The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042239	Sphingomonas sp. XS-10 chromosome, complete genome	4154291	2292045	2343706	4154291	protease,integrase,tRNA,tail	Tupanvirus(16.67%)	56	2297003:2297024	2310617:2310638
WP_145847141.1|2292045_2292936_-|protease	zinc metalloprotease	protease	A0A1I9SA48	Rhodococcus_phage	37.4	2.4e-35
WP_145847142.1|2293042_2294206_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_145847144.1|2294222_2295008_+	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	2.2e-16
WP_145847145.1|2295004_2295625_+	DUF4893 domain-containing protein	NA	NA	NA	NA	NA
WP_145847148.1|2295676_2296993_+	amidohydrolase	NA	NA	NA	NA	NA
2297003:2297024	attL	CCGTTTGCCCTGAGCCTGTCGA	NA	NA	NA	NA
WP_145847150.1|2297095_2297338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145847152.1|2297465_2298215_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_145847154.1|2298345_2298885_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_145849734.1|2298928_2299423_-	superoxide dismutase family protein	NA	A0A2K9V7M6	Bandra_megavirus	32.1	2.7e-09
WP_145847156.1|2299579_2300473_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	33.7	2.2e-09
WP_145847158.1|2300666_2301404_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_145849736.1|2301412_2302153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847160.1|2302204_2302657_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_145847162.1|2302659_2303748_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_145847164.1|2303744_2304473_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_145847166.1|2304469_2305072_-	DedA family protein	NA	NA	NA	NA	NA
WP_145847168.1|2305105_2306062_-	glutathione synthase	NA	NA	NA	NA	NA
WP_145847170.1|2306189_2306546_-	YraN family protein	NA	NA	NA	NA	NA
WP_145847171.1|2306658_2307495_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_145847173.1|2307507_2308707_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_145847175.1|2308835_2309975_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_145849738.1|2309987_2310569_+|protease	serine protease	protease	A0A2K9L334	Tupanvirus	27.3	8.8e-07
WP_145847177.1|2310706_2311378_-	hypothetical protein	NA	NA	NA	NA	NA
2310617:2310638	attR	CCGTTTGCCCTGAGCCTGTCGA	NA	NA	NA	NA
WP_145847179.1|2311429_2312011_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_145847181.1|2312000_2312696_-	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_145847183.1|2312736_2313405_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R2	Cassava_brown_streak_virus	31.3	3.8e-14
WP_145847185.1|2313401_2313818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145847187.1|2313841_2314252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145847189.1|2314283_2315000_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_145847191.1|2315187_2315694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847193.1|2315747_2316419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847195.1|2316449_2317493_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_145847196.1|2317517_2318075_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_145847198.1|2318238_2320980_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_145847200.1|2321047_2321422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847202.1|2321452_2321803_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_145849740.1|2321933_2322317_+	VOC family protein	NA	NA	NA	NA	NA
WP_145847204.1|2322313_2322517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847206.1|2322938_2323805_-	family 16 glycosylhydrolase	NA	M1I0P8	Acanthocystis_turfacea_Chlorella_virus	28.7	1.8e-24
WP_145847208.1|2323801_2324335_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.3	3.7e-12
WP_145847209.1|2324579_2326613_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.7	4.5e-114
WP_145847211.1|2326698_2327184_-	3'-5' exoribonuclease	NA	K4JMX3	Caulobacter_virus	35.7	3.2e-18
WP_145847213.1|2327397_2327757_+	glyoxalase	NA	NA	NA	NA	NA
WP_145847215.1|2327907_2329935_+|tail	phage tail sheath family protein	tail	A0A1J0GW47	Streptomyces_phage	30.7	3.3e-24
WP_145847217.1|2330196_2331012_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_145849742.1|2331167_2332580_+	UDP-N-acetylmuramate--alanine ligase	NA	NA	NA	NA	NA
WP_145849744.1|2332565_2333792_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_145847219.1|2333980_2334391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145847221.1|2334387_2334591_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145847223.1|2334595_2335513_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_145847225.1|2335574_2336228_-	fructose-6-phosphate aldolase	NA	I3ULK3	Synechococcus_phage	50.5	4.7e-49
WP_145847239.1|2336317_2336986_+	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_145847241.1|2337223_2337913_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145847243.1|2338179_2340345_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_145847244.1|2340552_2342178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145849746.1|2342194_2343706_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
