The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036350	Planctomycetes bacterium K2D chromosome, complete genome	5769002	2269210	2340734	5769002	protease,transposase,integrase	Pithovirus(14.29%)	60	2261142:2261156	2294118:2294132
2261142:2261156	attL	TGCTGCAAAGCGTCA	NA	NA	NA	NA
WP_145111200.1|2269210_2270278_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145382416.1|2270841_2271822_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145382418.1|2272000_2272258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382420.1|2272388_2272670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382422.1|2272768_2273794_-	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_145382424.1|2274144_2274441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382426.1|2274510_2275905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382428.1|2277092_2277800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145383546.1|2277925_2278348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382429.1|2278396_2279566_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_145382431.1|2279608_2281240_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145382433.1|2281274_2281985_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	32.4	7.0e-14
WP_145382434.1|2281987_2283130_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_145382436.1|2283220_2284633_+	TolC family protein	NA	NA	NA	NA	NA
WP_145382438.1|2285360_2286770_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145111297.1|2286822_2290005_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.1	3.8e-75
WP_145382440.1|2290058_2290745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145383547.1|2290806_2291325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382442.1|2291362_2292862_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_145382444.1|2293668_2294202_+	hypothetical protein	NA	NA	NA	NA	NA
2294118:2294132	attR	TGACGCTTTGCAGCA	NA	NA	NA	NA
WP_145382446.1|2294839_2295496_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_145382448.1|2295570_2298048_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.3	2.5e-119
WP_145382450.1|2298052_2298247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382452.1|2298323_2299937_-	TolC family protein	NA	NA	NA	NA	NA
WP_145383548.1|2300981_2302568_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145382454.1|2302557_2306073_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_145383549.1|2306885_2307269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145383550.1|2307864_2308413_+	cytochrome c	NA	NA	NA	NA	NA
WP_145382456.1|2308422_2308947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382457.1|2309130_2309418_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_145383551.1|2309533_2309776_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_145383552.1|2309949_2311356_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_145382459.1|2311506_2312775_-	TolC family protein	NA	NA	NA	NA	NA
WP_145382461.1|2313109_2315458_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	9.8e-89
WP_145382463.1|2316375_2317329_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.1	1.3e-55
WP_145382465.1|2317397_2317982_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145382466.1|2318011_2318512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382468.1|2318508_2319648_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145382470.1|2319758_2320112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382472.1|2320552_2320936_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_145382474.1|2320981_2321548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382476.1|2322489_2323188_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_145382478.1|2323210_2323513_+	glycoside hydrolase family 13	NA	NA	NA	NA	NA
WP_145382480.1|2323641_2324139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382482.1|2324321_2325338_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SIC7	Synechococcus_phage	49.6	3.8e-90
WP_145382484.1|2325348_2326755_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.6	1.1e-71
WP_145382486.1|2326751_2327150_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_145383553.1|2327213_2329610_+	glucoamylase	NA	NA	NA	NA	NA
WP_145382487.1|2329645_2330578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382490.1|2330580_2331786_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_145382492.1|2331788_2332535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382494.1|2332531_2333353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382496.1|2333778_2334531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382498.1|2334846_2335188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145382500.1|2335566_2335755_+	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_145383554.1|2335786_2336059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382501.1|2336339_2336741_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145382503.1|2336737_2337841_+	glycosidase	NA	NA	NA	NA	NA
WP_145383555.1|2338051_2339338_+	amino acid permease	NA	NA	NA	NA	NA
WP_145382505.1|2339384_2340734_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 2
NZ_CP036350	Planctomycetes bacterium K2D chromosome, complete genome	5769002	2346233	2394660	5769002	transposase	Leptospira_phage(33.33%)	30	NA	NA
WP_145383557.1|2346233_2347718_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145382515.1|2348142_2348715_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145382517.1|2348621_2349068_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.5	7.2e-09
WP_145382519.1|2349320_2349866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382521.1|2350272_2350806_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145382523.1|2350802_2351639_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_145382524.1|2352149_2353253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382526.1|2353249_2355469_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145382528.1|2355544_2358832_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	3.5e-68
WP_145382530.1|2359086_2359728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382531.1|2360149_2361505_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_145382533.1|2362606_2364013_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145382535.1|2364016_2367433_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.8	2.6e-58
WP_145382537.1|2367480_2367969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382539.1|2368040_2368379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382541.1|2368492_2369938_+	TolC family protein	NA	NA	NA	NA	NA
WP_145382543.1|2370467_2373407_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_145382545.1|2373508_2374750_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_145382547.1|2374753_2378281_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145382549.1|2378609_2378873_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_145382551.1|2378869_2379877_+	AAA family ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	28.9	5.3e-07
WP_145382553.1|2379880_2382463_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_145111270.1|2383319_2386874_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_145382555.1|2387329_2387710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145381881.1|2387706_2389323_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.0	4.9e-07
WP_145382557.1|2389515_2390289_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.1	3.3e-41
WP_145382559.1|2390285_2391782_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145382561.1|2391996_2393700_+	recombinase family protein	NA	NA	NA	NA	NA
WP_145382563.1|2393925_2394183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382564.1|2394441_2394660_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP036350	Planctomycetes bacterium K2D chromosome, complete genome	5769002	3302450	3353411	5769002	transposase,coat,integrase	Orpheovirus(14.29%)	49	3312211:3312235	3355595:3355619
WP_145112896.1|3302450_3304229_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_145112898.1|3304432_3305239_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_145112900.1|3305364_3306684_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_145112902.1|3306979_3308275_+	DUF2088 domain-containing protein	NA	NA	NA	NA	NA
WP_145112905.1|3308360_3309206_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_145112907.1|3309424_3310495_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145112909.1|3310642_3311641_-	TIM barrel protein	NA	NA	NA	NA	NA
3312211:3312235	attL	GTTCGATTCCCGCCGCCTCCACTTT	NA	NA	NA	NA
WP_145382941.1|3313117_3313402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382942.1|3313599_3313818_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145382943.1|3313814_3314261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382944.1|3314309_3314684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382945.1|3314730_3315615_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_145382946.1|3316204_3316792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382947.1|3316828_3317059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382948.1|3317070_3318129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382949.1|3318125_3318899_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_145382950.1|3318895_3319579_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_145382951.1|3319757_3320348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382952.1|3320241_3323463_+	protein kinase	NA	A0A2I2L419	Orpheovirus	24.2	2.9e-06
WP_145382953.1|3323591_3323864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382954.1|3324220_3324640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382955.1|3324909_3327123_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_145382956.1|3327135_3327702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382957.1|3328456_3329743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382958.1|3329796_3330474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382959.1|3330582_3330918_+	killer suppression protein	NA	NA	NA	NA	NA
WP_145382960.1|3330929_3332009_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_145382961.1|3332149_3332680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382962.1|3332868_3333786_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	42.3	5.8e-53
WP_145382963.1|3333998_3334178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382964.1|3334184_3335594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382965.1|3335604_3336105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145382966.1|3336135_3336660_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_145382967.1|3336763_3337795_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145382968.1|3338356_3339583_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_145382969.1|3339579_3340434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.6	2.3e-32
WP_145382970.1|3340888_3341215_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	41.1	3.4e-08
WP_145382971.1|3341207_3341552_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_145382972.1|3341772_3344229_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	2.7e-121
WP_145382973.1|3344322_3344976_-	cation transporter	NA	NA	NA	NA	NA
WP_145382974.1|3345180_3345795_-	cation transporter	NA	NA	NA	NA	NA
WP_145382975.1|3345909_3347310_-	TolC family protein	NA	NA	NA	NA	NA
WP_145383580.1|3347352_3348483_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_145382976.1|3348497_3349205_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	34.0	1.7e-15
WP_145382977.1|3349246_3350857_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145382978.1|3350877_3352047_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_145382979.1|3352073_3352511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145382980.1|3352521_3352953_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145382981.1|3352982_3353411_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.7	7.7e-08
3355595:3355619	attR	GTTCGATTCCCGCCGCCTCCACTTT	NA	NA	NA	NA
