The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	71212	89166	5126272	integrase	Salmonella_phage(27.27%)	19	85326:85339	89930:89943
WP_032166145.1|71212_73969_-	hypothetical protein	NA	Q858F8	Salmonella_phage	88.9	0.0e+00
WP_021543042.1|73968_76029_-	hypothetical protein	NA	Q858F9	Salmonella_phage	59.9	3.6e-204
WP_032166144.1|76028_78560_-	bacteriophage protein	NA	Q858G0	Salmonella_phage	79.6	0.0e+00
WP_023352366.1|78656_78863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101356979.1|79283_79646_-	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	75.8	1.6e-19
WP_021543045.1|79626_80124_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.3	9.2e-13
WP_021543046.1|80160_80583_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032273012.1|80793_82920_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.6	1.8e-174
WP_021543048.1|82916_83219_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032166143.1|83221_83479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111961088.1|83471_83807_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000094456.1|83880_84078_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_024188802.1|84135_84333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543050.1|84501_85059_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.6	1.1e-51
WP_050436474.1|85051_85795_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.0	1.6e-21
85326:85339	attL	TTTTTACCCAGTTC	NA	NA	NA	NA
WP_021568517.1|85787_86486_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.7	1.1e-11
WP_001336356.1|86560_86779_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001059729.1|87250_87901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023352357.1|87897_89166_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	1.0e-193
89930:89943	attR	TTTTTACCCAGTTC	NA	NA	NA	NA
>prophage 2
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1154122	1161262	5126272		Escherichia_phage(83.33%)	6	NA	NA
WP_001279003.1|1154122_1154761_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590420.1|1154757_1156020_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1156016_1156925_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001296319.1|1157120_1157888_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141302.1|1157938_1158595_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_101356954.1|1158700_1161262_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	4.1e-32
>prophage 3
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1236922	1289273	5126272	portal,lysis,plate,head,tRNA,holin,protease,tail,capsid,terminase	Shigella_phage(46.94%)	72	NA	NA
WP_000531794.1|1236922_1238095_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
WP_001331174.1|1238055_1238262_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|1238303_1239170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008234.1|1239278_1239803_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_000081287.1|1239930_1240755_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135691.1|1240820_1241183_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000500990.1|1241651_1242164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1242366_1243041_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|1243131_1243332_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|1243375_1243927_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|1244102_1244282_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104933.1|1244271_1245213_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001332382.1|1245209_1245704_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_001350763.1|1245703_1246357_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	4.7e-126
WP_000210172.1|1246353_1246680_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|1246676_1247066_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061411.1|1247085_1247883_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_001350764.1|1247890_1248880_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001047143.1|1248893_1249646_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_000606308.1|1249831_1250167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000544527.1|1250318_1250624_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_001180490.1|1250610_1251087_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000092331.1|1251083_1251521_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001332386.1|1251591_1251843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026993.1|1251949_1252390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135216.1|1252492_1252843_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000929172.1|1252968_1253463_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_072011717.1|1253696_1255193_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605604.1|1255204_1255387_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466267.1|1255386_1256628_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_001193631.1|1256605_1257256_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|1257270_1258476_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601360.1|1258525_1258726_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1258728_1259052_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702385.1|1259048_1259459_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000213503.1|1259433_1259940_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000779291.1|1259936_1260497_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000497751.1|1260505_1260676_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155718.1|1260659_1262156_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000090998.1|1262155_1262512_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661051.1|1262511_1262781_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_001314907.1|1262747_1262930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807182.1|1262922_1264758_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_001350765.1|1264818_1266147_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000999498.1|1266143_1267223_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_000103707.1|1267222_1267771_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424731.1|1267770_1268196_+	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000785328.1|1268182_1269241_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000539246.1|1269231_1269816_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000554665.1|1269819_1270563_+|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000356380.1|1270562_1271165_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|1271136_1271580_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_001115559.1|1271582_1272074_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_000834402.1|1272327_1274217_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000353910.1|1275268_1276042_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000174562.1|1276252_1276546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183405.1|1276633_1277422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001162465.1|1277418_1277616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332399.1|1277745_1278000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|1278578_1279061_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1279192_1279669_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1279658_1279949_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1280010_1280352_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880938.1|1280500_1282162_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1282247_1283126_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001332400.1|1283248_1283842_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1283896_1285183_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1285203_1285995_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1286161_1287523_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1287659_1287908_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1287926_1288475_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1288505_1289273_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1408147	1452653	5126272	holin,integrase,tail,terminase	Escherichia_phage(55.77%)	55	1401200:1401217	1432301:1432318
1401200:1401217	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_001296289.1|1408147_1409614_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1409682_1411260_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_020231273.1|1411452_1412703_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
WP_001077940.1|1412706_1412901_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_000163451.1|1412897_1413548_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	99.1	2.5e-127
WP_001335975.1|1413540_1413792_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1413949_1414198_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063821.1|1414247_1415129_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_063269926.1|1415125_1415947_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.2	2.0e-161
WP_001102257.1|1415943_1416243_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_000836290.1|1416551_1417136_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1417290_1417521_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402896.1|1417671_1417872_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001559621.1|1417887_1418703_+	hypothetical protein	NA	Q286X4	Escherichia_phage	96.4	3.2e-119
WP_001680564.1|1418699_1419485_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	2.1e-152
WP_063269925.1|1419602_1419947_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.5e-59
WP_101356951.1|1420008_1420428_+	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	57.2	1.6e-29
WP_000156548.1|1420424_1420739_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	86.9	1.6e-42
WP_001350881.1|1420731_1420941_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	98.6	2.0e-33
WP_063269923.1|1420937_1421678_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	77.6	2.8e-58
WP_000253289.1|1422566_1422851_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_021573221.1|1422843_1423125_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	4.5e-49
WP_021515113.1|1423117_1423456_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	2.2e-58
WP_024187282.1|1423496_1424171_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	4.4e-119
WP_021543020.1|1424167_1425643_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	6.4e-296
WP_063269921.1|1425733_1426072_-	hypothetical protein	NA	A0A1W6DXZ5	Salmonella_phage	96.4	2.5e-54
WP_000335899.1|1426778_1426985_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000852419.1|1426999_1428679_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_021517651.1|1428675_1428972_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_063269920.1|1428974_1429670_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	6.0e-95
WP_000268715.1|1429684_1430671_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627062.1|1430722_1431160_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	2.4e-73
WP_000012373.1|1431170_1431506_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	3.8e-55
WP_000424495.1|1431556_1431880_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000179259.1|1431879_1432485_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
1432301:1432318	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
WP_001018557.1|1432484_1434956_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_063269919.1|1434955_1435420_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	3.2e-84
WP_000332878.1|1435419_1435965_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_063269918.1|1435964_1438478_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.8	0.0e+00
WP_083574916.1|1438474_1440277_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	96.2	0.0e+00
WP_063269916.1|1440282_1442757_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
WP_001147904.1|1442952_1443249_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_000708858.1|1443280_1443442_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001113079.1|1443539_1443872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000405096.1|1443873_1444062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042095197.1|1444174_1444885_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	79.8	7.5e-101
WP_001188252.1|1445200_1445458_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_000218907.1|1445653_1448773_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.7	0.0e+00
WP_001276090.1|1449079_1449484_+	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000256103.1|1449470_1449779_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001567213.1|1449768_1450398_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.4e-113
WP_001336051.1|1450394_1450877_+	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	6.9e-74
WP_000755178.1|1451095_1451635_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669398.1|1451650_1452166_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|1452479_1452653_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 5
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1580009	1621124	5126272	portal,lysis,coat,head,holin,integrase,terminase	Enterobacteria_phage(79.25%)	58	1579920:1579936	1620040:1620056
1579920:1579936	attL	AATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1580009_1580210_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545737.1|1580267_1580435_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000002106.1|1580507_1580792_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000161575.1|1581069_1581642_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000215166.1|1581643_1581943_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000812193.1|1581939_1582458_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_001111304.1|1582552_1582849_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951332.1|1582872_1583256_-	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_101356887.1|1583255_1583861_-	ERF family protein	NA	A5VWA8	Enterobacteria_phage	99.5	3.2e-108
WP_014532157.1|1584117_1584393_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_000167596.1|1584482_1584953_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_000219332.1|1584961_1585261_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000856967.1|1585782_1586433_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1586513_1586699_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1586807_1587101_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1587123_1587396_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_001350936.1|1587398_1588346_+	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
WP_001248388.1|1588342_1589719_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000229808.1|1589791_1589998_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000091236.1|1590430_1590616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814617.1|1590627_1591038_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001254264.1|1591034_1591211_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000177653.1|1591207_1591633_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_000950973.1|1591625_1591802_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_001004257.1|1591794_1592517_+	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000002245.1|1592516_1592807_+	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001008199.1|1592803_1593166_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1593162_1593351_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027549.1|1593347_1593866_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000783734.1|1594462_1594786_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1594769_1595246_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_001350934.1|1595242_1595680_+|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_001139680.1|1595667_1595820_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001109020.1|1596025_1596568_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_000807788.1|1596795_1597038_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113731.1|1597040_1597481_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000200779.1|1597477_1598893_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000818371.1|1598894_1601093_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000372589.1|1601183_1602077_+	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000370106.1|1602095_1603349_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_001389518.1|1603390_1603579_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1603559_1604021_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122367.1|1604030_1605449_+	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_000785531.1|1605448_1606150_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_000627629.1|1606149_1606605_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000964905.1|1606607_1607300_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000257015.1|1607310_1608762_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_101356946.1|1608761_1610774_+	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.6	4.2e-96
WP_011703616.1|1610791_1611121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064337.1|1611317_1611884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|1611892_1612342_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000903306.1|1612390_1612927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051911.1|1612926_1613175_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000410001.1|1613289_1613442_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001350929.1|1613674_1614577_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000129907.1|1614677_1617623_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_000958671.1|1618722_1619880_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368123.1|1620191_1621124_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1620040:1620056	attR	AATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 6
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1858783	1867095	5126272		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569345.1|1858783_1859710_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783132.1|1859714_1860446_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1860426_1860534_-	protein YohO	NA	NA	NA	NA	NA
WP_001240394.1|1860593_1861325_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001295431.1|1861546_1863232_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1863228_1863948_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1863994_1864465_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1864505_1864967_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001332210.1|1865091_1867095_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
>prophage 7
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	1963856	1971591	5126272		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001116045.1|1963856_1965251_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
WP_000183029.1|1965425_1966319_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_000699453.1|1966691_1967777_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_001023648.1|1967776_1968676_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000857507.1|1968734_1969610_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_032139969.1|1969627_1970038_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_001332228.1|1970024_1970492_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001033086.1|1970484_1971591_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
>prophage 8
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	2762606	2825364	5126272	portal,lysis,head,holin,terminase,integrase,protease,capsid,tail	Enterobacteria_phage(35.42%)	75	2767330:2767345	2832730:2832745
WP_000422062.1|2762606_2763656_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_101356912.1|2763875_2764634_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_001278741.1|2764630_2765221_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2765260_2766136_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|2766348_2768244_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
2767330:2767345	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|2768271_2768892_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|2768888_2769770_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2769907_2769952_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|2770043_2771606_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2771605_2773201_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|2773204_2774563_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209529.1|2774574_2775768_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_101356911.1|2775767_2776574_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|2776954_2777134_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|2777219_2777720_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|2777765_2778272_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|2779044_2779314_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2779370_2780039_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2779983_2780121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885580.1|2780093_2780678_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000216497.1|2780677_2783785_-	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_001233195.1|2783936_2784536_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000515772.1|2784603_2788083_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_071526774.1|2788243_2788429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2788561_2789164_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140762.1|2789100_2789844_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2789848_2790547_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2790546_2790876_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082348.1|2790872_2793446_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|2793426_2793840_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_021530079.1|2793866_2794298_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	1.6e-42
WP_000235110.1|2794311_2795064_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2795071_2795467_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2795463_2795997_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2796012_2796366_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|2796358_2796742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522602.1|2796793_2797822_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
WP_000256823.1|2797879_2798227_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_101356910.1|2798263_2799769_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.6e-100
WP_000831818.1|2799758_2801351_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2801347_2801554_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2801537_2803466_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2803437_2803986_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001331705.1|2804372_2804606_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000057035.1|2804662_2805073_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001082537.1|2805380_2805845_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_001351274.1|2806783_2807056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|2807021_2807366_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|2807370_2807586_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331709.1|2807854_2808082_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000951233.1|2808622_2808844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935515.1|2809356_2810406_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2810556_2810754_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762880.1|2810978_2811800_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|2811796_2812171_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|2812183_2813230_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|2813231_2813510_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001013637.1|2813677_2813890_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_122083109.1|2813934_2814042_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001331714.1|2814048_2814339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|2814450_2815452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639476.1|2815467_2816430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151217.1|2816621_2817044_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_001262357.1|2817084_2818155_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|2818226_2818652_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2818635_2818878_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|2819269_2819608_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2819900_2820056_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2820215_2820437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2820437_2820602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2821002_2821191_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2821187_2821379_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048435.1|2821471_2823943_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|2824007_2824256_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2824233_2825364_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2832730:2832745	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	2932197	2977361	5126272	portal,lysis,head,tRNA,integrase,protease,tail,capsid,terminase	Enterobacteria_phage(55.17%)	68	2934391:2934404	2975242:2975255
WP_000654167.1|2932197_2932476_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2932472_2934533_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
2934391:2934404	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515327.1|2934591_2938074_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090879.1|2938134_2938737_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140762.1|2938673_2939417_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|2939421_2940120_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2940119_2940449_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_101356909.1|2940445_2943001_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	85.9	0.0e+00
WP_000459485.1|2942993_2943428_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_000479129.1|2943409_2943832_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_101357009.1|2943847_2944588_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_000683145.1|2944595_2944991_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|2944987_2945566_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2945577_2945931_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2945923_2946298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522649.1|2946349_2947378_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000256840.1|2947435_2947783_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253914.1|2947819_2949325_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831818.1|2949314_2950907_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|2950903_2951110_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000622379.1|2951093_2953022_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000867575.1|2952993_2953542_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001337542.1|2953808_2954129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327285.1|2954016_2954370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2954492_2954819_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2955299_2955593_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2955683_2955866_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2956082_2956580_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2956579_2956795_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2957383_2958466_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|2958654_2959038_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2959123_2959264_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2959260_2959623_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950951.1|2959642_2959837_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2959829_2960171_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2960173_2960350_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2960346_2960874_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2960870_2961311_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2961384_2961675_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2961671_2962373_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2962369_2963269_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2963301_2963598_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2963739_2963955_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2964030_2964726_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2964765_2965323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2965319_2966072_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2966348_2966531_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2966508_2966781_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|2966797_2967379_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|2967592_2967793_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2967975_2968344_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2968416_2968581_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2968549_2968693_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001496530.1|2968647_2968800_+	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_000995434.1|2968768_2969065_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2969070_2969856_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2969852_2970533_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2970529_2970712_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2970684_2970876_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|2971262_2971484_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2971483_2971810_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2971793_2972033_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2972172_2972409_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2972398_2973541_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2973654_2974905_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2975076_2975730_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
2975242:2975255	attR	GATGAAGCCGGACG	NA	NA	NA	NA
WP_000476093.1|2975739_2976201_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2976254_2977361_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	3204978	3299808	5126272	portal,lysis,plate,head,capsid,terminase,integrase,protease,tRNA,tail	Salmonella_phage(56.67%)	93	3266769:3266795	3299883:3299909
WP_000886683.1|3204978_3206271_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|3206361_3207705_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3207715_3208327_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077107.1|3208485_3212529_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3212663_3213158_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3213701_3214667_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043638.1|3214789_3216556_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_101356907.1|3216556_3218278_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.3	8.4e-21
WP_001241673.1|3218319_3219024_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3219308_3219527_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350182.1|3220568_3221123_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_101356906.1|3221133_3222135_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	9.4e-49
WP_000415806.1|3223065_3224373_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101565.1|3224702_3227936_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000097886.1|3227932_3228916_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|3229628_3231905_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3231935_3232256_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3232578_3232803_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|3232875_3234822_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746477.1|3234818_3235934_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|3236084_3237041_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599822.1|3237037_3238696_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3239121_3239817_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|3240137_3241037_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3241180_3242833_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178694.1|3242844_3243813_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815373.1|3243945_3245664_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000566391.1|3245700_3246702_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136572.1|3246712_3248143_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3248241_3249255_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255187.1|3249251_3250082_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|3250078_3250402_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000027205.1|3251259_3251988_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3252005_3252737_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|3252743_3253460_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3253459_3254128_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3254353_3255085_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149763.1|3255113_3256241_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_000389260.1|3256281_3256770_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3256829_3257675_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105433.1|3257671_3258625_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3258634_3259768_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3259862_3260975_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3261324_3261801_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3261888_3262791_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001201575.1|3263557_3263845_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|3264004_3264262_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|3264291_3264669_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3264938_3266624_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3266769:3266795	attL	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|3266859_3267078_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_053885094.1|3267168_3268269_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|3268265_3268751_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_101356905.1|3268747_3271825_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.5	0.0e+00
WP_000763311.1|3271817_3271937_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3271951_3272254_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3272308_3272824_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046126.1|3272833_3274006_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000356478.1|3274140_3274743_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000104760.1|3274742_3276368_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
WP_001086836.1|3276364_3276970_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268284.1|3276962_3277871_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001522712.1|3277857_3278217_-	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_033555171.1|3278213_3278792_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_052415661.1|3278881_3279580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356904.1|3279618_3280065_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.9	3.1e-60
WP_101356903.1|3280057_3280489_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_085950968.1|3280451_3280655_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	79.1	4.7e-24
WP_000196202.1|3280584_3281013_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.2	8.6e-60
WP_101356902.1|3281009_3281525_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	2.4e-88
WP_000171568.1|3281505_3281721_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3281724_3281928_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|3281927_3282392_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_089564033.1|3282487_3283138_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.2e-110
WP_000742511.1|3283141_3284200_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216237.1|3284216_3285050_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|3285192_3286959_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520349.1|3286958_3287993_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	6.5e-170
WP_000008839.1|3288040_3289450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3289771_3290077_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3290015_3290204_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_096969118.1|3290357_3292772_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_096969117.1|3292768_3293626_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.6	1.1e-162
WP_000752613.1|3293622_3293850_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3293849_3294083_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|3294150_3294492_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|3294455_3294656_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460883.1|3294663_3295173_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3295205_3295427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009008398.1|3295572_3296472_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.1	2.5e-37
WP_000130914.1|3296472_3297255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570730.1|3297257_3298328_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.5	4.2e-71
WP_000866326.1|3298305_3298677_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.8	5.6e-31
WP_000290937.1|3298755_3299808_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3299883:3299909	attR	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 11
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	3380169	3419714	5126272	portal,lysis,coat,head,holin,integrase,terminase	Enterobacteria_phage(64.81%)	59	3378637:3378651	3419788:3419802
3378637:3378651	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_101356896.1|3380169_3383115_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.2	0.0e+00
WP_101356895.1|3384092_3384542_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	59.6	1.5e-43
WP_101356894.1|3384550_3385117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053270946.1|3385292_3385742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101356893.1|3385759_3387598_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.2	3.1e-247
WP_101356892.1|3387597_3389004_-	acyltransferase	NA	I6RSG0	Salmonella_phage	55.4	1.4e-127
WP_101356891.1|3389013_3389706_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	1.1e-109
WP_000627629.1|3389708_3390164_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|3390163_3390865_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|3390864_3392283_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|3392292_3392754_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|3392734_3392923_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|3392964_3394218_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|3394236_3395130_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|3395220_3397419_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|3397420_3398836_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|3398832_3399273_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|3399275_3399518_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999679.1|3399621_3399993_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	2.0e-57
WP_101356890.1|3400180_3400711_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	94.9	9.9e-90
WP_001139680.1|3400916_3401069_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_101356889.1|3401056_3401524_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	3.0e-74
WP_001519603.1|3401520_3401997_-	glycoside hydrolase family protein	NA	Q716B5	Shigella_phage	99.4	1.7e-88
WP_000783734.1|3401980_3402304_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_101356888.1|3402744_3402930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001235461.1|3402891_3403515_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|3403511_3403700_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008200.1|3403696_3404059_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|3404055_3404346_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001004257.1|3404345_3405068_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|3405060_3405237_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|3405229_3405655_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|3405651_3405828_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|3405824_3406235_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000091236.1|3406246_3406432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000229808.1|3406864_3407071_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|3407143_3408520_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001350936.1|3408516_3409464_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
WP_001244621.1|3409466_3409739_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|3409761_3410055_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001054987.1|3410164_3410389_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092875.1|3410533_3411208_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	5.3e-104
WP_000394871.1|3411248_3411545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|3412272_3412545_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_072658121.1|3412547_3412940_+	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	99.2	7.4e-58
WP_014532157.1|3413240_3413516_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_101356887.1|3413772_3414378_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	99.5	3.2e-108
WP_101356886.1|3414377_3414761_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_094319198.1|3414784_3415081_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	1.7e-51
WP_101356885.1|3415091_3415256_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	3.2e-23
WP_101356884.1|3415252_3415849_+	hypothetical protein	NA	G8EYH3	Enterobacteria_phage	54.3	4.7e-40
WP_048943238.1|3415845_3416163_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	4.7e-47
WP_101356897.1|3416149_3416626_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	57.3	4.1e-26
WP_101356882.1|3416895_3417444_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.6	2.2e-36
WP_101356881.1|3417436_3417721_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	94.7	7.2e-47
WP_000545736.1|3417793_3417961_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	3.7e-27
WP_101357007.1|3417987_3418332_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	5.0e-58
WP_001303849.1|3418447_3418666_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_101356880.1|3418643_3419714_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	9.6e-201
3419788:3419802	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	3618212	3670937	5126272	portal,holin,integrase,protease,tail,tRNA,terminase	Enterobacteria_phage(31.58%)	68	3649035:3649050	3675843:3675858
WP_001201816.1|3618212_3619166_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000239877.1|3619397_3620066_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002430446.1|3620022_3620148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259980.1|3620120_3620426_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_001304815.1|3620483_3620783_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_001351011.1|3620730_3621111_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	77.9	3.6e-41
WP_001201822.1|3621585_3622539_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226381.1|3622725_3624210_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|3624393_3624699_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000742376.1|3624767_3625424_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|3625368_3625506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|3625478_3625577_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|3625616_3625910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|3625919_3626198_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_101356872.1|3626194_3628258_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
WP_101356871.1|3628322_3628922_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.5	1.5e-102
WP_101356870.1|3628989_3632682_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_077792027.1|3632932_3633565_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	7.1e-103
WP_001528990.1|3633510_3634254_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
WP_021524657.1|3634264_3634963_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000847298.1|3634962_3635292_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021524658.1|3635288_3637901_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000533397.1|3637890_3638295_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_016236015.1|3638321_3638753_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_016234254.1|3638771_3639518_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_000682708.1|3639525_3639924_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_016236016.1|3639936_3640560_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	98.1	4.7e-99
WP_001281346.1|3640562_3640844_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097059.1|3640836_3641163_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_128958825.1|3641250_3643230_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
WP_016236019.1|3643219_3644722_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
WP_000102415.1|3644721_3644934_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_050019234.1|3644930_3647054_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.6	0.0e+00
WP_016236020.1|3647050_3647527_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_122986666.1|3648041_3648227_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_001092866.1|3648745_3649279_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
3649035:3649050	attL	CGCTCAATGGCGTTAA	NA	NA	NA	NA
WP_001037012.1|3649315_3650206_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	6.1e-108
WP_000284510.1|3650210_3650426_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021545054.1|3650502_3650748_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_001304601.1|3650785_3650968_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_047335289.1|3651102_3653073_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	5.4e-250
WP_077462104.1|3653854_3654187_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_001204806.1|3654284_3654665_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_021524665.1|3654682_3655672_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
WP_001223333.1|3655681_3656197_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_021531991.1|3656212_3657010_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_101356869.1|3657029_3657419_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	3.9e-67
WP_021524668.1|3657415_3657742_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_021531977.1|3657738_3658392_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_021524670.1|3658391_3658886_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_101356868.1|3658882_3659878_-	replication protein	NA	Q8SBF1	Shigella_phage	87.9	8.5e-50
WP_000995577.1|3659874_3660174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024186770.1|3660170_3660395_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
WP_021524652.1|3660399_3661236_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
WP_000515860.1|3661232_3661784_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|3661827_3662028_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3662118_3662793_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3663479_3663842_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3663907_3664732_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3664859_3665396_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3665386_3665749_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|3665748_3666054_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_077462013.1|3665969_3666425_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	84.0	4.0e-63
WP_001298992.1|3666280_3667444_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000729155.1|3667806_3668673_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3668674_3668887_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|3668994_3669516_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3669551_3670937_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
3675843:3675858	attR	TTAACGCCATTGAGCG	NA	NA	NA	NA
>prophage 13
NZ_CP042246	Escherichia coli strain PU-1 chromosome, complete genome	5126272	4225962	4301182	5126272	portal,lysis,holin,integrase,protease,tail,tRNA,terminase	Enterobacteria_phage(46.55%)	88	4267521:4267537	4303544:4303560
WP_001223199.1|4225962_4226649_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|4227048_4227189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4227284_4228001_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920363.1|4228060_4229413_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219586.1|4229470_4230895_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
WP_001188687.1|4230894_4231584_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4231596_4232070_-	protein CreA	NA	NA	NA	NA	NA
WP_000371658.1|4232280_4233150_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|4233146_4233794_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001339518.1|4233845_4234373_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|4234445_4234772_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409429.1|4234861_4236799_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|4237005_4238673_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|4238728_4239013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000513550.1|4239014_4239347_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093834.1|4239438_4240671_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4240691_4242074_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132964.1|4242122_4243091_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124624.1|4243196_4243841_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105871.1|4243868_4244885_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_001293112.1|4244885_4246217_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224879.1|4246383_4247103_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|4247159_4248383_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477823.1|4248434_4249757_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	3.0e-79
WP_001350777.1|4249834_4250614_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_101357005.1|4250871_4252422_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088372.1|4252393_4253257_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563046.1|4253473_4254253_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001350778.1|4254249_4255323_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4255444_4255606_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4255732_4256338_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4256730_4258317_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217535.1|4258536_4258785_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000859544.1|4258892_4259465_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_000734593.1|4259461_4260283_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|4260279_4260993_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000355702.1|4261492_4261783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204579.1|4261792_4262071_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
WP_101357004.1|4262067_4264131_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	2.1e-151
WP_063269873.1|4264195_4264795_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101357003.1|4264862_4268561_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	75.3	0.0e+00
4267521:4267537	attL	GCGCATCGCCGAGCAGA	NA	NA	NA	NA
WP_101357002.1|4268621_4269149_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.1	8.3e-89
WP_063116075.1|4269167_4269911_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
WP_001152382.1|4269916_4270615_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_000447253.1|4270624_4270954_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_025492007.1|4270953_4274019_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_001161009.1|4273990_4274320_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4274328_4274715_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|4274775_4275519_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|4275530_4275932_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_042003597.1|4275928_4276507_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_025492009.1|4276518_4276794_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	7.2e-44
WP_001097046.1|4276786_4277110_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001360054.1|4277196_4279224_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_023908451.1|4279168_4280749_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_001072975.1|4280676_4280889_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_101357001.1|4280885_4282985_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.4	0.0e+00
WP_000421825.1|4282993_4283533_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001447005.1|4283688_4283889_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	98.5	1.4e-33
WP_001139675.1|4284205_4284358_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|4284345_4284813_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_061091416.1|4284809_4285286_-	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.8	5.0e-85
WP_001120496.1|4285289_4285616_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_133963776.1|4285629_4285821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907077.1|4286016_4286766_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_125282403.1|4286781_4287126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542079.1|4287129_4287744_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	35.9	2.2e-32
WP_001205457.1|4287769_4288114_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001542078.1|4288132_4289122_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.6e-194
WP_001542077.1|4289129_4289927_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_000767113.1|4289946_4290336_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|4290332_4290659_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001343335.1|4290655_4291309_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_001359043.1|4291308_4291803_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	99.4	1.9e-87
WP_000061487.1|4291799_4292618_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_001401086.1|4292614_4292839_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	8.2e-38
WP_001401085.1|4292835_4293987_-	phage regulatory, Rha family protein	NA	A0A0P0ZE80	Stx2-converting_phage	97.9	1.2e-212
WP_001542074.1|4293983_4294535_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.7	9.3e-99
WP_001401082.1|4294527_4294788_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	97.7	3.9e-39
WP_023154561.1|4294759_4294912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311077.1|4294885_4295578_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_032150596.1|4295656_4295911_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	2.3e-12
WP_000135680.1|4296299_4296662_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|4296727_4297552_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008196.1|4297679_4298216_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.2	1.3e-97
WP_024195021.1|4298250_4298445_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_001105426.1|4298654_4299788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218291.1|4299946_4301182_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.6e-234
4303544:4303560	attR	GCGCATCGCCGAGCAGA	NA	NA	NA	NA
>prophage 1
NZ_CP042245	Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence	285922	107864	156973	285922	transposase,integrase,protease	Macacine_betaherpesvirus(33.33%)	44	124872:124886	151634:151648
WP_001696651.1|107864_109088_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001442123.1|109164_110076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101357015.1|110072_111071_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001233385.1|112415_113387_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	1.5e-112
WP_001442122.1|113383_114589_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	9.5e-205
WP_032145561.1|115239_115941_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	32.6	6.0e-26
WP_021543129.1|116620_117427_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.4	3.7e-56
WP_001159871.1|117427_117733_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|117734_117953_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001336213.1|117954_118233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151784.1|118518_119031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545987.1|119064_120198_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|120364_121138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528932.1|121150_121651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|121915_122146_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|122142_122559_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_084818649.1|122603_126428_-	pcar	NA	NA	NA	NA	NA
124872:124886	attL	CAAAGAAAGAAATGT	NA	NA	NA	NA
WP_001261286.1|126778_127009_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|127005_127422_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|127496_129062_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|129046_130069_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000973519.1|131399_133601_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|133682_134960_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|134956_136699_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011908.1|136698_137646_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|137646_139371_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095528.1|139506_140700_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|141079_141460_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_001332402.1|141531_141804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968139.1|142701_143559_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|143555_144413_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|144409_145237_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|145236_146151_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_101357014.1|146273_146465_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000361611.1|149132_150110_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|150394_151135_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|151255_151444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|151818_152727_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
151634:151648	attR	CAAAGAAAGAAATGT	NA	NA	NA	NA
WP_001696610.1|152789_153899_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_023145084.1|153957_154242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000280980.1|154330_155284_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_011402718.1|155387_155777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001324038.1|156144_156408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595315.1|156556_156973_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
>prophage 2
NZ_CP042245	Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence	285922	172347	220821	285922	transposase,bacteriocin,protease	Enterobacteria_phage(26.67%)	40	NA	NA
WP_001610305.1|172347_173745_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000450493.1|174379_175573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948338.1|176027_177301_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
WP_000738422.1|177962_178256_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001324238.1|178770_178953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324233.1|180938_181202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001318220.1|181400_182516_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_011402704.1|182529_186315_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|186418_187648_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|187732_188689_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|188733_190911_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_012006525.1|191198_191426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024130004.1|191649_191835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190233.1|191755_192790_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_001334482.1|192807_192999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377483.1|193349_193658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|193756_193939_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|193935_194133_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001332356.1|194847_196089_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183603.1|196063_198178_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	4.8e-34
WP_001259758.1|198347_198659_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|198636_198873_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|199812_200082_+	membrane protein	NA	NA	NA	NA	NA
WP_001017347.1|200078_201059_+	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001282162.1|201125_201515_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	98.4	6.6e-67
WP_000612591.1|201511_201859_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001696784.1|204035_208169_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
WP_029402714.1|209134_210286_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_000124098.1|210407_210773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487120.1|211239_212250_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
WP_000086538.1|212827_213418_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_000756335.1|213772_214771_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000110581.1|214770_215808_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000020503.1|215807_216569_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_001128098.1|216580_217813_+	MFS transporter	NA	NA	NA	NA	NA
WP_000412701.1|217890_218148_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000451769.1|218148_218382_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001442107.1|218900_219089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001334660.1|219134_219254_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001442106.1|220479_220821_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	92.4	5.5e-41
