47.0	7.8e-49
WP_016489424.1|2262671_2263877_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	35.6	3.0e-49
>prophage 5
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	2448940	2464819	6368486	integrase	Pseudomonas_phage(56.25%)	30	2444823:2444836	2451938:2451951
2444823:2444836	attL	TTGGCTTTCGCAAA	NA	NA	NA	NA
WP_070086675.1|2448940_2450119_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	79.5	3.7e-177
WP_139138796.1|2449998_2450274_-	excisionase	NA	NA	NA	NA	NA
WP_070086676.1|2450327_2450570_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	47.3	2.6e-05
WP_070086677.1|2450559_2451117_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_145913658.1|2451253_2451589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070086679.1|2451575_2451893_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	57.9	1.5e-08
WP_070086680.1|2451983_2452379_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	61.7	7.3e-29
2451938:2451951	attR	TTGGCTTTCGCAAA	NA	NA	NA	NA
WP_070086681.1|2452505_2453288_-	LexA family transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	35.4	1.8e-34
WP_083283722.1|2453393_2453717_+	Cro/Cl family transcriptional regulator	NA	A0A0U1UNM4	Pseudomonas_phage	58.7	7.8e-13
WP_070086682.1|2453972_2454308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070086683.1|2454825_2455134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070086684.1|2455130_2455910_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	45.5	6.2e-32
WP_070086685.1|2455906_2456512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070086686.1|2456508_2456739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070086687.1|2456735_2457530_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	54.1	1.7e-29
WP_070086688.1|2457526_2458309_+	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	62.9	2.3e-90
WP_070086689.1|2458305_2459688_+	AAA family ATPase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	57.5	1.2e-139
WP_070086690.1|2459674_2460175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070086691.1|2460171_2460459_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	42.5	3.8e-11
WP_019438286.1|2460455_2460845_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	58.6	2.7e-36
WP_016489223.1|2461070_2461580_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	95.9	7.5e-87
WP_009685283.1|2461896_2462085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081264834.1|2462277_2462505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009685285.1|2462501_2462735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009685286.1|2462856_2463228_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	71.3	1.5e-39
WP_012313242.1|2463227_2463545_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	56.2	2.1e-15
WP_070086692.1|2463610_2463841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083283723.1|2464171_2464375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083283724.1|2464301_2464481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009685291.1|2464480_2464819_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.9	2.9e-26
>prophage 6
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	3163205	3194244	6368486	integrase,transposase	Salmonella_phage(25.0%)	30	3174729:3174763	3188547:3188581
WP_081011204.1|3163205_3163859_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L1B6	Ralstonia_phage	34.4	1.1e-21
WP_010794530.1|3163831_3164794_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_003090764.1|3164839_3165199_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090760.1|3165198_3166050_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090759.1|3166064_3167552_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_003124096.1|3168017_3168578_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|3168580_3171547_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000654684.1|3173316_3173562_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|3173564_3173840_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|3173855_3174206_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|3174277_3174712_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
3174729:3174763	attL	CTTAGCGTGCTTTATTTTCCGTTTTCTGAGGCGAC	NA	NA	NA	NA
WP_012196454.1|3174769_3175426_-	recombinase family protein	NA	A0A2H4UVX9	Bodo_saltans_virus	28.1	1.8e-08
WP_012196455.1|3175577_3175808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480959.1|3175971_3176808_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_025464697.1|3176807_3177611_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.6	2.2e-24
WP_099593669.1|3177676_3178291_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.2	3.5e-38
WP_033990018.1|3178416_3181302_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.6	2.4e-190
WP_000845048.1|3181489_3182503_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000946487.1|3182604_3183456_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001993321.1|3183385_3183565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3183583_3184084_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010454871.1|3184543_3185347_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_024012635.1|3185339_3186839_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003464995.1|3186995_3187841_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|3187870_3188389_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_003089120.1|3189906_3190305_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
3188547:3188581	attR	GTCGCCTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_003089115.1|3190379_3190730_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|3190742_3191018_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|3191025_3191238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089110.1|3191250_3194244_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	7.5e-259
>prophage 7
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	3275462	3307819	6368486	integrase,portal,tail,holin,terminase,head,capsid	uncultured_Caudovirales_phage(25.93%)	39	3277118:3277146	3314634:3314662
WP_016488635.1|3275462_3276221_+	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	29.5	5.9e-19
WP_011535129.1|3276251_3276962_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	37.9	8.7e-41
3277118:3277146	attL	GGGTTCAAATCCCTATCTCTCCGCCATAC	NA	NA	NA	NA
WP_145913778.1|3277264_3278503_-|integrase	tyrosine-type recombinase/integrase	integrase	Q76UT6	Pseudomonas_virus	40.1	1.8e-41
WP_132476057.1|3278499_3278751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913779.1|3278767_3278983_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	64.6	8.5e-16
WP_145913780.1|3278975_3279416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913781.1|3280042_3280543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913782.1|3280619_3281438_-	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	37.1	1.8e-37
WP_024717539.1|3281485_3281830_-	hypothetical protein	NA	A0A2D1GMS3	Marinobacter_phage	39.3	1.7e-10
WP_024717538.1|3281866_3282103_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_145913783.1|3282099_3282375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913784.1|3282371_3282656_-	hypothetical protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	41.5	1.9e-10
WP_145913785.1|3282720_3282960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913786.1|3283925_3284168_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145913787.1|3284585_3285074_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	54.0	8.7e-32
WP_145913788.1|3285066_3285270_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	47.8	8.0e-08
WP_145913789.1|3285266_3287987_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	62.5	0.0e+00
WP_145913790.1|3288121_3288334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145913791.1|3288326_3288926_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	47.4	1.4e-18
WP_145913792.1|3289109_3289454_+|holin	holin	holin	B5TK61	Pseudomonas_phage	73.4	4.7e-40
WP_145913793.1|3289682_3289967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145913794.1|3290097_3290457_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	57.0	2.0e-30
WP_145913795.1|3290456_3290636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145913796.1|3290734_3291268_+|terminase	phage terminase small subunit P27 family	terminase	H0USW2	Bacillus_phage	29.3	2.5e-08
WP_145913797.1|3291230_3293057_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	38.1	2.3e-109
WP_145913798.1|3293053_3293239_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	59.3	1.5e-08
WP_145913799.1|3293238_3294513_+|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	61.4	6.8e-145
WP_145913800.1|3294509_3295460_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	53.8	1.8e-89
WP_145913801.1|3295522_3296836_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	54.5	4.0e-124
WP_145913802.1|3296896_3297319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145913803.1|3297321_3297873_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_145913804.1|3297874_3298195_+|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	63.6	7.0e-22
WP_145913805.1|3298378_3298942_+	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	59.9	5.8e-56
WP_145913806.1|3298945_3299329_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	61.7	3.4e-39
WP_086975610.1|3299380_3299851_+	hypothetical protein	NA	A0A2H4JDL7	uncultured_Caudovirales_phage	60.8	9.2e-47
WP_145913807.1|3299937_3300282_+	hypothetical protein	NA	A0A2H4JFP4	uncultured_Caudovirales_phage	60.5	4.7e-32
WP_145913808.1|3300585_3306123_+	hypothetical protein	NA	A0A2H4JC10	uncultured_Caudovirales_phage	46.3	6.9e-141
WP_145913809.1|3306119_3307091_+	hypothetical protein	NA	R9TJ58	Synechococcus_phage	39.2	9.1e-57
WP_145913810.1|3307090_3307819_+	hypothetical protein	NA	A0A0N7CEF8	Salmonella_phage	38.7	1.3e-10
3314634:3314662	attR	GGGTTCAAATCCCTATCTCTCCGCCATAC	NA	NA	NA	NA
>prophage 8
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	4004331	4013131	6368486	tRNA	uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_016488116.1|4004331_4005612_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.1	5.9e-96
WP_016488115.1|4005612_4007004_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_095115612.1|4007134_4008094_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_145914652.1|4008188_4009190_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	80.8	1.6e-157
WP_016488112.1|4009201_4009537_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	1.3e-42
WP_016488111.1|4009533_4009830_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	61.6	2.8e-25
WP_060517055.1|4009829_4010189_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	2.1e-35
WP_016488109.1|4010190_4010583_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.1	2.5e-53
WP_016498869.1|4010758_4012138_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.6e-27
WP_003251184.1|4012459_4013131_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.1e-105
>prophage 9
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	5860344	5922141	6368486	protease,coat	Feldmannia_species_virus(10.0%)	56	NA	NA
WP_016485934.1|5860344_5860848_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016485933.1|5860851_5861385_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016485932.1|5861403_5861940_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016485931.1|5861970_5862498_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_145914452.1|5862767_5865014_+	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	22.8	2.1e-24
WP_016485929.1|5865029_5865491_+	response regulator	NA	NA	NA	NA	NA
WP_095114809.1|5865504_5867892_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.4	3.9e-08
WP_016485928.1|5868443_5868686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914453.1|5868813_5869884_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_145914454.1|5870009_5871899_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.3	6.3e-54
WP_145914455.1|5872077_5872944_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095114807.1|5872917_5874072_-	HPP family protein	NA	NA	NA	NA	NA
WP_016485923.1|5874342_5875662_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016485922.1|5875658_5876327_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016485921.1|5876327_5876642_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_060518834.1|5876641_5876950_-	peptidase	NA	NA	NA	NA	NA
WP_016485919.1|5877143_5878223_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_145914456.1|5878276_5878633_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_016485918.1|5878643_5879162_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_145914671.1|5879532_5882142_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_145914457.1|5882216_5883701_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_070086792.1|5883773_5884964_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_016485914.1|5885114_5887703_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_016485913.1|5887896_5889024_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_016485912.1|5889082_5889973_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_016485911.1|5889969_5890686_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016485910.1|5890992_5891529_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_016485909.1|5891534_5893070_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_060518838.1|5893069_5894050_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_145914458.1|5894258_5895602_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	32.5	2.2e-45
WP_016500538.1|5895681_5896416_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_016485905.1|5896455_5897430_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_016485904.1|5897558_5898056_-	universal stress protein	NA	NA	NA	NA	NA
WP_145914459.1|5898191_5899139_-	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_016485902.1|5899372_5900449_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.5	6.3e-83
WP_003250290.1|5900584_5900866_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003259780.1|5901374_5901626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016485901.1|5901758_5902736_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016485900.1|5902849_5903140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016485899.1|5903198_5903804_-	arylesterase	NA	NA	NA	NA	NA
WP_016485898.1|5903814_5904498_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.0e-06
WP_145914460.1|5904497_5907005_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016485896.1|5907014_5907488_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_016485895.1|5907499_5907808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016485894.1|5908019_5909426_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016485893.1|5909583_5910381_+	preprotein translocase subunit TatD	NA	NA	NA	NA	NA
WP_145914461.1|5910490_5911969_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	7.2e-37
WP_016485891.1|5912044_5912413_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_016485890.1|5912549_5913347_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_145914462.1|5913435_5914203_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_003250254.1|5914217_5914496_-	lipoprotein	NA	NA	NA	NA	NA
WP_016485889.1|5914674_5915715_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016485888.1|5915819_5917691_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016485887.1|5917872_5918145_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	64.0	7.7e-22
WP_145914463.1|5918297_5920694_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	7.4e-217
WP_016485885.1|5920857_5922141_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	8.1e-138
>prophage 10
NZ_CP022560	Pseudomonas putida strain B1 chromosome, complete genome	6368486	6101954	6173625	6368486	integrase,portal,tRNA,tail,head,protease,capsid	Pseudomonas_phage(40.68%)	90	6097603:6097617	6174645:6174659
6097603:6097617	attL	CGACCAGCGCCAGGC	NA	NA	NA	NA
WP_145914509.1|6101954_6102911_+	hypothetical protein	NA	A0A068CDF3	Rhizobium_phage	37.8	5.6e-51
WP_145914510.1|6102937_6103213_+	hypothetical protein	NA	A0A2H4J6R2	uncultured_Caudovirales_phage	50.0	2.3e-13
WP_145914511.1|6103177_6103414_-	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	46.3	6.1e-07
WP_145914512.1|6103403_6103712_-	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	70.5	9.0e-35
WP_145914513.1|6103711_6104068_-	S24 family peptidase	NA	A0A1L5C2A3	Pseudoalteromonas_phage	42.2	2.3e-13
WP_145914514.1|6104143_6104368_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	81.1	1.0e-27
WP_145914515.1|6104381_6104891_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_145914516.1|6104887_6105334_-	structural protein P5	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	55.4	1.6e-37
WP_145914517.1|6105394_6105616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914518.1|6105829_6106210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914519.1|6106206_6116013_-	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	59.4	0.0e+00
WP_145914520.1|6116069_6116648_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	63.6	4.4e-59
WP_145914521.1|6116705_6117053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914522.1|6117181_6117844_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_145914523.1|6118120_6118876_-|tail	phage tail protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	76.1	4.1e-121
WP_145914524.1|6118878_6119628_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.9	4.8e-122
WP_145914525.1|6119624_6119963_-|tail	phage tail protein	tail	A0A1S5R1J0	Pseudomonas_phage	37.5	1.5e-14
WP_145914526.1|6119962_6123253_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	33.8	3.1e-72
WP_145914527.1|6123298_6123535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020190152.1|6123531_6123876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014756120.1|6123916_6124417_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	75.8	2.0e-68
WP_016485711.1|6124473_6124860_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	83.6	2.6e-55
WP_145914528.1|6124852_6125428_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	56.3	6.2e-53
WP_145914529.1|6125610_6125937_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JC00	uncultured_Caudovirales_phage	49.1	8.7e-20
WP_135198716.1|6125933_6126275_-|head,tail	phage gp6-like head-tail connector protein	head,tail	C4ML08	Xanthomonas_virus	38.3	1.7e-13
WP_145914530.1|6126278_6126809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914531.1|6126852_6128040_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	70.1	5.0e-150
WP_145914532.1|6128042_6128900_-|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	63.9	1.4e-96
WP_145914533.1|6128916_6130215_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	72.2	7.4e-187
WP_145914534.1|6131961_6133722_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145914535.1|6133773_6134427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914536.1|6135021_6136605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135198708.1|6136697_6137297_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	57.9	3.5e-51
WP_145914537.1|6137296_6137656_-	hypothetical protein	NA	A0A1B0VML3	Pseudomonas_phage	52.3	3.5e-22
WP_145913855.1|6137913_6138111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914644.1|6138240_6139374_-|capsid	phage major capsid protein	capsid	A0A0R6PIV7	Moraxella_phage	33.5	3.0e-35
WP_145913856.1|6139479_6139713_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_145914538.1|6139713_6141003_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	51.0	2.8e-114
WP_145914539.1|6141253_6141547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135198480.1|6141546_6142821_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_135198479.1|6142817_6143225_-	virulence-associated protein E	NA	NA	NA	NA	NA
WP_135198478.1|6143227_6143524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135193013.1|6143520_6143790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135198477.1|6144319_6144508_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	54.5	6.7e-09
WP_145914540.1|6144564_6145752_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	44.7	7.2e-80
WP_145914541.1|6146261_6146762_-	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	38.5	6.0e-12
WP_086975815.1|6146919_6147258_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.3	4.0e-28
WP_086975814.1|6147257_6147575_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	63.6	3.5e-10
WP_086975812.1|6147574_6147946_-	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	70.7	5.0e-40
WP_086975810.1|6148347_6148548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086975809.1|6148711_6149398_-	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	63.2	3.9e-78
WP_086975807.1|6149409_6149727_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	61.0	1.4e-30
WP_086975886.1|6149723_6149975_-	hypothetical protein	NA	A0A2H4J105	uncultured_Caudovirales_phage	68.4	6.6e-28
WP_145914542.1|6149998_6151297_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	56.3	3.1e-129
WP_145914543.1|6151293_6151722_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	78.7	3.0e-52
WP_145914544.1|6151718_6152015_-	DUF1364 family protein	NA	A5VW86	Enterobacteria_phage	71.9	2.0e-31
WP_145914545.1|6152017_6152830_-	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	67.2	6.8e-98
WP_145914546.1|6152819_6153677_-	replication protein	NA	W6MYB0	Pseudomonas_phage	36.5	1.6e-36
WP_042914514.1|6153833_6154028_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_145914547.1|6154134_6155016_+	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	39.1	9.5e-45
WP_016485689.1|6155046_6155364_-	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	57.1	2.9e-20
WP_145914548.1|6155801_6156107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914549.1|6156492_6156876_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	60.8	2.5e-26
WP_145914550.1|6156895_6157165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914551.1|6157161_6157704_+	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	33.5	6.7e-17
WP_145914552.1|6157792_6158140_+	hypothetical protein	NA	I3PUY8	Vibrio_phage	50.0	4.7e-24
WP_145914553.1|6158166_6158982_+	DUF2303 family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	42.6	1.7e-48
WP_145914554.1|6159089_6159632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914555.1|6159734_6160298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914556.1|6160310_6160508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914557.1|6160585_6160807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914558.1|6160913_6161297_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	46.5	7.3e-26
WP_145914559.1|6161322_6161814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914560.1|6161960_6162725_+	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	51.8	1.2e-51
WP_145914561.1|6162736_6164482_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	41.3	1.4e-95
WP_145914562.1|6164492_6165245_+	hypothetical protein	NA	A0A1Y0SX42	Pseudomonas_phage	66.7	1.9e-17
WP_145914563.1|6165241_6165967_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	48.1	3.5e-53
WP_145914564.1|6166007_6166310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145914565.1|6166481_6167162_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	45.4	1.7e-41
WP_145914566.1|6167513_6167810_+	hypothetical protein	NA	A0A0S2SY28	Pseudomonas_phage	93.4	1.8e-48
WP_145914567.1|6167806_6168133_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	49.5	1.4e-17
WP_145914568.1|6168129_6168342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145914569.1|6168338_6168734_+	DUF2591 family protein	NA	A0A1B0VMD7	Pseudomonas_phage	37.2	6.2e-12
WP_064590671.1|6168730_6169066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023047612.1|6169109_6169343_+	hypothetical protein	NA	A0A2H4PHJ9	Dickeya_phage	41.6	8.4e-09
WP_145914570.1|6169400_6169952_+	hypothetical protein	NA	A0A0U2CID3	Pseudomonas_phage	54.9	2.4e-46
WP_016485670.1|6169989_6170268_+	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	67.0	1.5e-25
WP_016485669.1|6170251_6171379_-|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	74.5	3.6e-166
WP_145914571.1|6171478_6172489_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023048541.1|6172698_6173625_+	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	36.2	8.5e-12
6174645:6174659	attR	CGACCAGCGCCAGGC	NA	NA	NA	NA
