The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	715736	755764	6618662	protease,transposase	Heterosigma_akashiwo_virus(33.33%)	25	NA	NA
WP_145281203.1|715736_716681_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145291966.1|717156_717336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145281205.1|717498_718713_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145281207.1|718724_719855_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145281209.1|719939_720194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145281211.1|720624_722151_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145281213.1|723733_724711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145281215.1|724698_725829_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145281217.1|728250_728460_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_145281219.1|728624_729536_+	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	31.3	4.4e-13
WP_145281221.1|729563_730946_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145281223.1|734156_736454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145281224.1|736658_737102_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_145281226.1|737228_737705_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_145281228.1|737782_738100_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_145281230.1|738390_740133_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.7	7.2e-12
WP_145281232.1|740289_741966_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_145281234.1|742060_745045_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	30.0	1.2e-19
WP_145281236.1|745125_746169_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_145281238.1|746269_747937_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_145281239.1|748023_751035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145281240.1|751174_752989_-	1,4-alpha-glucan branching protein	NA	NA	NA	NA	NA
WP_145291967.1|753181_753637_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_145281241.1|754113_754521_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_145281242.1|754585_755764_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	2329963	2398398	6618662	integrase,transposase	Escherichia_phage(50.0%)	40	2384806:2384831	2404303:2404328
WP_145283564.1|2329963_2331151_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145283566.1|2331034_2335237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283568.1|2335461_2336214_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145283570.1|2336314_2337121_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145283572.1|2337117_2338857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292043.1|2338930_2339944_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145283574.1|2339974_2340430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283576.1|2340465_2341902_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145283578.1|2341949_2344490_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145283580.1|2344515_2347521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283583.1|2348904_2351118_-	malate synthase G	NA	NA	NA	NA	NA
WP_145283586.1|2353366_2354626_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	47.5	3.0e-84
WP_145283588.1|2354690_2355722_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_145283590.1|2355770_2357294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283592.1|2357551_2359258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283595.1|2359265_2360144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283597.1|2360140_2361163_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_145283599.1|2361206_2362502_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145283602.1|2362507_2365396_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_145283604.1|2365545_2367084_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145283606.1|2367080_2367701_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145283609.1|2368277_2369264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283611.1|2369650_2372032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283614.1|2372104_2373073_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145283616.1|2373156_2373549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283618.1|2373779_2373977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283621.1|2374178_2375012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145283623.1|2375019_2376948_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145283626.1|2376944_2382065_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_145283628.1|2382636_2385060_+	hypothetical protein	NA	NA	NA	NA	NA
2384806:2384831	attL	GCCGACTACACCGTGTGGCGCGACAC	NA	NA	NA	NA
WP_145292044.1|2385134_2386532_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145283631.1|2386410_2387970_+	DUF1593 domain-containing protein	NA	NA	NA	NA	NA
WP_145283633.1|2388143_2389916_+	DUF4038 domain-containing protein	NA	NA	NA	NA	NA
WP_145283635.1|2390559_2391732_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145283637.1|2391949_2392285_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145283640.1|2392269_2392437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145283642.1|2392452_2393364_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145283644.1|2393502_2394039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145283646.1|2395151_2396462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283648.1|2397132_2398398_+|integrase	tyrosine-type recombinase/integrase	integrase	Q854V7	Mycobacterium_virus	29.4	3.0e-07
2404303:2404328	attR	GTGTCGCGCCACACGGTGTAGTCGGC	NA	NA	NA	NA
>prophage 3
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	2786798	2955164	6618662	integrase,transposase	Bacillus_phage(18.18%)	110	2892140:2892161	2912555:2912576
WP_145284355.1|2786798_2787929_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284359.1|2787895_2789020_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_145292056.1|2789077_2790535_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284362.1|2790644_2793833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284365.1|2794370_2796149_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_145292057.1|2796276_2799171_+	signaling protein	NA	NA	NA	NA	NA
WP_145284368.1|2799367_2800789_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145292058.1|2800969_2803303_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_145284371.1|2803318_2804104_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_145284374.1|2807328_2807835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284379.1|2809111_2810242_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284382.1|2810213_2811779_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284385.1|2812034_2814677_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_145284388.1|2814725_2815136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284391.1|2815143_2816160_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145284394.1|2816224_2817232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284397.1|2817445_2818243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284401.1|2818259_2819276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284404.1|2819272_2821234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284407.1|2821633_2822167_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145284410.1|2822159_2823668_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145284413.1|2823830_2825297_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284416.1|2826029_2828342_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284419.1|2828619_2829642_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145284422.1|2830938_2831430_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145284425.1|2831378_2833085_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145292059.1|2833526_2835251_+	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_145284429.1|2835234_2837028_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_145284432.1|2837002_2838865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284435.1|2839550_2842940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284438.1|2843251_2843620_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284441.1|2843657_2844320_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284444.1|2844446_2844737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284447.1|2844872_2847347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284451.1|2847428_2848898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284454.1|2849363_2851826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284457.1|2854352_2855636_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284460.1|2855717_2857628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292060.1|2857713_2858991_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145284463.1|2859519_2861607_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284467.1|2862006_2862423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284471.1|2862419_2863418_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145284475.1|2864831_2866316_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145292061.1|2866457_2868296_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_145284478.1|2868755_2869586_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_145284481.1|2869645_2870689_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284484.1|2870795_2871818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284487.1|2871912_2873604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284490.1|2873718_2877540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284493.1|2878780_2882731_+	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_145284496.1|2882965_2883460_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145284499.1|2884006_2885689_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284502.1|2885660_2886569_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_145284505.1|2886565_2889193_+	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145284508.1|2889209_2890631_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145292062.1|2890678_2891476_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145284511.1|2891523_2892249_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2892140:2892161	attL	CCCATCGCGTCGATGGTCACCA	NA	NA	NA	NA
WP_145284514.1|2892259_2892691_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284517.1|2892776_2894102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284520.1|2894159_2894615_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145284523.1|2895455_2895767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284526.1|2895742_2896648_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.3	1.1e-48
WP_145284529.1|2896768_2900212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284532.1|2900998_2904580_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_145284535.1|2904576_2905647_+	dihydroorotate dehydrogenase-like protein	NA	NA	NA	NA	NA
WP_145292063.1|2906202_2906442_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_145284539.1|2906802_2907891_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	28.3	4.6e-09
WP_145284542.1|2908313_2908574_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_145284545.1|2908746_2910120_-	response regulator	NA	NA	NA	NA	NA
WP_145284548.1|2910820_2911204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284551.1|2911200_2911557_-	DUF2252 family protein	NA	NA	NA	NA	NA
WP_145284554.1|2911599_2911923_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145284557.1|2912046_2913177_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2912555:2912576	attR	TGGTGACCATCGACGCGATGGG	NA	NA	NA	NA
WP_145284559.1|2913124_2914579_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284562.1|2914632_2916303_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284565.1|2917149_2918280_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284568.1|2918646_2920146_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.7	2.4e-24
WP_145284572.1|2920142_2921714_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284575.1|2921797_2921983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284578.1|2922279_2925114_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_145284581.1|2925122_2926643_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284584.1|2926892_2927192_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284587.1|2927206_2927698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284590.1|2927779_2929285_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145284593.1|2929281_2929782_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.9	2.5e-10
WP_145284596.1|2930004_2930982_+	recombinase family protein	NA	NA	NA	NA	NA
WP_145284599.1|2930957_2931239_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284603.1|2931275_2932103_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284606.1|2932201_2933398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292064.1|2933449_2933848_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	46.3	1.2e-23
WP_145284609.1|2933988_2935020_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.5	4.2e-44
WP_145284613.1|2935045_2936299_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_145284616.1|2936756_2937053_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_145284619.1|2937444_2938956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284622.1|2939345_2940476_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284625.1|2940630_2941323_+	DNA ligase	NA	NA	NA	NA	NA
WP_145284628.1|2941319_2942450_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145284631.1|2942643_2942811_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_145284634.1|2942916_2944329_+	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	NA	NA	NA	NA
WP_145284637.1|2944365_2944626_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_145284640.1|2944636_2944888_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_145284643.1|2944936_2945893_+	nucleotidyltransferase domain-containing protein	NA	G3M9V9	Bacillus_virus	27.4	2.0e-19
WP_145292065.1|2945904_2946666_+	nucleotidyltransferase domain-containing protein	NA	K4K696	Caulobacter_phage	38.0	6.5e-10
WP_145284646.1|2946772_2947339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284649.1|2947488_2947938_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145284652.1|2947927_2948347_+	hypothetical protein	NA	A0A2I7RFE0	Vibrio_phage	25.4	4.5e-05
WP_145284655.1|2949754_2950231_+	hypothetical protein	NA	A0A0K2D0E0	Bacillus_phage	33.6	2.0e-09
WP_145284658.1|2950227_2952831_+	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	26.5	3.8e-25
WP_145292066.1|2953473_2953968_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_145284379.1|2954033_2955164_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	2970462	3137358	6618662	integrase,transposase	Acanthocystis_turfacea_Chlorella_virus(10.53%)	117	3035644:3035659	3059553:3059578
WP_145284683.1|2970462_2972010_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145284686.1|2972410_2973337_+	universal stress protein	NA	NA	NA	NA	NA
WP_145284689.1|2973469_2974402_+	universal stress protein	NA	NA	NA	NA	NA
WP_145284692.1|2974469_2977247_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.8	1.7e-76
WP_145292067.1|2977215_2977317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284695.1|2977591_2978737_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	40.9	1.7e-54
WP_145284698.1|2979326_2979560_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_145284701.1|2979556_2981293_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_145284705.1|2981347_2982985_-	fucose isomerase	NA	NA	NA	NA	NA
WP_145292068.1|2983252_2984740_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145284708.1|2985340_2985565_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284710.1|2985676_2985781_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284713.1|2987563_2990035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284718.1|2990467_2990914_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	41.2	3.1e-20
WP_145284721.1|2990991_2994309_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	23.2	7.2e-61
WP_145284724.1|2994393_2995608_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145284727.1|2995699_2996197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292069.1|2996250_2997024_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_145284730.1|2997171_2998098_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_145284733.1|2998152_2999133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284735.1|2999857_3000802_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_145284738.1|3002002_3002671_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145284741.1|3003865_3006142_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145284744.1|3006262_3007669_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145284748.1|3008211_3009264_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_145284751.1|3010097_3010385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284754.1|3010693_3010993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284757.1|3011329_3011665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284760.1|3011700_3012636_+|transposase	IS3 family transposase	transposase	Q5GQZ1	Simian_immunodeficiency_virus	28.3	3.5e-05
WP_145284763.1|3012809_3013235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284768.1|3014563_3018961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284771.1|3019781_3020471_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145282628.1|3020341_3020821_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145284774.1|3020983_3021850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292070.1|3022432_3023137_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.5	1.2e-18
WP_145284777.1|3023271_3024462_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145284780.1|3024565_3025696_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284783.1|3027105_3028758_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	33.6	1.6e-37
WP_145292071.1|3028828_3030064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284786.1|3030538_3031702_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_145284789.1|3031910_3032915_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	28.3	6.3e-45
3035644:3035659	attL	TCTGCATCAGCAGCGG	NA	NA	NA	NA
WP_145284792.1|3037089_3037314_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3035644:3035659	attL	TCTGCATCAGCAGCGG	NA	NA	NA	NA
WP_145284795.1|3037371_3038115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284799.1|3038353_3038725_+|transposase	transposase	transposase	NA	NA	NA	NA
3038459:3038474	attR	CCGCTGCTGATGCAGA	NA	NA	NA	NA
WP_145284802.1|3039634_3040279_-	hypothetical protein	NA	NA	NA	NA	NA
3038459:3038474	attR	CCGCTGCTGATGCAGA	NA	NA	NA	NA
WP_145284805.1|3040569_3040803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284808.1|3040792_3041488_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_145284812.1|3041506_3042154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284815.1|3042044_3043070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284818.1|3043182_3043401_-	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_145284821.1|3043596_3043851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292072.1|3043908_3044142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284824.1|3044150_3045107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284828.1|3045166_3045589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284831.1|3045615_3047109_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.3	9.1e-48
WP_145284836.1|3047154_3047364_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145284839.1|3047360_3047729_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145284843.1|3047725_3048241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292073.1|3049038_3049821_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_145284847.1|3050194_3051235_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_145284850.1|3051861_3052680_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145284855.1|3052832_3053144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145284858.1|3053711_3054761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284862.1|3054992_3055841_+	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
WP_145284865.1|3056163_3056502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284868.1|3056814_3057867_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_145292074.1|3058033_3058840_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145284871.1|3059087_3059249_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145284874.1|3060015_3060846_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145284877.1|3060845_3061370_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145284882.1|3061519_3062071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284885.1|3062501_3063455_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	7.9e-29
WP_145284889.1|3063628_3064528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284893.1|3064591_3065008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284896.1|3065178_3066132_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	39.7	5.2e-57
WP_145284899.1|3066132_3070857_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284902.1|3071071_3073009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284905.1|3073413_3076458_-	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	26.2	1.3e-21
WP_145284909.1|3076648_3078130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284912.1|3078126_3078663_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145284917.1|3079381_3080428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292075.1|3080504_3081596_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145284921.1|3081701_3082400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284923.1|3082662_3084636_+	endoglucanase A	NA	NA	NA	NA	NA
WP_145284927.1|3084788_3086135_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145284931.1|3086199_3088398_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_145284934.1|3089015_3090989_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.2	4.3e-29
WP_145292076.1|3091069_3092014_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_145284939.1|3092059_3092617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284943.1|3092680_3095347_-	DUF2309 family protein	NA	NA	NA	NA	NA
WP_145284947.1|3095391_3096981_-	oxidoreductase	NA	NA	NA	NA	NA
WP_145284951.1|3097193_3097622_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145284954.1|3099192_3099378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284957.1|3099468_3103461_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145284961.1|3103648_3105304_-	protein kinase	NA	A0A1E1EXG0	Acanthamoeba_castellanii_mimivirus	31.9	1.1e-20
WP_145284964.1|3105293_3106271_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145284967.1|3106447_3107938_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	45.6	1.0e-43
WP_145284971.1|3108219_3109350_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145284974.1|3109638_3110202_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_145284978.1|3111198_3112446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284983.1|3112637_3112976_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_145284988.1|3112969_3113320_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.2	4.0e-15
WP_145284991.1|3113363_3115037_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	32.9	3.8e-71
WP_145284994.1|3115029_3115323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145284998.1|3116142_3117246_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	39.7	6.1e-57
WP_145285002.1|3117244_3118120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285005.1|3119560_3120463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285008.1|3121144_3121567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285011.1|3123066_3124647_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145292077.1|3124693_3126082_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145285014.1|3126228_3127623_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145292078.1|3127657_3129889_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_145285018.1|3129938_3132812_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145292079.1|3132865_3134389_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145285022.1|3134502_3136059_-	iron dicitrate transport regulator FecR	NA	A0A0P0YMD2	Yellowstone_lake_phycodnavirus	29.9	5.3e-06
WP_145285025.1|3136055_3136589_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145285028.1|3136803_3137358_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	3316379	3388376	6618662	integrase,protease,transposase	Acinetobacter_phage(33.33%)	50	3345474:3345493	3398689:3398708
WP_145285434.1|3316379_3317105_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_145285437.1|3318290_3318614_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_145292089.1|3318689_3320090_+	permease	NA	NA	NA	NA	NA
WP_145285441.1|3320102_3320339_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_145285445.1|3320416_3320881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285448.1|3320921_3321407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285451.1|3321399_3322077_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_145285454.1|3322106_3323525_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_145285457.1|3323973_3324396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285460.1|3324507_3325728_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145285464.1|3325812_3326508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285469.1|3326625_3328029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285472.1|3328277_3329291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145285477.1|3329569_3331012_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145285480.1|3331017_3333561_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145285483.1|3334060_3335200_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145285486.1|3335839_3336943_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145285489.1|3337377_3337713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285492.1|3337956_3338712_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285495.1|3338967_3340443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285499.1|3341067_3342501_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145285503.1|3342497_3342980_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_145285507.1|3343324_3345910_+	hypothetical protein	NA	NA	NA	NA	NA
3345474:3345493	attL	GCGAGCGCGACGGCCAGGCG	NA	NA	NA	NA
WP_145285511.1|3345906_3346830_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_145285514.1|3346986_3348015_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_145285518.1|3348058_3349048_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_145285522.1|3349044_3351159_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_145285526.1|3351190_3355120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285529.1|3355116_3357450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285532.1|3357478_3358546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292090.1|3359281_3360655_+	ArsB/NhaD family transporter	NA	NA	NA	NA	NA
WP_145285535.1|3360877_3361807_+	universal stress protein	NA	NA	NA	NA	NA
WP_145285540.1|3362413_3364729_+	DUF5060 domain-containing protein	NA	NA	NA	NA	NA
WP_145285543.1|3364900_3366217_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_145285546.1|3366562_3367174_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_145285549.1|3367443_3367908_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.5	7.8e-14
WP_145292091.1|3368092_3370222_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145285552.1|3370837_3372076_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.1	3.6e-58
WP_145285556.1|3372117_3373695_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	49.6	3.6e-135
WP_145285559.1|3373769_3376127_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145285564.1|3376178_3376400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285568.1|3376366_3377311_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145285572.1|3377990_3378179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285575.1|3378649_3379540_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285580.1|3379933_3380629_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_145285583.1|3381172_3383212_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145285586.1|3383208_3385755_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145285590.1|3386179_3387226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285593.1|3387464_3387860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292092.1|3388094_3388376_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3398689:3398708	attR	GCGAGCGCGACGGCCAGGCG	NA	NA	NA	NA
>prophage 6
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	3447701	3477593	6618662	transposase	Shigella_phage(66.67%)	21	NA	NA
WP_145292097.1|3447701_3447923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285714.1|3447940_3448798_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	3.9e-35
WP_145285718.1|3449597_3450422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285722.1|3450875_3451514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285725.1|3451596_3452697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285729.1|3452963_3453368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285732.1|3453764_3454694_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285735.1|3455710_3457078_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145285739.1|3457050_3458007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285744.1|3458356_3459265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285747.1|3459317_3460925_-	GMC family oxidoreductase	NA	A0A1V0S9J5	Catovirus	45.9	3.2e-06
WP_145285750.1|3461043_3461457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285753.1|3461486_3461699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285756.1|3463061_3469556_+	phosphotransferase	NA	NA	NA	NA	NA
WP_145285760.1|3469652_3470423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285764.1|3470450_3470732_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_145292098.1|3471035_3471299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285767.1|3471787_3472684_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_145285771.1|3472716_3473715_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	3.5e-35
WP_145285775.1|3473884_3475186_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145285779.1|3476345_3477593_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	3494194	3580201	6618662	integrase,protease,transposase	uncultured_Caudovirales_phage(25.0%)	55	3490649:3490668	3498047:3498066
3490649:3490668	attL	GTTTTCAGGCGCCGTTCACA	NA	NA	NA	NA
WP_145285831.1|3494194_3494968_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_145285835.1|3495175_3495634_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145285839.1|3496008_3496527_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_145285843.1|3496596_3497439_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285846.1|3497680_3497902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285849.1|3498151_3498604_-	ATP-binding protein	NA	NA	NA	NA	NA
3498047:3498066	attR	TGTGAACGGCGCCTGAAAAC	NA	NA	NA	NA
WP_145285853.1|3499472_3504260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292100.1|3503776_3505219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285856.1|3507926_3508475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285859.1|3509144_3509792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285862.1|3510297_3511017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285865.1|3512226_3515187_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_145285868.1|3516047_3516758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285871.1|3517261_3517534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285874.1|3517928_3518501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285878.1|3518962_3519457_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_145285881.1|3520152_3521058_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285886.1|3521841_3522459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285890.1|3522933_3524406_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_145285893.1|3524546_3525215_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285897.1|3525328_3526204_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145285900.1|3526203_3528201_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145285904.1|3528221_3528404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285907.1|3528437_3529628_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145285910.1|3529700_3530300_-	sulfotransferase	NA	NA	NA	NA	NA
WP_145285785.1|3531016_3531202_+	carbon storage regulator	NA	A0A2H4J8C6	uncultured_Caudovirales_phage	48.1	3.4e-05
WP_145285913.1|3531395_3531950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285916.1|3532182_3532749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285919.1|3533354_3542654_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.2	5.3e-29
WP_145285922.1|3542674_3546130_+	protein kinase	NA	G9BWE0	Planktothrix_phage	21.3	3.9e-09
WP_145285925.1|3546262_3548557_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_145285928.1|3549303_3549909_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145285933.1|3550207_3550594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285936.1|3550776_3556152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285939.1|3556148_3557096_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145285944.1|3557079_3559173_-	protein kinase	NA	A0A146JFA3	Tokyovirus	28.1	1.0e-20
WP_145285948.1|3559380_3561891_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145285951.1|3562499_3564176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285955.1|3565078_3565726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145285958.1|3565985_3566786_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145292101.1|3567037_3567106_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_145285961.1|3567659_3567893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285964.1|3567908_3568577_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_145285967.1|3568595_3569243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285971.1|3569133_3570159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145282364.1|3570278_3570497_-	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_145285974.1|3570669_3570924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292102.1|3570981_3571215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285977.1|3571223_3572180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285980.1|3573371_3574013_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285984.1|3573897_3574812_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285988.1|3574928_3575288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285992.1|3575978_3576473_-	DUF1877 family protein	NA	NA	NA	NA	NA
WP_145285996.1|3577209_3578802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284379.1|3579070_3580201_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	3587595	3659533	6618662	transposase	Klosneuvirus(12.5%)	49	NA	NA
WP_145286015.1|3587595_3588567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145284379.1|3588991_3590122_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145286020.1|3590429_3591041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286023.1|3591672_3593958_-	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_145286026.1|3594613_3595588_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145286030.1|3596924_3597359_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145286033.1|3597456_3597702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286037.1|3597816_3600534_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145286041.1|3601315_3605689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286045.1|3606403_3607030_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_145286049.1|3607022_3608219_-	XdhC family protein	NA	NA	NA	NA	NA
WP_145286053.1|3608215_3610489_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145286056.1|3610485_3610962_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_145286060.1|3611021_3611651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286063.1|3612365_3613973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286066.1|3614293_3616327_-	primary-amine oxidase	NA	A0A1V0SK86	Klosneuvirus	29.9	6.5e-73
WP_145286071.1|3616492_3616906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286074.1|3617110_3618598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286079.1|3618648_3619596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286082.1|3620366_3620879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286085.1|3620872_3622954_-	PEP-CTERM sorting domain-containing protein	NA	S5WIY5	Leptospira_phage	28.4	1.5e-27
WP_145286088.1|3623407_3623908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286091.1|3624013_3624664_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145286095.1|3624533_3628880_+	protein kinase	NA	S4VV57	Pandoravirus	34.7	2.3e-11
WP_145286098.1|3629518_3630559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286102.1|3632102_3633269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283328.1|3633319_3633562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286105.1|3633782_3635297_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.6	1.7e-46
WP_145286109.1|3635342_3635552_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145286113.1|3635548_3635917_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145286117.1|3636271_3636475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286121.1|3636452_3638033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286126.1|3637963_3638752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286130.1|3639520_3640180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286134.1|3640730_3644408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286138.1|3644845_3646006_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_145286141.1|3646124_3647864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286144.1|3647924_3648212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286149.1|3648211_3649318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286152.1|3649868_3650348_+	hypothetical protein	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.7	3.0e-05
WP_145286156.1|3650665_3651145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286159.1|3651141_3652440_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.6	2.7e-104
WP_145292103.1|3652776_3654255_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145286163.1|3654688_3655522_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145286167.1|3655554_3656574_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.2	2.1e-24
WP_145286170.1|3656651_3657002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145286175.1|3656958_3657540_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145284994.1|3657573_3657867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284991.1|3657859_3659533_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	32.9	3.8e-71
>prophage 9
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	3771209	3864865	6618662	transposase	Enterobacteria_phage(28.57%)	78	NA	NA
WP_145286402.1|3771209_3772163_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.3	1.6e-58
WP_145286405.1|3772128_3772569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286409.1|3772646_3773069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145280780.1|3773535_3773982_-|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	40.4	7.7e-19
WP_145292111.1|3774370_3775333_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145286414.1|3775370_3775820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286417.1|3776289_3777537_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_145286420.1|3777521_3779120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286423.1|3779706_3780129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286427.1|3780118_3781165_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145286430.1|3782136_3782826_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145286434.1|3782961_3784071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286437.1|3784829_3785471_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145286440.1|3785534_3785981_-|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	40.4	7.7e-19
WP_145286444.1|3786266_3786548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286448.1|3788449_3788683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286451.1|3788672_3789368_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_145286455.1|3789386_3790031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286458.1|3789924_3790947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145284818.1|3791066_3791285_-	molybdopterin converting factor	NA	NA	NA	NA	NA
WP_145286461.1|3791398_3791650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292112.1|3791768_3792002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286464.1|3792010_3792967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286466.1|3793026_3793449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286469.1|3793475_3794981_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	33.2	6.4e-49
WP_145286472.1|3795026_3795236_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145286475.1|3795232_3795601_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145286478.1|3795597_3796113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286481.1|3796755_3796887_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145286484.1|3796823_3798200_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.8	6.1e-06
WP_145286487.1|3798217_3798772_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145286490.1|3798560_3799658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145286493.1|3799775_3800294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286496.1|3800290_3800860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286402.1|3801028_3801982_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.3	1.6e-58
WP_145286499.1|3802332_3803463_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145292113.1|3804374_3805175_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145286502.1|3805171_3805867_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145286506.1|3806439_3807540_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_145286509.1|3807896_3809465_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145286513.1|3809479_3810565_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145286516.1|3810758_3812432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286519.1|3812609_3813317_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145286522.1|3813384_3816141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145286526.1|3816224_3817466_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145286529.1|3817837_3818350_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145286532.1|3818346_3820026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286535.1|3820077_3822333_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_145286538.1|3822329_3823856_+	sulfatase-like hydrolase/transferase	NA	W6LM83	Streptococcus_phage	25.6	6.1e-07
WP_145286541.1|3824013_3824478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286544.1|3824505_3825480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286548.1|3825960_3826185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145285070.1|3827103_3827400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286551.1|3827714_3827909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286554.1|3827905_3829030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286558.1|3829909_3830161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286561.1|3830241_3830994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286564.1|3831333_3831729_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_145286567.1|3831805_3832882_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145286570.1|3833876_3835859_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145286574.1|3836028_3836250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145292114.1|3836531_3837875_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145286579.1|3837933_3839142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286584.1|3839479_3842794_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145286587.1|3842796_3844257_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145286591.1|3844990_3846730_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_145286595.1|3846732_3847323_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145286598.1|3847734_3848904_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145286602.1|3849160_3850216_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145286605.1|3850298_3850697_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_145286608.1|3850842_3855297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286611.1|3855405_3856173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145286614.1|3856186_3858001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292115.1|3858181_3859723_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_145286618.1|3859842_3861786_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_145286621.1|3861739_3862918_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145286624.1|3863393_3863651_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_145286627.1|3863686_3864865_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	4354689	4413376	6618662	tRNA,protease,transposase	Wolbachia_phage(22.22%)	56	NA	NA
WP_145287707.1|4354689_4355349_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	40.0	7.6e-23
WP_145284889.1|4355590_4356490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145283687.1|4357066_4358020_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	7.9e-29
WP_145287710.1|4359143_4360097_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.6	6.0e-29
WP_145287714.1|4360379_4361411_+	fatty acid desaturase	NA	A6N231	Microbacterium_phage	23.5	6.6e-05
WP_145287717.1|4361400_4361604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287720.1|4361781_4362111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287723.1|4362410_4363610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287726.1|4363661_4365275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292136.1|4365296_4366382_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145287729.1|4366510_4367251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287732.1|4367388_4369548_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_145292137.1|4369700_4371152_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145287734.1|4371158_4371542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287737.1|4372223_4373306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287740.1|4373354_4374602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287743.1|4374816_4375854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287746.1|4376105_4376726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287749.1|4376722_4377136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287752.1|4377132_4378158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287757.1|4378404_4379175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287760.1|4379153_4379594_-	DUF2231 domain-containing protein	NA	NA	NA	NA	NA
WP_145287763.1|4379644_4380109_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_145287765.1|4380506_4381376_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.3	2.5e-66
WP_145287768.1|4381423_4381960_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_145287771.1|4382001_4382277_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_145287774.1|4382554_4384828_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.9	5.1e-127
WP_145287776.1|4384964_4386077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287779.1|4386241_4387201_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145287782.1|4387265_4387607_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_145287785.1|4387599_4388697_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_145287788.1|4388721_4389231_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_145287791.1|4389386_4390265_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_145287794.1|4390450_4391368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287797.1|4391412_4391973_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_145287801.1|4392385_4392925_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_145287807.1|4393015_4394362_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	24.6	1.0e-26
WP_145287810.1|4394381_4394804_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_145287813.1|4394812_4395742_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_145292138.1|4395775_4397137_-	PDZ domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	28.7	4.8e-11
WP_145287815.1|4397472_4397943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287818.1|4398139_4399864_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A1X7QHJ5	Faustovirus	29.9	5.4e-20
WP_145287821.1|4400113_4400797_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_145292139.1|4400872_4401334_-	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_145287823.1|4401402_4402116_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_145287826.1|4402273_4402801_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_145287829.1|4402849_4403848_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_145287832.1|4403947_4404436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287835.1|4404556_4405123_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_145287838.1|4405264_4406902_-	adenine deaminase	NA	NA	NA	NA	NA
WP_145287841.1|4407306_4408818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145287844.1|4408921_4409347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145287847.1|4409371_4410340_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_145287850.1|4410327_4411716_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_145287854.1|4411601_4412408_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_145287857.1|4412407_4413376_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	4738534	4746899	6618662		Bacillus_virus(33.33%)	9	NA	NA
WP_145288625.1|4738534_4740043_-	protein kinase	NA	M1HJV9	Paramecium_bursaria_Chlorella_virus	32.0	1.2e-15
WP_145288629.1|4740045_4740324_+	DUF3470 domain-containing protein	NA	NA	NA	NA	NA
WP_145288632.1|4740639_4741074_+	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_145288635.1|4741066_4742200_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	37.0	2.7e-44
WP_145288639.1|4742333_4743809_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.8	2.7e-100
WP_145288643.1|4743933_4744638_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	35.0	7.3e-32
WP_145288646.1|4744896_4745493_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.0	7.4e-25
WP_145288649.1|4745802_4746339_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_145288653.1|4746344_4746899_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	39.4	9.5e-35
>prophage 12
NZ_CP036291	Planctomycetes bacterium Pla175 chromosome, complete genome	6618662	4930491	4977806	6618662	integrase,transposase	Vibrio_phage(33.33%)	29	4920505:4920548	4974577:4974620
4920505:4920548	attL	TGGGCACGACAGAACTCGAATCTGTGACCTCTTGCATGTCAAGC	NA	NA	NA	NA
WP_145289034.1|4930491_4931157_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145289038.1|4932475_4933387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145289051.1|4936168_4936420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145289055.1|4936734_4937307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289060.1|4938863_4941548_-	sodium/solute symporter	NA	NA	NA	NA	NA
WP_145289063.1|4941572_4942472_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_145292172.1|4942572_4943340_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_145292174.1|4943423_4944602_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_145289066.1|4944690_4945857_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145289071.1|4946033_4947566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289074.1|4947593_4951931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145292176.1|4951998_4953045_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145289077.1|4953104_4953542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289080.1|4953596_4954631_+	dihydrodipicolinate synthetase	NA	NA	NA	NA	NA
WP_145289083.1|4956207_4956666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289086.1|4957938_4959078_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145289090.1|4959271_4961086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289093.1|4961213_4962167_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	40.1	1.1e-57
WP_145292179.1|4962224_4962401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145289096.1|4963958_4964993_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_145289099.1|4965480_4967472_+	mucoidy inhibitor MuiA family protein	NA	NA	NA	NA	NA
WP_145289102.1|4967950_4968928_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_145289105.1|4969638_4971402_-	DNA polymerase I	NA	A0A2D1G5Z3	Mycobacterium_phage	26.0	4.4e-09
WP_145289109.1|4972297_4972522_-	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_145289114.1|4973361_4974468_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145289117.1|4974872_4975091_+	hypothetical protein	NA	NA	NA	NA	NA
4974577:4974620	attR	TGGGCACGACAGAACTCGAATCTGTGACCTCTTGCATGTCAAGC	NA	NA	NA	NA
WP_145289121.1|4975505_4976570_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145292097.1|4976709_4976931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145285714.1|4976948_4977806_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	3.9e-35
