The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	498271	581419	7613473	transposase,protease	Enterobacteria_phage(22.22%)	60	NA	NA
WP_145254028.1|498271_498970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145254031.1|499762_500704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254034.1|500739_502251_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145254037.1|502816_503506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254040.1|504251_504560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254043.1|504564_505092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254046.1|506008_507214_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_145254049.1|507713_508562_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_145254052.1|508558_508993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254055.1|509042_510437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254058.1|510527_510737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254061.1|510903_511533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254064.1|511777_512080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254067.1|512090_513035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254069.1|513122_514607_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.6	3.3e-50
WP_145254072.1|514653_514851_-	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_145254075.1|514847_515216_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_145254077.1|515672_519089_+	type I restriction-modification system endonuclease	NA	A0A0E3JQF5	Streptomyces_phage	28.8	3.4e-05
WP_145254081.1|519138_520572_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_145254084.1|520568_522530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254088.1|522589_524572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254091.1|524757_527190_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145254099.1|527190_529872_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_145254102.1|530271_530835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145263544.1|530782_532273_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145254105.1|532269_533040_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	39.1	2.0e-38
WP_145254107.1|533238_533859_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145253726.1|534041_535145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145263546.1|536269_536617_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_145254110.1|536663_537386_-	hypothetical protein	NA	Q56AR7	Bacillus_thuringiensis_phage	28.9	2.9e-07
WP_145254113.1|538523_539963_+	TolC family protein	NA	NA	NA	NA	NA
WP_145263549.1|539971_541372_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145254116.1|541382_544808_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.8	2.4e-51
WP_145254121.1|545854_546283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254124.1|546540_547635_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145254127.1|547703_549104_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145254130.1|549380_550160_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_145254133.1|550156_550549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145263551.1|550560_551040_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145254136.1|551114_551792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254139.1|551849_552182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254142.1|552251_552599_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_145254145.1|552654_552984_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145254147.1|552955_553216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254150.1|553328_553841_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145254153.1|553837_554083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254156.1|554196_554547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254158.1|554675_555446_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	39.1	4.4e-38
WP_145263553.1|555442_556933_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145254161.1|557415_558348_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_145263555.1|558344_558947_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_145254164.1|559259_559814_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_145254167.1|559810_560749_+	DUF1016 family protein	NA	Q9JMM6	Wolbachia_phage	40.1	2.8e-39
WP_145254169.1|561518_574169_+	fibro-slime domain-containing protein	NA	NA	NA	NA	NA
WP_145254172.1|574229_575306_+	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_145254175.1|575685_576039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145254178.1|576041_576434_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	1.0e-11
WP_145254181.1|576792_578481_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.7	2.5e-54
WP_145254184.1|578999_580400_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145254187.1|580141_581419_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	934438	1033423	7613473	tRNA,integrase,transposase,protease	Leptospira_phage(23.08%)	68	987821:987844	1027847:1027874
WP_145254871.1|934438_935683_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145254874.1|935863_936547_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145254877.1|936756_937173_+	globin	NA	NA	NA	NA	NA
WP_145254880.1|937723_938818_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_145254882.1|939222_940563_+	AAA family ATPase	NA	A0A2I7SAD7	Vibrio_phage	32.0	1.0e-50
WP_145254885.1|941139_942438_-	DUF1015 family protein	NA	NA	NA	NA	NA
WP_145254888.1|942603_943329_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_145254891.1|943361_944258_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_145254894.1|944312_944966_-	CvpA family protein	NA	NA	NA	NA	NA
WP_145254897.1|944988_946686_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_145254899.1|946771_947947_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_145254902.1|947976_948747_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_145254904.1|949251_949689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254907.1|950880_952638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254909.1|952807_954916_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_145254912.1|955196_956198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254915.1|956328_957048_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_145254918.1|957509_958787_+	DUF2088 domain-containing protein	NA	NA	NA	NA	NA
WP_145263595.1|958793_959168_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	G1D028	Mycobacterium_virus	51.6	1.1e-26
WP_145254921.1|959388_960819_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.9	2.8e-54
WP_145254923.1|960901_961072_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_145254926.1|961122_961887_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145254929.1|961920_964221_-	protein kinase	NA	M1PWP3	Moumouvirus	28.3	4.6e-14
WP_145254932.1|964403_966668_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_145254935.1|966761_969164_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_145254938.1|969127_971350_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_145254941.1|971827_972094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254944.1|972135_972741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254947.1|972783_973515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254949.1|973655_975233_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145254951.1|975457_975847_-	RND transporter	NA	NA	NA	NA	NA
WP_145254954.1|975860_979076_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_145254957.1|979085_980732_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_145254960.1|980888_981323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254963.1|981597_984075_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_145254966.1|984650_984908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254969.1|984929_986657_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.5	5.8e-54
WP_145253735.1|987015_987408_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	3.6e-12
WP_145254972.1|987410_987764_-|transposase	transposase	transposase	NA	NA	NA	NA
987821:987844	attL	ACGCCACCGTTGCAACGCTCACGC	NA	NA	NA	NA
WP_145254975.1|988650_990534_+	PAS domain S-box protein	NA	NA	NA	NA	NA
987821:987844	attL	ACGCCACCGTTGCAACGCTCACGC	NA	NA	NA	NA
WP_145254978.1|990394_991723_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_145254981.1|991719_992874_+	response regulator	NA	NA	NA	NA	NA
WP_145254984.1|993257_993620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254987.1|993634_995284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254990.1|995745_997116_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145254993.1|998526_998988_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145254996.1|999823_1000273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145254999.1|1000172_1000796_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_145255002.1|1001132_1002560_-	hypothetical protein	NA	S5W9C6	Leptospira_phage	34.9	1.8e-08
WP_145255004.1|1003236_1003590_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145255007.1|1003592_1003988_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.8e-12
WP_145255010.1|1004346_1006032_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.8	2.8e-53
WP_145255013.1|1006053_1006743_-|transposase	transposase	transposase	NA	NA	NA	NA
1006077:1006100	attR	ACGCCACCGTTGCAACGCTCACGC	NA	NA	NA	NA
WP_145255016.1|1007325_1008372_+	hypothetical protein	NA	NA	NA	NA	NA
1006077:1006100	attR	ACGCCACCGTTGCAACGCTCACGC	NA	NA	NA	NA
WP_145255019.1|1008427_1009306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145255022.1|1009318_1011313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145263597.1|1011603_1013094_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145255025.1|1013090_1013861_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	38.7	5.7e-38
WP_145255028.1|1014429_1015188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145255031.1|1015398_1021218_-	protein kinase	NA	B5LWE2	Feldmannia_species_virus	27.7	9.1e-19
WP_145255034.1|1021234_1021882_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145255037.1|1023009_1023675_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_145255039.1|1024344_1024788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145255042.1|1024784_1025948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145255045.1|1026095_1026449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145255048.1|1026466_1027693_+|integrase	tyrosine-type recombinase/integrase	integrase	A8ATJ6	Listeria_phage	24.1	5.4e-06
WP_145263599.1|1028611_1030846_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145263601.1|1030897_1033423_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	1438647	1452672	7613473	transposase	Ralstonia_virus(25.0%)	13	NA	NA
WP_145254871.1|1438647_1439892_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145255869.1|1440174_1440831_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.8	1.5e-10
WP_145255872.1|1441234_1442479_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	30.4	1.0e-44
WP_145255875.1|1443534_1445262_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.8	2.3e-55
WP_145255878.1|1445620_1446013_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	8.0e-12
WP_145255881.1|1446015_1446369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145255884.1|1446434_1446737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145255887.1|1446733_1447504_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	41.9	9.8e-38
WP_145263649.1|1447567_1447753_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_145263652.1|1447864_1448272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145263655.1|1448597_1449944_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145255890.1|1450253_1450646_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	8.0e-12
WP_145255893.1|1451004_1452672_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.2	2.1e-53
>prophage 4
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	2395493	2469756	7613473	tRNA,integrase,transposase	Planktothrix_phage(22.22%)	55	2448247:2448267	2475981:2476001
WP_145257638.1|2395493_2396762_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_145257639.1|2396758_2397577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257640.1|2398295_2399378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257641.1|2399491_2400091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257642.1|2400409_2401642_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145257643.1|2401730_2403110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257644.1|2403503_2404319_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_145257645.1|2404562_2405624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257646.1|2406037_2406775_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	30.7	3.5e-08
WP_145254028.1|2406840_2407539_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145254025.1|2407535_2407979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145257647.1|2408319_2408745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257648.1|2408782_2409751_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145257649.1|2410081_2411551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145257650.1|2411553_2412111_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.6	9.6e-27
WP_145257651.1|2412081_2412588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257652.1|2412763_2413825_-	signal peptide peptidase SppA	NA	G8DH45	Emiliania_huxleyi_virus	25.5	4.1e-10
WP_145263797.1|2413852_2414332_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	NA	NA	NA	NA
WP_145257653.1|2414446_2416186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257654.1|2416294_2417317_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_145257655.1|2417313_2417499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257656.1|2419154_2420264_-	DUF763 domain-containing protein	NA	NA	NA	NA	NA
WP_145257657.1|2420793_2423994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257658.1|2425146_2425722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257659.1|2425743_2426973_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_145257660.1|2427607_2427979_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145257661.1|2428396_2431798_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.8	3.1e-19
WP_145257662.1|2432089_2434465_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145257663.1|2434590_2434881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257664.1|2435304_2436582_+	response regulator	NA	W8CYM9	Bacillus_phage	40.3	2.5e-14
WP_145257665.1|2436613_2437102_+	response regulator	NA	NA	NA	NA	NA
WP_145257666.1|2437305_2438577_-	radical SAM protein	NA	NA	NA	NA	NA
WP_145257667.1|2438688_2439765_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	1.2e-14
WP_145257668.1|2439761_2440787_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.1	9.7e-17
WP_145257669.1|2440842_2441646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257670.1|2441657_2442998_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_145257671.1|2442997_2443930_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_145257672.1|2443956_2446056_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_145257673.1|2446401_2448159_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	35.2	1.6e-80
2448247:2448267	attL	CCCCCTTGGACAAGGGGGAGC	NA	NA	NA	NA
WP_145257674.1|2449168_2450371_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145257675.1|2450373_2450817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145257676.1|2452151_2453207_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_145257677.1|2453269_2453863_+	type I-MYXAN CRISPR-associated protein Cas6/Cmx6	NA	NA	NA	NA	NA
WP_145257678.1|2453921_2456231_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_145257679.1|2456231_2457935_+	type I-MYXAN CRISPR-associated protein Cmx8	NA	NA	NA	NA	NA
WP_145257680.1|2457931_2458852_+	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_145257681.1|2458833_2459580_+	type I-MYXAN CRISPR-associated protein Cas5/Cmx5/DevS	NA	NA	NA	NA	NA
WP_145257682.1|2459640_2461302_+	type I-MYXAN CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_145257683.1|2461325_2461625_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_145257684.1|2464506_2465115_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145263800.1|2465252_2466743_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145257685.1|2466739_2467510_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	38.7	7.5e-38
WP_145257686.1|2467994_2468201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257687.1|2468204_2469269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257688.1|2469402_2469756_+|transposase	transposase	transposase	NA	NA	NA	NA
2475981:2476001	attR	GCTCCCCCTTGTCCAAGGGGG	NA	NA	NA	NA
>prophage 5
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	2776909	2818188	7613473	transposase	Ralstonia_virus(28.57%)	26	NA	NA
WP_145257923.1|2776909_2778070_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145257924.1|2778570_2779815_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	1.6e-42
WP_145257925.1|2780573_2781557_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145257926.1|2781318_2781783_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.5e-12
WP_145257927.1|2781785_2782139_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145257928.1|2783063_2785220_-	phosphatase PAP2 family protein	NA	A0A1V0SKZ4	Klosneuvirus	31.5	4.2e-46
WP_145257929.1|2785885_2787175_+	MFS transporter	NA	NA	NA	NA	NA
WP_145257930.1|2787158_2788592_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145263841.1|2788616_2790026_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145257931.1|2790387_2791164_+	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_145257932.1|2791222_2791618_-	YciI family protein	NA	NA	NA	NA	NA
WP_145257933.1|2791789_2792005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257934.1|2792105_2792996_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	31.7	5.8e-18
WP_145257935.1|2793478_2795284_+	aspartate kinase	NA	NA	NA	NA	NA
WP_145257936.1|2795362_2796808_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145257937.1|2796829_2797318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257938.1|2797436_2798642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145257939.1|2798714_2799740_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_145257940.1|2800356_2800887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257941.1|2800945_2801551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257942.1|2802469_2810149_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_145257943.1|2810506_2811136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145257944.1|2814339_2815584_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.6	7.3e-43
WP_145257927.1|2816057_2816411_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145257945.1|2816413_2816806_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	31.2	1.8e-11
WP_145257946.1|2817141_2818188_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	28.8	1.3e-11
>prophage 6
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	3068839	3150079	7613473	tRNA,transposase,plate	Feldmannia_irregularis_virus(20.0%)	52	NA	NA
WP_145258096.1|3068839_3069988_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_145258097.1|3070029_3071784_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_145258098.1|3071780_3072392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258099.1|3072507_3072975_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_145258100.1|3073564_3075889_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
WP_145258101.1|3076480_3076948_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_145258102.1|3077284_3078760_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_145258103.1|3078763_3079297_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_145258104.1|3079559_3080789_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_145258105.1|3081063_3085857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258106.1|3085808_3087593_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_145258107.1|3087585_3088431_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_145258108.1|3088430_3089984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258109.1|3090067_3094933_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_145258110.1|3095004_3095826_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145258111.1|3095854_3096286_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_145258112.1|3096291_3096633_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_145258113.1|3096796_3097816_-	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_145258114.1|3098010_3098823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258115.1|3098618_3099905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258116.1|3099947_3100967_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_145258117.1|3101500_3102586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258118.1|3102585_3103278_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_145258119.1|3103277_3104375_+	putative sugar O-methyltransferase	NA	NA	NA	NA	NA
WP_145258120.1|3104546_3105356_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_145263867.1|3105390_3106587_+	N-acetyl sugar amidotransferase	NA	NA	NA	NA	NA
WP_145258121.1|3106546_3107659_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145258122.1|3107665_3109243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258123.1|3109243_3114487_+	glycosyltransferase	NA	Q6XM29	Feldmannia_irregularis_virus	31.5	5.9e-17
WP_145258124.1|3114874_3116221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258125.1|3116287_3118141_+	family 3 adenylate cyclase	NA	NA	NA	NA	NA
WP_145258126.1|3118188_3122238_-	protein kinase	NA	A0A142CJL8	Brazilian_marseillevirus	28.7	1.2e-17
WP_145258127.1|3122901_3125235_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_145258128.1|3125401_3126142_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_145258129.1|3126232_3127489_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_145258130.1|3127728_3128307_-	DUF2203 family protein	NA	NA	NA	NA	NA
WP_145258131.1|3128744_3129851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258132.1|3130424_3130976_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145258133.1|3131096_3132002_-	sugar kinase	NA	NA	NA	NA	NA
WP_145258134.1|3132259_3134314_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_145258135.1|3134318_3135152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145263870.1|3135514_3136588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258136.1|3137311_3137503_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_145258137.1|3138231_3138951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258138.1|3139046_3139550_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_145258139.1|3139780_3141376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258140.1|3141730_3144526_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	51.5	5.9e-258
WP_145258141.1|3144764_3145613_+	glycerophosphodiester phosphodiesterase	NA	F8J173	Lactobacillus_virus	26.7	5.8e-15
WP_145258142.1|3145963_3146641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145258143.1|3147005_3147410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258144.1|3147656_3148799_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145257603.1|3148834_3150079_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	6.2e-42
>prophage 7
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	3284333	3331408	7613473	integrase,transposase	uncultured_virus(50.0%)	41	3271280:3271295	3352365:3352386
3271280:3271295	attL	TTCGCCAGTGGCAAGG	NA	NA	NA	NA
WP_145258230.1|3284333_3285062_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3282455:3282476	attL	TACATGTCGCCCGAGCAGGCCG	NA	NA	NA	NA
WP_145258230.1|3284333_3285062_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145258231.1|3285109_3286150_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
3285568:3285583	attR	CCTTGCCACTGGCGAA	NA	NA	NA	NA
WP_145258232.1|3286100_3287345_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.6	5.6e-43
3285568:3285583	attR	CCTTGCCACTGGCGAA	NA	NA	NA	NA
WP_145263897.1|3287668_3287857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258233.1|3287861_3288383_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145258234.1|3289018_3289483_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	44.0	4.0e-10
WP_145258235.1|3289426_3289780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145258236.1|3289782_3290175_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145258237.1|3290533_3292240_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.2	1.3e-53
WP_145258238.1|3293378_3295064_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.9	3.3e-54
WP_145258239.1|3295422_3295815_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	3.6e-12
WP_145258235.1|3295817_3296171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145258240.1|3296331_3296607_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_145258241.1|3297734_3299228_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_145258242.1|3299550_3300900_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_145258243.1|3300896_3302351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258244.1|3302334_3302928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258245.1|3302946_3303534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258246.1|3304087_3306460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145263655.1|3306805_3308152_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145258247.1|3309893_3311156_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_145258248.1|3311514_3311802_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	52.1	5.5e-18
WP_145258249.1|3311853_3313473_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.4	3.5e-162
WP_145258250.1|3313432_3314470_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_145258251.1|3314526_3315024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258252.1|3315106_3316813_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.4	4.4e-54
WP_145258236.1|3317171_3317564_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145258235.1|3317566_3317920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145258253.1|3317783_3318224_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145258254.1|3318718_3319855_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145258255.1|3319791_3320742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258256.1|3321028_3321799_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	41.9	2.0e-38
WP_145263901.1|3321795_3323286_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145258257.1|3323372_3323969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258258.1|3323951_3324686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258259.1|3324682_3325414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145258260.1|3325470_3326184_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_145254871.1|3327403_3328648_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145258261.1|3328749_3329649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258262.1|3329877_3330162_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145258263.1|3330178_3331408_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3352365:3352386	attR	TACATGTCGCCCGAGCAGGCCG	NA	NA	NA	NA
>prophage 8
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	3918037	3942245	7613473	terminase,integrase,portal,capsid	Erysipelothrix_phage(28.57%)	35	3918205:3918219	3925675:3925689
WP_145258652.1|3918037_3918940_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3918205:3918219	attL	GATGCTCGATCGCGG	NA	NA	NA	NA
WP_145258654.1|3919327_3919774_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_145258656.1|3920154_3921198_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145258658.1|3921272_3921596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258660.1|3921600_3922122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145263986.1|3922162_3922357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258662.1|3922586_3923228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258664.1|3923264_3923603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258666.1|3923599_3923845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258668.1|3923848_3924175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258670.1|3924176_3925214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258673.1|3925462_3925720_+	hypothetical protein	NA	NA	NA	NA	NA
3925675:3925689	attR	GATGCTCGATCGCGG	NA	NA	NA	NA
WP_145258675.1|3925723_3926194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258677.1|3926186_3926537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258679.1|3926568_3927060_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_145258681.1|3927182_3927557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258683.1|3927567_3928359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258685.1|3928417_3928786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258687.1|3928869_3929940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258689.1|3929993_3930395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258691.1|3930405_3930738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258693.1|3930734_3931475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258695.1|3931490_3931754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258697.1|3931754_3933155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258698.1|3933253_3933484_+	hypothetical protein	NA	I3WVV4	Acinetobacter_phage	62.1	3.6e-12
WP_145258700.1|3933543_3933876_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	37.3	1.8e-09
WP_145258702.1|3933880_3934303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258704.1|3934299_3935052_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	48.9	1.1e-62
WP_145258706.1|3934958_3935516_+|terminase	phage terminase small subunit P27 family	terminase	I2E8V0	Clostridium_phage	30.8	6.1e-05
WP_145258708.1|3935531_3937175_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	46.3	1.7e-127
WP_145258710.1|3937171_3938893_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	39.9	6.7e-79
WP_145258712.1|3938944_3939838_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	33.9	4.1e-27
WP_145258714.1|3939850_3940081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258716.1|3940077_3940368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145258718.1|3940880_3942245_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
>prophage 9
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	4211633	4233590	7613473	transposase	uncultured_virus(33.33%)	15	NA	NA
WP_145259094.1|4211633_4213319_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	5.1e-55
WP_145259096.1|4213680_4214073_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	4.7e-12
WP_145259098.1|4214075_4214429_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259100.1|4214494_4214878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259102.1|4215401_4215992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145254871.1|4216835_4218080_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145259104.1|4218473_4218827_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259106.1|4218829_4219225_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.8e-12
WP_145259108.1|4219583_4221308_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	8.9e-55
WP_145259110.1|4221370_4221817_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_145259112.1|4221761_4222094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259114.1|4222913_4230797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259116.1|4230883_4231378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259118.1|4231332_4232103_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	38.7	1.3e-37
WP_145259120.1|4232099_4233590_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	4594136	4690192	7613473	tRNA,transposase,tail,protease	Leptospira_phage(22.73%)	74	NA	NA
WP_145259580.1|4594136_4596110_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_145259582.1|4596327_4596930_-	LemA family protein	NA	NA	NA	NA	NA
WP_145259584.1|4597651_4598158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259586.1|4598516_4598909_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145259588.1|4598911_4599265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259590.1|4600366_4600609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259592.1|4600696_4602520_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	25.8	3.8e-24
WP_145259594.1|4602933_4604199_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_145259595.1|4604400_4605003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259597.1|4605628_4605820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259599.1|4605887_4607132_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.8e-42
WP_145259601.1|4607903_4608281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259603.1|4608349_4609027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259604.1|4609355_4610297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259606.1|4610306_4611092_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_145259608.1|4611301_4612810_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.5	1.1e-37
WP_145259610.1|4612861_4614310_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_145259612.1|4614306_4615443_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_145259614.1|4616108_4616300_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259615.1|4616365_4618093_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	8.9e-55
WP_145259618.1|4618451_4618844_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	4.7e-12
WP_145259620.1|4618846_4619200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259622.1|4619344_4619629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254871.1|4620038_4621283_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145259624.1|4621506_4623174_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.2	9.5e-54
WP_145255890.1|4623532_4623925_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	8.0e-12
WP_145259626.1|4623927_4624281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259628.1|4624355_4631192_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_145259630.1|4631672_4632776_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_145259633.1|4632787_4634032_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.6	9.6e-43
WP_145259635.1|4634355_4634508_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_145259637.1|4634775_4635129_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259639.1|4635131_4635524_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145259641.1|4635947_4636301_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259643.1|4636303_4636696_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.9	4.2e-13
WP_145259645.1|4637055_4637736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259646.1|4637633_4638014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259648.1|4638062_4638659_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	36.9	3.7e-24
WP_145259650.1|4638690_4640043_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.8	2.4e-55
WP_145259652.1|4640936_4641119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259654.1|4641339_4642071_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_145259656.1|4642199_4642730_+	cytochrome c nitrite reductase small subunit	NA	NA	NA	NA	NA
WP_145264072.1|4642815_4644465_+	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
WP_145259658.1|4644589_4645168_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_145259660.1|4645456_4646443_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_145259662.1|4646712_4648140_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_145259664.1|4648512_4649478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259666.1|4649717_4650185_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	33.3	2.1e-14
WP_145259668.1|4651291_4653223_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_145259671.1|4653219_4654002_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_145259673.1|4654731_4655991_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.2	6.1e-29
WP_145259675.1|4655981_4657253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259677.1|4657339_4659538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259679.1|4659605_4662785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259682.1|4663360_4663996_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_145259684.1|4664097_4665066_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_145259686.1|4665537_4666179_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_145259688.1|4666184_4666679_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_145259690.1|4667097_4667937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259692.1|4668148_4670995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259694.1|4671414_4672443_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_145259696.1|4672746_4674153_-	aspartate ammonia-lyase	NA	A0A1B1ISB0	uncultured_Mediterranean_phage	25.2	5.3e-05
WP_145259698.1|4674626_4675112_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_145259699.1|4675092_4675449_+	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.6	2.2e-08
WP_145259701.1|4675614_4676385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259703.1|4676635_4677892_+	sulfate adenylyltransferase	NA	NA	NA	NA	NA
WP_145259705.1|4678416_4680381_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_145259707.1|4680580_4681756_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_145259709.1|4682074_4682626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259711.1|4682885_4683767_+	ATP phosphoribosyltransferase	NA	A0A1V0SIZ6	Klosneuvirus	20.7	4.6e-07
WP_145259713.1|4684003_4684660_+	adenosylmethionine decarboxylase	NA	Q5GQE8	Synechococcus_phage	37.5	6.2e-17
WP_145259715.1|4684497_4685613_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.8	1.8e-16
WP_145259716.1|4685940_4687557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259718.1|4688152_4690192_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	30.8	4.7e-71
>prophage 11
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	4750408	4799038	7613473	integrase,transposase,protease	Streptococcus_phage(22.22%)	34	4747895:4747910	4804890:4804905
4747895:4747910	attL	CGTCACCCAGTTCGCC	NA	NA	NA	NA
WP_145259800.1|4750408_4752454_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_145259802.1|4752615_4755804_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_145259804.1|4755914_4756658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145264078.1|4758860_4759346_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.4	1.9e-10
WP_145259806.1|4759489_4760614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259807.1|4760969_4761995_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145264081.1|4762394_4763420_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145264084.1|4763559_4764579_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145259809.1|4764727_4765759_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145259811.1|4765774_4766206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259813.1|4767274_4767865_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_145259816.1|4767885_4769016_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.3	1.3e-67
WP_145259818.1|4769286_4770300_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145259819.1|4770533_4771541_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145259821.1|4771615_4772044_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_145264087.1|4772688_4773996_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	37.9	2.3e-55
WP_145259823.1|4774329_4775631_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	1.2e-144
WP_145259825.1|4776317_4777160_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	30.7	1.5e-26
WP_145259827.1|4777389_4777581_+	carbon storage regulator CsrA	NA	I3PUZ0	Vibrio_phage	42.9	4.6e-05
WP_145259829.1|4777732_4778992_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_145259831.1|4779176_4780808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259833.1|4780804_4782676_-	gliding motility protein	NA	NA	NA	NA	NA
WP_145259835.1|4782903_4783686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259836.1|4783945_4785265_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145259838.1|4785390_4787958_+	DUF1588 domain-containing protein	NA	NA	NA	NA	NA
WP_145259840.1|4787979_4788180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259842.1|4788332_4790957_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_145259844.1|4790953_4791355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259846.1|4791439_4792663_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145259848.1|4793681_4795307_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	3.2e-54
WP_145259850.1|4795310_4796996_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.8	3.6e-53
WP_145259852.1|4797311_4797704_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	6.1e-12
WP_145259854.1|4797706_4798060_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145259856.1|4798099_4799038_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4804890:4804905	attR	GGCGAACTGGGTGACG	NA	NA	NA	NA
>prophage 12
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	4845003	4931691	7613473	transposase,protease	uncultured_virus(25.0%)	65	NA	NA
WP_145259914.1|4845003_4845666_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_145259916.1|4845680_4845875_+	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_145259918.1|4845939_4847355_+	phosphotransferase	NA	NA	NA	NA	NA
WP_145259920.1|4847240_4848650_+	phosphotransferase	NA	NA	NA	NA	NA
WP_145259922.1|4848910_4850284_-	dipeptidase	NA	NA	NA	NA	NA
WP_145264092.1|4850795_4853213_+	cytochrome C	NA	NA	NA	NA	NA
WP_145259924.1|4854146_4854737_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_145259926.1|4854999_4855602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259927.1|4856085_4857570_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_145259929.1|4857835_4858360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259931.1|4858544_4859345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259933.1|4859535_4860168_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_145259935.1|4860181_4861933_+	protein kinase	NA	A0A0N9PM31	Port-miou_virus	26.1	2.5e-12
WP_145259937.1|4861961_4863335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259939.1|4863593_4864208_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145259940.1|4864537_4864978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259942.1|4864913_4865510_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_145259944.1|4865872_4867069_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_145259946.1|4867204_4870030_-	YfhO family protein	NA	NA	NA	NA	NA
WP_145259948.1|4870243_4871542_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_145259950.1|4871756_4872542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259952.1|4872743_4873193_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_145259955.1|4873804_4876765_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	39.4	2.2e-16
WP_145259957.1|4876994_4878455_-	transcription termination factor NusA	NA	NA	NA	NA	NA
WP_145259958.1|4878876_4881354_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_145259960.1|4881609_4883331_-	DNA polymerase/3'-5' exonuclease PolX	NA	NA	NA	NA	NA
WP_145259962.1|4883688_4884099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259964.1|4884305_4885616_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_145259966.1|4886446_4892782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259967.1|4893301_4895728_+	hypothetical protein	NA	A0A125RNK2	Pseudomonas_phage	22.8	8.8e-08
WP_145259969.1|4895923_4896322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259971.1|4896440_4896728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259973.1|4896728_4897265_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_145259975.1|4897273_4898272_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_145259977.1|4898625_4898829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145259979.1|4898915_4899878_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9KZK0	Tupanvirus	48.1	1.0e-84
WP_145259981.1|4900066_4900966_+	tyrosine recombinase	NA	A0A166YH27	Gordonia_phage	28.2	5.4e-11
WP_145264095.1|4901161_4902403_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.5	9.4e-06
WP_145259984.1|4902711_4903671_+	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_145259986.1|4903808_4904384_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_145259988.1|4904377_4905580_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_145259990.1|4905948_4907004_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_145259992.1|4906871_4907942_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_145259994.1|4908034_4908268_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_145259996.1|4908378_4909491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145259998.1|4912038_4912467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145260000.1|4912592_4912910_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.1	3.3e-08
WP_145260002.1|4913268_4914993_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	1.3e-53
WP_145260004.1|4915014_4915239_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_145260005.1|4916085_4916982_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.8	4.5e-26
WP_145259650.1|4917003_4918356_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.8	2.4e-55
WP_145260007.1|4918387_4920094_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	1.5e-54
WP_145259639.1|4920452_4920845_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145260010.1|4920847_4921201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145260012.1|4921266_4921680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145260014.1|4922184_4922373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145260016.1|4923037_4924282_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.6	1.3e-42
WP_145260018.1|4924462_4925041_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145260020.1|4925037_4925688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145260022.1|4925709_4927437_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.3	7.5e-54
WP_145258236.1|4927795_4928188_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	2.7e-12
WP_145258235.1|4928190_4928544_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145260024.1|4928651_4929638_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145260026.1|4929715_4930165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145263835.1|4930344_4931691_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP036279	Planctomycetes bacterium Pan216 chromosome, complete genome	7613473	5527734	5586657	7613473	integrase,transposase,plate	Ralstonia_virus(33.33%)	46	5521381:5521394	5536391:5536404
5521381:5521394	attL	CGACGCGATCCGCG	NA	NA	NA	NA
WP_145260806.1|5527734_5528853_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145260808.1|5529114_5530086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260810.1|5530177_5530324_-	DNase	NA	NA	NA	NA	NA
WP_145260811.1|5531729_5533103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260813.1|5533246_5533486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145254028.1|5533461_5534160_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145254025.1|5534156_5534600_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145260815.1|5534723_5534924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145254028.1|5534920_5535619_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145260816.1|5535693_5536449_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	30.9	3.8e-26
5536391:5536404	attR	CGACGCGATCCGCG	NA	NA	NA	NA
WP_145260818.1|5536514_5536868_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145260820.1|5536870_5537263_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.0	3.6e-12
WP_145254871.1|5537716_5538961_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145260822.1|5539203_5540931_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.5	4.0e-55
WP_145254871.1|5541645_5542890_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	1.4e-41
WP_145260824.1|5543372_5544533_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145260826.1|5544534_5544666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145260828.1|5544762_5545371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145260830.1|5545957_5546728_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	37.9	1.7e-37
WP_145260832.1|5546724_5547423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260834.1|5547604_5548375_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	42.4	1.3e-37
WP_145260836.1|5549999_5550617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260838.1|5551130_5551547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260840.1|5551543_5551789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260842.1|5551826_5552324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260844.1|5552377_5554126_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145260846.1|5554935_5555625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260848.1|5555783_5557013_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145260850.1|5557139_5558993_-	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	22.1	1.8e-05
WP_145260852.1|5559005_5559869_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_145260854.1|5559951_5561145_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_145260856.1|5561432_5562833_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_145260858.1|5562849_5566395_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145260860.1|5566391_5567657_-	DNA repair exonuclease	NA	A0A142F1G8	Bacillus_phage	26.2	1.9e-06
WP_145260862.1|5567802_5571294_+	exonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_145260864.1|5571376_5571958_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145260866.1|5571929_5572403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260868.1|5572581_5572923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145260870.1|5573760_5575281_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_145260872.1|5575234_5576947_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_145260874.1|5577029_5577689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260876.1|5578449_5581191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145260878.1|5581649_5582807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145260880.1|5583107_5583596_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_145260882.1|5583592_5585449_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_145260884.1|5585412_5586657_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
