The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	274735	282833	2467769		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_005882708.1|274735_275635_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	37.4	4.2e-40
WP_005882710.1|275843_276773_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036604126.1|276769_277450_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	2.1e-31
WP_005882714.1|277461_278517_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_005882717.1|278588_279932_+	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	24.4	1.2e-22
WP_005882719.1|279970_281320_+	insulinase family protein	NA	M1NN74	Moumouvirus	20.6	9.5e-12
WP_050757806.1|281356_281998_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_005882724.1|282036_282525_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.5	8.1e-30
WP_005882726.1|282584_282833_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.9	3.1e-17
>prophage 2
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	626036	688167	2467769	tail,protease,portal,integrase,capsid,head,terminase	Burkholderia_phage(16.67%)	79	647060:647085	687268:687293
WP_005879590.1|626036_627416_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_005879591.1|627466_629794_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_081442176.1|629870_630365_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_005879593.1|630382_631435_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_005879594.1|631431_631899_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_005879596.1|631898_632684_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_005879598.1|632747_633875_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_005879600.1|633867_634527_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	2.3e-27
WP_145815021.1|634633_635302_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_005879602.1|635338_636163_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005879603.1|636343_638776_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	1.9e-164
WP_005879604.1|638921_639359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036602506.1|639400_640312_+	paraslipin	NA	NA	NA	NA	NA
WP_005879607.1|640428_640743_-	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_005879609.1|640775_641618_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005879611.1|641770_642115_-	MliC family protein	NA	NA	NA	NA	NA
WP_005879614.1|642158_643010_-	glutamate racemase	NA	NA	NA	NA	NA
WP_005879616.1|643006_644545_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_145814914.1|644946_646914_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.9	8.8e-83
647060:647085	attL	GGGTTCGAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
WP_005879620.1|647221_648379_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.4	5.5e-101
WP_005879624.1|649000_649486_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	60.7	6.3e-51
WP_005879626.1|649473_649722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145814915.1|649718_649985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036602509.1|650014_650455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036602512.1|650451_650967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145814916.1|650947_651157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879630.1|651345_651765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879632.1|652276_652780_-	siphovirus Gp157 family protein	NA	NA	NA	NA	NA
WP_036602515.1|652781_653399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879636.1|653395_654025_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	58.5	3.8e-72
WP_086131812.1|654189_654957_-	hypothetical protein	NA	I7HBC8	Xanthomonas_virus	64.8	8.1e-08
WP_145814917.1|654953_655163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879639.1|655222_655513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879640.1|655720_656572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879641.1|656568_657318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879643.1|657381_658047_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_036602524.1|658126_658372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081442177.1|658329_658698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081442178.1|659429_659903_+	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	36.1	1.3e-21
WP_036602529.1|659899_660208_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	42.9	1.0e-06
WP_005879647.1|660204_661032_+	helix-turn-helix domain-containing protein	NA	I6XGC7	Burkholderia_virus	48.1	5.4e-18
WP_005879648.1|660991_661684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036602538.1|661680_662037_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036602542.1|662286_662541_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036603471.1|662542_662989_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	51.7	6.5e-34
WP_036602543.1|663118_663523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814918.1|663539_663776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050757685.1|664222_664936_+	hypothetical protein	NA	Q8HA44	Vibrio_phage	51.4	2.4e-22
WP_005879652.1|665128_665422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081442179.1|665447_665747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005879655.1|665743_666079_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_005879657.1|666321_666861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036602549.1|667246_667597_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.8	6.0e-27
WP_005879660.1|667676_668015_+	hypothetical protein	NA	Q3HQS6	Burkholderia_phage	48.4	1.0e-07
WP_005879662.1|668018_669707_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	60.5	2.0e-192
WP_005879664.1|669716_670946_+|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	54.0	1.7e-124
WP_005879666.1|670942_671776_+|protease	Clp protease ClpP	protease	Q3HQS9	Burkholderia_phage	59.5	3.3e-87
WP_005879668.1|671841_673074_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	67.4	3.3e-160
WP_005879670.1|673121_673358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005879672.1|673357_673699_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	47.8	5.9e-19
WP_005879674.1|673700_674021_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	40.0	6.3e-15
WP_050757686.1|674013_674355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005879676.1|674344_674692_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_005879679.1|674684_675044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036602553.1|675157_675388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005879683.1|675422_676061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005879684.1|676069_678778_+	hypothetical protein	NA	Q52PL2	Xanthomonas_phage	27.3	1.8e-17
WP_005879685.1|678777_679173_+	hypothetical protein	NA	A0A0H5ARL4	Pseudomonas_phage	33.1	8.9e-11
WP_036602556.1|679165_679690_+	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	39.5	4.8e-28
WP_005879687.1|679686_680073_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	35.4	6.2e-17
WP_036602557.1|680046_680535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005879688.1|680615_683231_+	hypothetical protein	NA	A5A3R1	Burkholderia_phage	37.1	6.1e-148
WP_145814919.1|683242_683794_+	hypothetical protein	NA	M4QPP7	Synechococcus_phage	38.4	2.2e-15
WP_005879690.1|683804_684542_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_036602558.1|684525_684771_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	47.9	8.8e-09
WP_005879691.1|685003_685492_+	lysozyme	NA	A0A1S6L191	Ralstonia_phage	42.6	2.4e-26
WP_005879692.1|685488_685968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050757765.1|686088_686919_+	damage-inducible protein D	NA	F5A3D6	Riemerella_phage	40.4	6.6e-48
WP_036602565.1|687963_688167_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	65.7	2.5e-17
687268:687293	attR	GGGTTCGAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
>prophage 3
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	1068718	1129301	2467769	tail,capsid	Enterobacter_phage(40.0%)	45	NA	NA
WP_050757700.1|1068718_1070173_-|tail	tail fiber protein	tail	A0A0U4K5K2	Pseudomonas_phage	62.1	1.3e-14
WP_005880177.1|1070628_1073616_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005880179.1|1073939_1074530_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_050757774.1|1074721_1075243_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145814943.1|1075352_1076507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005880186.1|1076680_1076860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814944.1|1076903_1078088_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	40.4	2.8e-15
WP_036602741.1|1078304_1078562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036602743.1|1078566_1078821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036602748.1|1079895_1080633_-	LexA family transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	39.2	1.5e-43
WP_005880197.1|1081138_1082386_+	YdaU family protein	NA	A0A220NQM6	Acinetobacter_phage	36.4	3.8e-07
WP_005880200.1|1082483_1083080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145815030.1|1083560_1083962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880204.1|1083958_1084627_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_036603646.1|1084988_1088855_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.5	1.9e-41
WP_005880207.1|1089152_1091267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880209.1|1091273_1092380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880211.1|1092896_1093484_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_145815031.1|1094056_1094560_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005880217.1|1094771_1096691_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_005880218.1|1096698_1097385_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_145814945.1|1097573_1098794_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_050757702.1|1099033_1100506_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005880224.1|1100729_1101932_-	BNR repeat containing protein	NA	NA	NA	NA	NA
WP_005880226.1|1101944_1103198_-	BNR repeat containing protein	NA	NA	NA	NA	NA
WP_005880229.1|1103791_1105261_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_145815032.1|1105655_1105952_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005880233.1|1106074_1107247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050757703.1|1107430_1108219_-|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	45.3	8.2e-32
WP_005880236.1|1108467_1109502_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_005880239.1|1112873_1114319_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005880241.1|1114460_1115582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005880244.1|1115591_1115813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036602761.1|1116096_1116426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880246.1|1116521_1117940_-	hypothetical protein	NA	Q858G0	Salmonella_phage	47.2	1.1e-21
WP_005880248.1|1118563_1120177_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_081442188.1|1120333_1121251_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005880250.1|1121297_1121813_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005880252.1|1121897_1122413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050757704.1|1122590_1123751_+	hypothetical protein	NA	D5LGZ0	Escherichia_phage	35.2	9.3e-16
WP_005880256.1|1124406_1125456_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_005880258.1|1125535_1125856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880260.1|1125889_1127332_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	35.4	4.3e-18
WP_005880262.1|1127328_1127880_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_145815033.1|1127879_1129301_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	35.5	3.6e-17
>prophage 4
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	1143536	1175841	2467769	tail	Enterobacter_phage(26.67%)	36	NA	NA
WP_086131829.1|1143536_1144052_-|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	54.5	3.7e-33
WP_005880300.1|1144378_1145287_-	class A beta-lactamase	NA	NA	NA	NA	NA
WP_050757708.1|1145570_1146533_-	class A beta-lactamase	NA	NA	NA	NA	NA
WP_005880303.1|1146691_1147165_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005880304.1|1147505_1147922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880305.1|1148088_1149483_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_145814949.1|1149650_1151201_-	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.6e-41
WP_005880307.1|1151461_1151959_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005880308.1|1152244_1153111_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005880309.1|1153501_1154134_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_036602783.1|1154198_1154870_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005880313.1|1154880_1155384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005880315.1|1155691_1156042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880317.1|1156484_1156667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880319.1|1156663_1157017_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_005880321.1|1157104_1157521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880323.1|1157511_1157865_+	hypothetical protein	NA	A0A0U4KR36	Arthrobacter_phage	33.9	3.3e-09
WP_036602786.1|1157885_1158221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880328.1|1158313_1159450_+	hypothetical protein	NA	Q6JIL8	Burkholderia_virus	27.2	4.9e-09
WP_005880330.1|1159446_1159782_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	48.6	1.7e-26
WP_036602789.1|1159781_1160480_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	59.9	1.9e-80
WP_005880334.1|1160481_1161207_+	C40 family peptidase	NA	D6PG99	uncultured_phage	48.5	8.9e-65
WP_005880336.1|1161369_1161960_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	50.3	7.7e-43
WP_005880338.1|1162039_1162660_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	52.7	1.5e-49
WP_005880340.1|1162656_1165803_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	48.2	4.7e-211
WP_036602792.1|1165874_1166951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880344.1|1167014_1168664_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	42.3	1.6e-16
WP_005880346.1|1168780_1170409_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	37.7	7.7e-16
WP_005880348.1|1170420_1170672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814950.1|1170744_1172004_+	hypothetical protein	NA	A0A193GYM0	Enterobacter_phage	50.6	1.4e-28
WP_005880352.1|1172016_1172355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814951.1|1172645_1173143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880356.1|1173335_1173674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880358.1|1173652_1174144_+	lysozyme	NA	A0A1S6L191	Ralstonia_phage	42.1	3.9e-24
WP_005880360.1|1174140_1174626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005880362.1|1174728_1175841_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	34.5	2.1e-17
>prophage 5
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	1302355	1339156	2467769	portal,integrase,tail,terminase	Synechococcus_phage(10.34%)	50	1303464:1303479	1339310:1339325
WP_145814965.1|1302355_1303033_-	LexA family transcriptional regulator	NA	A0A1I9KG86	Aeromonas_phage	30.8	1.1e-24
1303464:1303479	attL	TGGTGCCCGGGACCGG	NA	NA	NA	NA
WP_086131798.1|1303528_1303816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131797.1|1304022_1304202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131796.1|1304227_1304677_-	single-stranded DNA-binding protein	NA	I6NRL7	Burkholderia_virus	58.6	2.6e-46
WP_086131795.1|1304679_1305135_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	58.9	1.3e-50
WP_086131794.1|1305131_1305764_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	49.5	1.6e-57
WP_086131793.1|1305760_1306135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131792.1|1306121_1306346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131791.1|1306342_1307380_-	phage Gp37/Gp68 family protein	NA	I3UM26	Rhodobacter_phage	48.9	1.1e-92
WP_086131790.1|1307382_1307571_-	conjugal transfer protein TraR	NA	M4QSH0	Salicola_phage	54.1	1.2e-10
WP_086131789.1|1307567_1307927_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	51.5	6.0e-22
WP_086131827.1|1307916_1308333_-	DUF3310 domain-containing protein	NA	I6Q9W4	Yersinia_phage	55.2	1.9e-11
WP_086131788.1|1308702_1308882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145814966.1|1309034_1309565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131786.1|1309773_1310244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086131785.1|1310235_1310442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131784.1|1310467_1310926_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	29.6	1.8e-10
WP_086131782.1|1311229_1311625_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086131781.1|1311651_1311936_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	54.1	3.0e-16
WP_086131780.1|1311939_1312233_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.2	2.0e-15
WP_086131779.1|1312324_1313047_+	hypothetical protein	NA	Q8HA44	Vibrio_phage	47.6	9.9e-24
WP_086131778.1|1313039_1313885_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	43.3	1.6e-17
WP_086131777.1|1313877_1316391_+	hypothetical protein	NA	B7SYD0	Stenotrophomonas_phage	32.4	6.5e-107
WP_086131775.1|1316713_1317073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814967.1|1317380_1318160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145814968.1|1318213_1318981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131772.1|1319170_1319773_+	hypothetical protein	NA	D6PFE8	uncultured_phage	28.3	3.8e-05
WP_086131771.1|1319765_1321901_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	42.0	8.0e-122
WP_086131770.1|1321909_1322128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131769.1|1322131_1323583_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	37.8	6.1e-73
WP_086131768.1|1323644_1325681_+	hypothetical protein	NA	A0A2I7S8L6	Vibrio_phage	33.3	8.8e-78
WP_086131826.1|1325763_1326114_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_086131767.1|1326113_1326419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131766.1|1326415_1326823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131765.1|1326836_1327769_+	hypothetical protein	NA	G8EY04	Synechococcus_phage	44.8	2.8e-63
WP_086131764.1|1327778_1328105_+	hypothetical protein	NA	G8CLB3	Synechococcus_phage	29.9	1.5e-08
WP_086131763.1|1328269_1328494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131762.1|1328483_1331027_+	hypothetical protein	NA	A0A2H4J7J3	uncultured_Caudovirales_phage	28.6	1.4e-59
WP_086131761.1|1331026_1331422_+	hypothetical protein	NA	A0A0H5ARL4	Pseudomonas_phage	33.1	1.5e-10
WP_086131760.1|1331414_1331939_+	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	38.4	3.1e-27
WP_086131759.1|1331935_1332322_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	36.2	4.3e-18
WP_036602557.1|1332295_1332784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086131758.1|1332864_1335465_+|tail	phage tail protein	tail	A0A0B5A1N2	Achromobacter_phage	37.3	1.1e-141
WP_145815040.1|1335633_1336014_+	hypothetical protein	NA	M4QPP7	Synechococcus_phage	43.6	2.1e-17
WP_086131757.1|1336016_1336643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131756.1|1336639_1336882_+	pseudouridine synthase	NA	Q776W9	Haemophilus_phage	50.7	8.4e-12
WP_086131755.1|1336878_1337097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131754.1|1337089_1337596_+	lysozyme	NA	U3TK98	Ralstonia_phage	40.5	2.0e-23
WP_086131753.1|1337626_1338061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086131752.1|1338178_1339156_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	48.0	9.7e-75
1339310:1339325	attR	TGGTGCCCGGGACCGG	NA	NA	NA	NA
>prophage 6
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	1529831	1540066	2467769	plate,tail	Burkholderia_phage(41.67%)	12	NA	NA
WP_005880779.1|1529831_1531205_-|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	38.7	3.0e-13
WP_005880780.1|1531227_1531908_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	48.6	8.6e-54
WP_005880781.1|1531904_1533080_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	47.6	7.8e-87
WP_005880782.1|1533076_1533433_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	50.4	4.2e-28
WP_145814983.1|1533438_1534161_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	50.2	3.1e-54
WP_005880784.1|1534160_1535111_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	38.2	6.9e-41
WP_005880785.1|1535107_1535422_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	38.5	1.7e-12
WP_005880786.1|1535424_1535970_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	39.2	7.9e-26
WP_005880787.1|1536057_1537530_-	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	40.8	6.1e-12
WP_036602957.1|1537722_1538151_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	31.5	8.7e-12
WP_005880791.1|1538150_1538594_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	50.0	1.1e-33
WP_005880794.1|1538605_1540066_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	54.5	7.3e-135
>prophage 7
NZ_CP042242	Oxalobacter formigenes strain SSYG-15 chromosome, complete genome	2467769	1653463	1664855	2467769	tRNA	Klosneuvirus(33.33%)	8	NA	NA
WP_005880967.1|1653463_1655062_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	27.2	5.0e-52
WP_036603863.1|1655099_1656005_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_005880972.1|1656241_1656757_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	44.7	4.4e-10
WP_005880974.1|1656746_1657208_-	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	34.5	4.5e-14
WP_036603865.1|1657214_1657850_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005880981.1|1657866_1660866_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.2e-14
WP_005880983.1|1661713_1663321_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.1	5.8e-16
WP_005880988.1|1663391_1664855_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	2.0e-95
