The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	8108	40625	9565229	transposase,integrase	Enterobacteria_phage(100.0%)	23	18459:18476	53257:53274
WP_145048049.1|8108_9326_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_145048051.1|9370_11806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145048054.1|12096_12345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048056.1|12401_14072_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145048058.1|14132_14531_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_145048060.1|14523_14844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145048062.1|15293_16688_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145048064.1|16714_18163_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048066.1|18255_19623_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
18459:18476	attL	CGCCGCCGAACAGCAGCG	NA	NA	NA	NA
WP_145048069.1|19619_23372_-	DUF1588 domain-containing protein	NA	NA	NA	NA	NA
WP_145048071.1|23407_24517_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145048073.1|24591_25818_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048075.1|25900_27541_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145048077.1|27576_28992_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145048079.1|29238_30621_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048081.1|30676_32374_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145048083.1|32337_32862_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145048085.1|33664_34744_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145048087.1|35200_36058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145048091.1|36172_37636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145059163.1|37613_38168_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	34.4	2.3e-20
WP_145048093.1|38362_40078_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145048095.1|40091_40625_+|transposase	transposase	transposase	NA	NA	NA	NA
53257:53274	attR	CGCCGCCGAACAGCAGCG	NA	NA	NA	NA
>prophage 2
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	115384	173012	9565229	transposase,integrase	Tetraselmis_virus(50.0%)	43	111889:111905	149693:149709
111889:111905	attL	CGGCCCGAGTCGGTCGC	NA	NA	NA	NA
WP_145048190.1|115384_117424_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145048192.1|117318_118131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048194.1|118167_118992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048196.1|119327_120011_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_145048198.1|120000_120678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048200.1|120658_121579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048203.1|121663_121888_-	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_145048205.1|122010_122265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048207.1|122384_122618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048209.1|122622_123573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048211.1|123619_125113_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	32.2	1.5e-55
WP_145048213.1|125226_125427_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145048215.1|125423_125792_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145048217.1|126523_128278_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_145048219.1|128769_129096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048221.1|129155_129527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048222.1|130110_131535_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048224.1|131635_135025_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145048227.1|135334_135550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048230.1|135779_137144_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145048232.1|138161_139934_+	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145048234.1|139952_141212_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048236.1|141227_142232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145048239.1|145120_146539_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145048241.1|147301_148378_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145048243.1|148539_149544_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	31.9	9.5e-33
WP_145048245.1|149590_150976_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
149693:149709	attR	GCGACCGACTCGGGCCG	NA	NA	NA	NA
WP_145048247.1|151332_152706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145048249.1|155060_155705_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_145048251.1|155791_156922_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_145059166.1|156918_157431_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	1.0e-22
WP_145048253.1|157642_158200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048255.1|158233_160198_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	6.8e-27
WP_145048257.1|160277_161213_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_145048259.1|161209_163771_-	DUF2309 family protein	NA	NA	NA	NA	NA
WP_145048261.1|163826_165467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048263.1|165719_166133_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145048265.1|166184_166559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048267.1|166823_168023_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_145048269.1|167985_169527_-	DUF4838 domain-containing protein	NA	NA	NA	NA	NA
WP_145048091.1|169456_170920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145048271.1|170897_172079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048273.1|172433_173012_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	797591	878331	9565229	transposase,protease	Beihai_Nido-like_virus(16.67%)	57	NA	NA
WP_145049099.1|797591_799031_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145049101.1|799976_800921_+	DUF4886 domain-containing protein	NA	NA	NA	NA	NA
WP_145049103.1|801206_803045_-	AAA family ATPase	NA	A0A1L3KIW1	Beihai_Nido-like_virus	36.6	6.9e-05
WP_145049105.1|803414_804317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049107.1|804316_805657_-	MFS transporter	NA	NA	NA	NA	NA
WP_145049109.1|805879_806668_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_145049111.1|806838_808833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049113.1|808825_809173_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_145049115.1|809313_810759_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_145059214.1|810810_811068_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_145049117.1|811361_812657_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_145049119.1|813550_814687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049121.1|814959_816174_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	35.4	1.5e-37
WP_145049123.1|816322_817300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049125.1|817362_818619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049127.1|818948_819929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049129.1|820205_821510_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_145049131.1|821871_822705_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_145049133.1|822759_823950_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_145049135.1|824127_824637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049137.1|825192_826131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049139.1|826186_826429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048247.1|826635_828009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145049141.1|828038_828548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049143.1|829095_830304_+	myo-inositol-1-phosphate synthase	NA	NA	NA	NA	NA
WP_145049145.1|830500_831712_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_145049146.1|831916_833806_+	protein kinase	NA	A0A1M7XTW9	Cedratvirus	30.3	1.3e-11
WP_145049148.1|833892_836019_+	DUF2079 domain-containing protein	NA	NA	NA	NA	NA
WP_145059216.1|836096_837479_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145049150.1|840677_842474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049152.1|842470_843064_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145049154.1|843275_844622_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145049155.1|845036_845873_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145049157.1|845749_846169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145049159.1|846300_847338_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_145049161.1|847334_848087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049163.1|848164_851692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049165.1|851897_852869_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_145049167.1|852875_853727_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_145049169.1|854571_855660_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_145049171.1|855675_856164_-	DinB family protein	NA	NA	NA	NA	NA
WP_145049173.1|856279_857125_-	DUF4343 domain-containing protein	NA	A0A2L0V0T4	Agrobacterium_phage	33.0	1.6e-17
WP_145049175.1|857148_858717_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_145049177.1|858769_860347_-	TolC family protein	NA	NA	NA	NA	NA
WP_145049179.1|860407_860842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049182.1|861227_861635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049184.1|861875_863831_+	DUF4838 domain-containing protein	NA	NA	NA	NA	NA
WP_145049186.1|863846_865379_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145049188.1|865569_866352_+	DUF3050 domain-containing protein	NA	A0A1L7N1A4	Ralstonia_phage	34.0	8.4e-37
WP_145059219.1|866361_867591_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145049189.1|868184_871586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145049191.1|871865_872777_+	bestrophin	NA	NA	NA	NA	NA
WP_145049193.1|872785_873229_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_145049195.1|873373_874102_-	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
WP_145049197.1|874754_877043_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_145049199.1|877320_877632_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_145049200.1|877764_878331_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.0	1.0e-15
>prophage 4
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	2388418	2468245	9565229	transposase,integrase,protease	uncultured_Mediterranean_phage(20.0%)	54	2421898:2421912	2473683:2473697
WP_145051726.1|2388418_2389942_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145051728.1|2390277_2393724_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_145051730.1|2394067_2395102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051732.1|2395216_2396212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051733.1|2396215_2398504_+	caspase family protein	NA	NA	NA	NA	NA
WP_145051735.1|2398500_2402448_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145051737.1|2402622_2403207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051739.1|2403442_2404159_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145051741.1|2404130_2405897_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.4	4.6e-14
WP_145051743.1|2405893_2408026_+	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	30.9	5.3e-17
WP_145051745.1|2408084_2408666_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145051747.1|2408991_2410863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051749.1|2411152_2412022_-	subclass B3 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_145051751.1|2412427_2413081_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_145051753.1|2413217_2414333_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_145051755.1|2414345_2416547_+	DUF1588 domain-containing protein	NA	NA	NA	NA	NA
WP_145051757.1|2416434_2417946_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145051759.1|2418050_2421992_-	protein kinase	NA	Q6XLZ2	Feldmannia_irregularis_virus	25.0	3.2e-15
2421898:2421912	attL	TGCCGCAAATGTTCC	NA	NA	NA	NA
WP_145051761.1|2422091_2422655_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145051763.1|2423177_2427056_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145051766.1|2427143_2428592_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145051769.1|2428595_2430200_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145051772.1|2430704_2433389_+	glucosidase	NA	NA	NA	NA	NA
WP_145051775.1|2434272_2435805_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145051778.1|2436823_2437015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051781.1|2437102_2438134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051785.1|2438210_2438795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051788.1|2438788_2440480_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	31.7	1.8e-20
WP_145051791.1|2440476_2441055_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145051794.1|2441350_2442463_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_145051797.1|2442553_2443636_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_145051800.1|2443650_2446317_-	protein kinase	NA	A0A292G230	Feline_leukemia_virus	25.0	7.4e-08
WP_145051803.1|2446632_2448591_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_145051806.1|2448999_2449569_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_145051809.1|2449820_2451266_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145051812.1|2451507_2451753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051815.1|2451807_2452098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051818.1|2452206_2452614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051821.1|2452666_2453086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051824.1|2453164_2453839_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_145054873.1|2453853_2454168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051827.1|2454220_2455153_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.3	1.2e-13
WP_145059343.1|2455298_2455694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051830.1|2455813_2456755_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145051833.1|2456810_2457038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051836.1|2457152_2457767_-	hypothetical protein	NA	A0A1P8DJF2	Virus_Rctr71	45.0	9.9e-41
WP_145051839.1|2457884_2458787_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.2	4.5e-34
WP_145051842.1|2459286_2461503_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.0	5.9e-11
WP_145051845.1|2461384_2462515_+	response regulator	NA	W8CYM9	Bacillus_phage	30.5	5.3e-08
WP_145051847.1|2463982_2464606_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_145051850.1|2465063_2466110_-	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_145051852.1|2466217_2466445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145051856.1|2467064_2467742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145051859.1|2467888_2468245_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2473683:2473697	attR	TGCCGCAAATGTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	2823778	2898420	9565229	tRNA,transposase,protease,integrase	Leptospira_phage(42.86%)	66	2812996:2813011	2875246:2875260
2812996:2813011	attL	CCGAGGCGGAACTCGG	NA	NA	NA	NA
WP_145052629.1|2823778_2825911_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.7	1.5e-99
2812996:2813011	attL	CCGAGGCGGAACTCGG	NA	NA	NA	NA
WP_145052632.1|2826551_2827715_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_145052635.1|2827699_2829991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052638.1|2830173_2831232_+	transaldolase	NA	NA	NA	NA	NA
WP_145052640.1|2831416_2831920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052643.1|2833345_2834473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052646.1|2834902_2835274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049920.1|2835270_2836425_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145059383.1|2836992_2837298_+	transcription initiation protein	NA	NA	NA	NA	NA
WP_145052649.1|2837455_2838118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059385.1|2838255_2838402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052652.1|2838782_2839508_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_145048230.1|2839537_2840902_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145052656.1|2841137_2841677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052659.1|2841804_2842761_+	histone deacetylase	NA	NA	NA	NA	NA
WP_145052662.1|2842892_2843468_+	YcxB family protein	NA	NA	NA	NA	NA
WP_145052665.1|2843332_2844184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052668.1|2844156_2844726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052671.1|2845108_2845408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052674.1|2845560_2846124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052677.1|2846566_2846956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052680.1|2847216_2848107_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0B5GXV1	Mycobacterium_phage	27.1	4.2e-08
WP_145052684.1|2848093_2849221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052687.1|2849622_2849928_-	hypothetical protein	NA	NA	NA	NA	NA
2849425:2849440	attR	CCGAGTTCCGCCTCGG	NA	NA	NA	NA
WP_145052690.1|2850169_2851060_+|integrase	tyrosine-type recombinase/integrase	integrase	G8I6R6	Mycobacterium_virus	26.4	2.5e-08
2849425:2849440	attR	CCGAGTTCCGCCTCGG	NA	NA	NA	NA
WP_145052693.1|2851046_2852174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052696.1|2852808_2853774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052699.1|2854278_2855169_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.9	1.8e-27
WP_145052703.1|2855173_2856283_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052706.1|2856744_2857131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052709.1|2857242_2857788_-	CbrC family protein	NA	NA	NA	NA	NA
WP_145052712.1|2857994_2858885_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.9	1.1e-27
WP_145052715.1|2858871_2859999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052718.1|2861927_2862332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052721.1|2862482_2862860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052724.1|2863002_2863659_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_145052727.1|2863688_2865152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052730.1|2865943_2866834_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.3	1.1e-27
WP_145052733.1|2866820_2867948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052736.1|2868330_2868828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052741.1|2868981_2870052_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	8.5e-64
WP_145052745.1|2870420_2871266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052748.1|2871345_2871819_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145052751.1|2871890_2872409_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_145052754.1|2872539_2872860_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_145052757.1|2872924_2873431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052760.1|2873535_2874147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052763.1|2874241_2875792_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_145052766.1|2875936_2876698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052769.1|2876870_2878130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052772.1|2878329_2878701_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145059387.1|2879221_2881882_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145052775.1|2881964_2884283_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145059389.1|2884746_2885085_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_145052778.1|2885146_2885392_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_145052781.1|2885781_2886327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052784.1|2886371_2886917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052788.1|2887001_2888165_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_145052791.1|2888637_2889330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052794.1|2889376_2890399_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_145052798.1|2890557_2891127_+	elongation factor P	NA	NA	NA	NA	NA
WP_145052800.1|2891902_2893555_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_145052802.1|2893587_2894388_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_145052804.1|2895043_2895358_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_145052806.1|2895567_2897940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052807.1|2898000_2898420_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	2968727	3078808	9565229	transposase,integrase,protease	Acidithiobacillus_phage(50.0%)	81	2961968:2961982	3094435:3094451
2961968:2961982	attL	CCATCACGCCGACGA	NA	NA	NA	NA
WP_145052909.1|2968727_2970011_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2961968:2961982	attL	CCATCACGCCGACGA	NA	NA	NA	NA
WP_145052911.1|2970007_2971138_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145052913.1|2971661_2971970_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_145052915.1|2972096_2972801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052917.1|2973454_2974030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052920.1|2974352_2976446_+	recombinase family protein	NA	NA	NA	NA	NA
WP_145052922.1|2976525_2976720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052924.1|2976900_2977269_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145052926.1|2977265_2977460_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145052929.1|2977515_2978997_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	31.3	3.9e-51
WP_145052931.1|2979081_2980023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052933.1|2980019_2980283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052935.1|2980382_2980598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052937.1|2980766_2980991_+	molybdopterin converting factor	NA	NA	NA	NA	NA
2980954:2980968	attR	CCATCACGCCGACGA	NA	NA	NA	NA
WP_145052939.1|2981072_2982062_+	hypothetical protein	NA	NA	NA	NA	NA
2980954:2980968	attR	CCATCACGCCGACGA	NA	NA	NA	NA
WP_145052941.1|2981997_2982690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052943.1|2982686_2983355_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_145052946.1|2983978_2984209_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145052948.1|2984422_2988655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052949.1|2988644_2990636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052950.1|2992694_2993153_+	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	42.0	1.3e-13
WP_145048091.1|2993092_2994556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052951.1|2995100_2998250_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_145052952.1|2998525_2999953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052953.1|2999949_3001248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052954.1|3001382_3003236_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_145052955.1|3003192_3003729_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_145052956.1|3003766_3006292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052957.1|3007184_3008999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052958.1|3009318_3010380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052959.1|3010508_3010850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052960.1|3011010_3011895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048369.1|3011917_3012181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052961.1|3012547_3013111_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145052963.1|3013210_3019246_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.0	2.5e-19
WP_145050672.1|3021053_3022517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052965.1|3022850_3023939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048357.1|3024160_3025741_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145052967.1|3026100_3027597_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145052970.1|3027804_3028191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052972.1|3028494_3029508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145052974.1|3029550_3033585_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145052976.1|3034264_3035572_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_145052978.1|3035590_3036844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145052980.1|3036830_3037064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145052982.1|3037070_3039125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052984.1|3039211_3039496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052986.1|3039784_3040162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052988.1|3040380_3040794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052990.1|3040849_3041185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052992.1|3041243_3041762_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145052995.1|3041785_3042004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052997.1|3042157_3043108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145052999.1|3043671_3044151_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	32.3	4.4e-12
WP_145059397.1|3044150_3044582_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	60.2	3.3e-27
WP_145049920.1|3044578_3045733_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145053001.1|3045789_3046965_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	37.7	1.4e-40
WP_145053003.1|3047412_3047832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145053005.1|3047708_3048650_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145053007.1|3048988_3050806_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145053009.1|3050837_3051650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053011.1|3051658_3053548_+	translocase	NA	NA	NA	NA	NA
WP_145053013.1|3053577_3055503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053015.1|3055699_3057910_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145053017.1|3057877_3058909_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145053019.1|3059050_3059374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053021.1|3059424_3065094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053023.1|3066314_3066836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053025.1|3066942_3067737_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_145053028.1|3067794_3069246_+	pectic acid lyase	NA	NA	NA	NA	NA
WP_145053030.1|3069327_3069864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053032.1|3069903_3070506_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_145053034.1|3071063_3071357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053037.1|3071526_3072798_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_145053039.1|3072936_3073926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145053041.1|3074039_3074645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053044.1|3074685_3074937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053046.1|3075145_3076702_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_145053048.1|3076789_3076990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053050.1|3077011_3077815_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_145059399.1|3077941_3078808_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3094435:3094451	attR	CCGGCTGCTGCGGCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	3412394	3451424	9565229	transposase,protease,integrase,tRNA	Bacillus_phage(28.57%)	29	3446382:3446428	3452454:3452500
WP_145053476.1|3412394_3413789_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145053478.1|3413944_3415066_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_145053480.1|3415077_3416187_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.9	7.5e-15
WP_145053483.1|3416337_3416784_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_145053485.1|3417391_3422554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059446.1|3422682_3424107_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_145053487.1|3424642_3425287_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_145053489.1|3425777_3428624_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.9	9.5e-70
WP_145053491.1|3428920_3429505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053494.1|3429685_3431488_+	histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	1.0e-16
WP_145053496.1|3431498_3431954_+	response regulator	NA	W8CYM9	Bacillus_phage	30.2	1.7e-05
WP_145053498.1|3431984_3433262_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CYK4	Yersinia_phage	42.4	1.8e-76
WP_145053500.1|3433591_3434971_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145059448.1|3435357_3436554_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_145053502.1|3437226_3438540_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	33.8	3.4e-54
WP_145053504.1|3439565_3440090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053506.1|3440435_3440831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053508.1|3440983_3441316_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_145048247.1|3441505_3442879_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145053510.1|3442977_3444204_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145053512.1|3444307_3444658_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_145053514.1|3444873_3445743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145053516.1|3445805_3446033_-	hypothetical protein	NA	NA	NA	NA	NA
3446382:3446428	attL	AAGCACGCCCAGAAGGATTCGAACCTTCGACCTGCGGATTAGAAGTC	NA	NA	NA	NA
WP_145053519.1|3446983_3447241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053521.1|3447856_3448654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053523.1|3448650_3448854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145053525.1|3448886_3449630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059450.1|3449604_3450849_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.4	8.2e-111
WP_145053527.1|3450755_3451424_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3452454:3452500	attR	AAGCACGCCCAGAAGGATTCGAACCTTCGACCTGCGGATTAGAAGTC	NA	NA	NA	NA
>prophage 8
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	4639911	4686419	9565229	transposase	Yellowstone_lake_phycodnavirus(50.0%)	32	NA	NA
WP_145054378.1|4639911_4641066_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145054379.1|4641437_4642961_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145054380.1|4643095_4643482_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_145050654.1|4643528_4644902_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054381.1|4644944_4646591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054382.1|4646667_4647294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145048247.1|4647595_4648969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054383.1|4649011_4650304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054384.1|4650443_4652966_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_145054385.1|4653102_4656174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054386.1|4656163_4657822_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_145054387.1|4658257_4659787_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_145054388.1|4659780_4660293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054389.1|4660326_4661397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054390.1|4661565_4662279_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145054391.1|4662354_4662783_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_145054392.1|4662855_4666104_-	helicase SNF2	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	33.0	1.2e-41
WP_145054393.1|4666451_4666916_+	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_145054394.1|4666951_4667929_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_145054395.1|4668307_4669072_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145054396.1|4669068_4670643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054397.1|4671214_4671568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054398.1|4671871_4673713_+	HSP90 family protein	NA	A0A1V0SAD6	Catovirus	28.2	3.8e-19
WP_145054399.1|4673705_4674791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054400.1|4674853_4675426_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_145054401.1|4675752_4676661_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_145054402.1|4676716_4677964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054403.1|4678311_4679751_+	response regulator	NA	NA	NA	NA	NA
WP_145054404.1|4679787_4682316_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_145059574.1|4682629_4683187_-	DUF3386 family protein	NA	NA	NA	NA	NA
WP_145049920.1|4683138_4684293_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145054405.1|4684979_4686419_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	4760214	4909444	9565229	transposase,integrase,tRNA	Synechococcus_phage(15.38%)	101	4826187:4826208	4883114:4883135
WP_145059586.1|4760214_4761270_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.0	1.9e-60
WP_145054457.1|4761399_4762437_-	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_145054458.1|4762711_4763200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054459.1|4763295_4764651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054460.1|4764876_4765890_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3F8A7	Synechococcus_phage	57.5	4.4e-102
WP_145054461.1|4766302_4767328_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_145054462.1|4767525_4768035_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145054463.1|4768055_4768508_-	rubrerythrin	NA	NA	NA	NA	NA
WP_145054464.1|4768626_4771650_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_145054465.1|4771978_4772188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054466.1|4772308_4772809_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_145054467.1|4772913_4773960_-	FAD-binding protein	NA	A0A2I2L5E1	Orpheovirus	46.4	1.4e-74
WP_145054468.1|4774094_4775150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054469.1|4775219_4776515_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145054470.1|4776540_4778352_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145059588.1|4778736_4780191_-	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	48.9	1.9e-122
WP_145054471.1|4780417_4782388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054472.1|4782684_4785729_+	PAS domain-containing protein	NA	W8CYM9	Bacillus_phage	31.4	2.3e-05
WP_145054473.1|4785747_4786419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054474.1|4786484_4786985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054475.1|4787161_4787680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054476.1|4787687_4789016_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145054477.1|4789286_4790366_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145054478.1|4790586_4791276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054479.1|4791651_4792887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054480.1|4793114_4793549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054481.1|4793883_4794756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054482.1|4795122_4796616_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145054483.1|4796731_4797808_-	peptidase M42	NA	NA	NA	NA	NA
WP_145054484.1|4798509_4799112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145050672.1|4799116_4800580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145049331.1|4800745_4801693_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_145054485.1|4801976_4802186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054486.1|4802366_4803035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054487.1|4803038_4803548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145049581.1|4803616_4805056_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145054488.1|4804967_4805258_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145054489.1|4805441_4806860_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145054490.1|4806994_4807201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054491.1|4807736_4821494_+	choice-of-anchor D domain-containing protein	NA	NA	NA	NA	NA
WP_145054492.1|4821393_4822299_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145054493.1|4822347_4823721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054494.1|4823689_4824085_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145054495.1|4823962_4825207_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_145054496.1|4825227_4826136_+	hypothetical protein	NA	NA	NA	NA	NA
4826187:4826208	attL	CGAATGGCACAGTCGTTTTTCT	NA	NA	NA	NA
WP_145054497.1|4826367_4827813_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145054498.1|4827848_4828751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054499.1|4828780_4830220_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145054500.1|4830500_4831391_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.3	6.2e-28
WP_145054501.1|4831377_4832505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054502.1|4832582_4834163_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145054503.1|4834504_4836343_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_145054504.1|4836655_4837912_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145054505.1|4837971_4841127_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_145054506.1|4841515_4842073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054507.1|4842282_4842705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054508.1|4842948_4844445_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145054509.1|4844739_4845219_-	HAD family hydrolase	NA	E4ZFI9	Streptococcus_phage	56.0	1.7e-19
WP_145054510.1|4845436_4851475_+	hypothetical protein	NA	G9J201	Bacillus_phage	33.3	1.6e-29
WP_145054511.1|4851645_4853109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054512.1|4853451_4856004_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_145054513.1|4856131_4857478_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145054514.1|4859026_4860634_-	serine hydrolase	NA	NA	NA	NA	NA
WP_145059590.1|4861136_4862498_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145054515.1|4862494_4864420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054516.1|4864776_4866228_+	serine hydrolase	NA	NA	NA	NA	NA
WP_145054517.1|4866837_4867743_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.9	2.1e-31
WP_145054518.1|4868101_4868446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054519.1|4869368_4869734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054520.1|4871313_4872339_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_145054521.1|4872915_4873371_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_145054522.1|4873367_4874369_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_145054523.1|4874546_4875575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054524.1|4876053_4880664_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145054525.1|4881091_4881964_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145054526.1|4882334_4882634_+	Ryanodine receptor Ryr	NA	A0A1S5R402	Pseudomonas_phage	36.4	1.9e-05
WP_145054527.1|4882730_4883216_+	hypothetical protein	NA	NA	NA	NA	NA
4883114:4883135	attR	CGAATGGCACAGTCGTTTTTCT	NA	NA	NA	NA
WP_145054528.1|4883137_4884661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145054529.1|4884512_4886669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059592.1|4887111_4887585_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145054530.1|4887581_4888553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054531.1|4888536_4889013_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145054532.1|4889042_4889693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054533.1|4889949_4890951_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_145054534.1|4891026_4891542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054535.1|4891543_4892488_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_145054536.1|4892542_4893319_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_145054537.1|4893598_4895653_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.9	1.7e-52
WP_145054538.1|4895918_4896620_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145054539.1|4896627_4896894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054540.1|4896942_4899081_-	AAA family ATPase	NA	A0A1V0SG63	Hokovirus	39.0	1.1e-30
WP_145054541.1|4899143_4899713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054542.1|4899849_4900869_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_145054543.1|4901111_4902239_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_145054544.1|4902351_4903803_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_145054545.1|4904270_4904657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145059594.1|4905274_4905940_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_145054546.1|4906072_4906474_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_145054547.1|4906725_4907769_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145054548.1|4907884_4908469_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	2.0e-14
WP_145054549.1|4908472_4909444_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	5345542	5353118	9565229		Paramecium_bursaria_Chlorella_virus(14.29%)	8	NA	NA
WP_145054819.1|5345542_5346433_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	31.1	2.3e-22
WP_145054820.1|5346554_5347484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145054821.1|5347769_5348591_+	DNA adenine methylase	NA	Q6NDX5	Leptospira_phage	33.9	5.6e-31
WP_145054822.1|5348774_5349371_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	55.7	4.1e-60
WP_145054823.1|5349501_5350071_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	26.6	2.6e-11
WP_145054824.1|5350255_5350702_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.1	4.2e-09
WP_145054825.1|5350705_5351998_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.2	1.7e-106
WP_145054826.1|5352086_5353118_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.3	9.5e-12
>prophage 11
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	7026404	7037737	9565229	transposase,integrase	Leptospira_phage(100.0%)	9	7035628:7035687	7046599:7046702
WP_145055132.1|7026404_7027295_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.9	1.8e-27
WP_145055133.1|7027281_7028409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145056182.1|7028842_7029322_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_145056183.1|7029534_7030101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145055132.1|7030316_7031207_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.9	1.8e-27
WP_145056184.1|7031193_7032321_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145056185.1|7033004_7033436_-	hypothetical protein	NA	NA	NA	NA	NA
7035628:7035687	attL	TTCAAGGAAGCCGCTGCGCGGCAGGTTTTGATTTTACCCCTTCGCTGTGGTTGTACGCCA	NA	NA	NA	NA
WP_145056186.1|7035732_7036494_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-21
WP_145056187.1|7036609_7037737_+|transposase	transposase	transposase	NA	NA	NA	NA
7046599:7046702	attR	TTCAAGGAAGCCGCTGCGCGGCAGGTTTTGATTTTACCCCTTCGCTGTGGTTGTACGCCATCCTTGGAAGGACGTTTTTCTTTGCGTTTTTCCAGGAGGTTGAT	NA	NA	NA	NA
>prophage 12
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	7303235	7350643	9565229	transposase,tRNA	Planktothrix_phage(50.0%)	36	NA	NA
WP_145056386.1|7303235_7304681_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_145056387.1|7304845_7306150_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_145056388.1|7306206_7307301_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_145056389.1|7307636_7307930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056390.1|7308416_7309130_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145056391.1|7309132_7310047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059925.1|7310138_7310447_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_145056392.1|7310578_7310947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145059929.1|7311103_7311598_-	protein phosphatase	NA	NA	NA	NA	NA
WP_145056393.1|7311740_7314869_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145056394.1|7314920_7317071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056395.1|7317116_7320350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056396.1|7320571_7321027_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.6	1.2e-06
WP_145056397.1|7321075_7322086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145056398.1|7321998_7322544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145056399.1|7322850_7324431_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145056400.1|7324972_7328137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056401.1|7328467_7329385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056402.1|7329892_7330456_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145056403.1|7330573_7330888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056404.1|7331323_7332715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056405.1|7333265_7333739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056406.1|7333914_7334136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056407.1|7334295_7334745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056408.1|7334793_7335465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145059933.1|7335440_7335719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056409.1|7335954_7336341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056410.1|7336388_7336634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056411.1|7336645_7337590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145056412.1|7337772_7341996_+	protein kinase	NA	A0A075BUR2	Microcystis_phage	37.4	1.2e-20
WP_145056413.1|7342465_7343425_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145056414.1|7343926_7344190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145056415.1|7344377_7345958_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145056416.1|7346229_7347810_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145056417.1|7348351_7348831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145054405.1|7349203_7350643_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	8792585	8862438	9565229	transposase,protease,integrase	Synechococcus_phage(14.29%)	48	8810828:8810845	8868689:8868706
WP_145058215.1|8792585_8793173_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_145058217.1|8793419_8796299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058219.1|8796425_8797286_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	24.6	2.8e-17
WP_145058221.1|8797320_8800974_-	protein kinase	NA	A0A1M7XUH0	Cedratvirus	23.5	7.5e-19
WP_145058223.1|8801170_8802313_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_145060157.1|8802601_8806003_-	dehydrogenase	NA	NA	NA	NA	NA
WP_145058225.1|8806550_8806916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058227.1|8807580_8808567_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.0	5.4e-49
WP_145058228.1|8808843_8812659_+	S8 family serine peptidase	NA	NA	NA	NA	NA
8810828:8810845	attL	CGGCCCACCCGGAGCGAG	NA	NA	NA	NA
WP_145058230.1|8812689_8814303_-	amidase	NA	NA	NA	NA	NA
WP_145058232.1|8814299_8814620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058234.1|8814642_8816397_-	Hsp70 family protein	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	34.0	3.8e-77
WP_145058236.1|8816439_8817264_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_145058238.1|8817260_8817551_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_145058240.1|8817694_8820007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058242.1|8820734_8821541_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	4.3e-20
WP_145058244.1|8821621_8824492_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_145058247.1|8824566_8826339_+	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_145058249.1|8826460_8827300_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_145058251.1|8827432_8828245_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_145058253.1|8828260_8828707_-	transporter	NA	NA	NA	NA	NA
WP_145058255.1|8828834_8830115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058257.1|8830130_8830949_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_145058259.1|8830983_8832009_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_145058261.1|8832033_8832987_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_145060160.1|8833093_8833615_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_145058263.1|8833914_8834763_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145058265.1|8834884_8837206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058267.1|8837286_8839245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058269.1|8839284_8840328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058271.1|8840776_8841178_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_145058273.1|8841248_8842127_-	recombinase RecA	NA	NA	NA	NA	NA
WP_145058275.1|8842376_8842916_-	DUF2617 family protein	NA	NA	NA	NA	NA
WP_145058277.1|8843197_8844022_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145058279.1|8844414_8845266_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	39.6	1.4e-53
WP_145060162.1|8845397_8847182_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.4	8.0e-51
WP_145058281.1|8848052_8848463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058283.1|8848643_8850332_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_145058285.1|8850707_8852135_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145048230.1|8852379_8853744_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145058287.1|8853933_8854731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058289.1|8854795_8855092_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145048247.1|8855304_8856678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145058291.1|8857020_8857461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058293.1|8857492_8857747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058295.1|8858232_8859309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058297.1|8860095_8860653_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_145048091.1|8860974_8862438_+|transposase	transposase	transposase	NA	NA	NA	NA
8868689:8868706	attR	CTCGCTCCGGGTGGGCCG	NA	NA	NA	NA
>prophage 14
NZ_CP036433	Planctomycetes bacterium Pla85_3_4 chromosome, complete genome	9565229	9374961	9396344	9565229	transposase	Bacillus_thuringiensis_phage(33.33%)	17	NA	NA
WP_145050654.1|9374961_9376335_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145058894.1|9376533_9377139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145058895.1|9377363_9378944_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145048230.1|9379410_9380775_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145058898.1|9381086_9382667_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145058900.1|9382870_9383641_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_145058902.1|9384379_9385264_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145058904.1|9385355_9386111_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_145060229.1|9386406_9386694_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_145058906.1|9386741_9387380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058908.1|9387575_9387872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145058910.1|9388093_9389026_-	diguanylate cyclase	NA	Q56AR1	Bacillus_thuringiensis_phage	27.0	1.1e-06
WP_145058912.1|9389022_9391752_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.8	5.3e-70
WP_145058914.1|9391757_9392438_-	RedB protein	NA	NA	NA	NA	NA
WP_145058916.1|9393592_9394333_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145058918.1|9394338_9394650_+	response regulator	NA	NA	NA	NA	NA
WP_145058920.1|9395747_9396344_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.2	1.1e-17
