The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	969618	1129856	7795793	tRNA,transposase,integrase	Pseudomonas_phage(21.43%)	109	959571:959593	1111380:1111400
959571:959593	attL	GCGACGCCGCCGGCGGTGACGGC	NA	NA	NA	NA
WP_145234509.1|969618_970062_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
959571:959593	attL	GCGACGCCGCCGGCGGTGACGGC	NA	NA	NA	NA
WP_145234511.1|970526_970889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234513.1|970967_971504_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.7	8.6e-25
WP_145234515.1|971881_972277_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_145234517.1|972354_973215_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_145234519.1|973229_974045_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_145234521.1|974334_974553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234522.1|974549_975296_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_145234524.1|975397_976534_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_145234526.1|976594_977464_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_145234527.1|977595_977946_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_145234529.1|978179_980321_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_145234531.1|980628_981405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234533.1|982061_984971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234535.1|985189_986311_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_145234537.1|986404_986863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234540.1|986958_988017_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145234542.1|988015_988486_+	cell division protein FtsH	NA	NA	NA	NA	NA
WP_145234545.1|988598_990947_-	protein kinase	NA	A0A2K9L1Y7	Tupanvirus	28.8	2.5e-15
WP_145234547.1|991139_993689_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145234549.1|993952_995110_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145234551.1|995102_995342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145234553.1|995861_996935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234555.1|997096_998458_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145234557.1|999540_1000410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234559.1|1000666_1002478_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.3e-36
WP_145234561.1|1004442_1005580_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145234563.1|1005915_1006224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244565.1|1006433_1007381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234565.1|1007451_1009263_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_145234567.1|1009275_1009752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234569.1|1009885_1010842_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145234571.1|1010966_1015010_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145234573.1|1015029_1017018_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_145234575.1|1017045_1018710_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_145234577.1|1018740_1023753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234579.1|1023897_1024683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234581.1|1024679_1026032_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7F1	Microcystis_virus	47.3	2.7e-38
WP_145234583.1|1026451_1029013_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_145234585.1|1029043_1032673_-	Hsp70 family protein	NA	G8DDB7	Micromonas_pusilla_virus	30.7	2.9e-31
WP_145234587.1|1032906_1033266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234589.1|1033287_1034709_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145234590.1|1034705_1035467_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_145234592.1|1035596_1036325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234594.1|1036573_1036837_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145234596.1|1036942_1037623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234598.1|1038244_1038736_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145234600.1|1038723_1039335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234602.1|1039358_1040729_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	34.8	1.2e-49
WP_145234604.1|1040901_1041489_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145234606.1|1041296_1044782_+	protein kinase	NA	A0A0G2Y6J2	Acanthamoeba_polyphaga_mimivirus	27.1	4.0e-14
WP_145234608.1|1045170_1057431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244566.1|1058126_1059170_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_145234610.1|1059259_1059604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145234612.1|1059633_1060392_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145234614.1|1060523_1063526_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_145234616.1|1063529_1064519_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
1063560:1063582	attR	GCCGTCACCGCCGGCGGCGTCGC	NA	NA	NA	NA
WP_145234618.1|1064519_1065935_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
1063560:1063582	attR	GCCGTCACCGCCGGCGGCGTCGC	NA	NA	NA	NA
WP_145234619.1|1065944_1068440_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145234621.1|1069128_1069683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234623.1|1069758_1070298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234625.1|1070312_1071740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234626.1|1071739_1072039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234628.1|1072062_1072929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234630.1|1073034_1074417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234631.1|1074556_1075399_-	hypothetical protein	NA	A0A2H4PB07	Aphanizomenon_phage	29.8	2.8e-06
WP_145234633.1|1075337_1077125_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	38.3	6.3e-88
WP_145234635.1|1077697_1078090_-	AAA domain-containing protein	NA	A7KV75	Bacillus_phage	44.7	9.8e-18
WP_145234636.1|1078554_1078935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234638.1|1079023_1080601_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145234639.1|1080935_1081058_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_145234641.1|1081054_1082740_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_145234643.1|1082784_1087170_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145244567.1|1087412_1090820_+	type I restriction-modification system endonuclease	NA	A0A2H4GY70	Pseudomonas_phage	25.3	6.5e-09
WP_145234645.1|1090838_1091699_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_145234647.1|1091695_1092544_+	hypothetical protein	NA	A0A142KAR9	Gordonia_phage	33.4	7.2e-34
WP_145234648.1|1092540_1093971_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	26.6	4.1e-29
WP_145234650.1|1093967_1095455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234651.1|1095486_1096044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234653.1|1096228_1096531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234654.1|1096431_1096755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234656.1|1096837_1099948_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145234658.1|1100031_1100313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234660.1|1100375_1101812_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145234662.1|1101828_1102281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234664.1|1102368_1102590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234666.1|1102974_1104216_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145234668.1|1104404_1104980_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145233609.1|1104994_1106389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145234670.1|1106452_1106731_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145234672.1|1106744_1107032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145234673.1|1107177_1108512_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145234675.1|1108508_1108967_-	response regulator	NA	NA	NA	NA	NA
WP_145234677.1|1108983_1109352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234679.1|1109381_1111949_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_145244568.1|1111945_1112233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234681.1|1112260_1112896_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145234683.1|1113076_1113463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234685.1|1113568_1114060_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_145234687.1|1114232_1115057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234689.1|1115130_1115574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234691.1|1115909_1117316_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_145234693.1|1117325_1119821_-	DUF1588 domain-containing protein	NA	NA	NA	NA	NA
WP_145234695.1|1119977_1120418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234697.1|1120541_1121969_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145234699.1|1122719_1126715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145234701.1|1127272_1127821_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_145234703.1|1128510_1129728_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	1.2e-50
WP_145233393.1|1129559_1129856_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	2137769	2191420	7795793	transposase	Leptospira_phage(37.5%)	37	NA	NA
WP_145234638.1|2137769_2139347_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145236316.1|2139488_2140619_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	27.8	1.1e-21
WP_145236318.1|2140716_2142039_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_145236321.1|2142127_2144440_+	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_145236323.1|2144454_2145915_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145236326.1|2146555_2147083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145236327.1|2147097_2148570_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_145236328.1|2148666_2150313_+	YHYH protein	NA	A0A1D8KSF1	Synechococcus_phage	33.9	1.9e-09
WP_145236331.1|2150328_2152821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236334.1|2152864_2155831_-	DUF2341 domain-containing protein	NA	NA	NA	NA	NA
WP_145236337.1|2157735_2158455_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_145236339.1|2158567_2158885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236342.1|2159030_2159570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236345.1|2159644_2159989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145236349.1|2160034_2160310_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.9	1.6e-06
WP_145236352.1|2160361_2161120_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	31.1	3.6e-16
WP_145236355.1|2161184_2162066_-	hypothetical protein	NA	A0A059NT77	Lactococcus_phage	34.2	2.2e-25
WP_145236359.1|2161932_2163513_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145236361.1|2163509_2164427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236364.1|2165379_2166198_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	38.0	2.4e-26
WP_145236367.1|2166834_2167992_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_145236370.1|2168074_2169094_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_145236373.1|2169253_2170495_+	DUF4281 domain-containing protein	NA	NA	NA	NA	NA
WP_145236376.1|2170582_2171503_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_145236379.1|2171615_2173535_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	38.9	2.1e-33
WP_145236382.1|2173709_2174846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145236385.1|2174746_2176033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145236387.1|2176052_2177162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145236390.1|2178948_2180046_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_145236393.1|2180370_2182431_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_145236396.1|2182475_2185145_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_145236399.1|2185141_2186536_-	hypothetical protein	NA	A0A1V0SEH2	Indivirus	31.4	1.4e-45
WP_145236402.1|2186623_2187346_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_145236404.1|2187769_2188642_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_145236406.1|2188836_2188989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236409.1|2189103_2189442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145236412.1|2190037_2191420_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	3511451	3520898	7795793	transposase	Acinetobacter_phage(100.0%)	12	NA	NA
WP_145239428.1|3511451_3512615_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_145235098.1|3512849_3514013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_145239430.1|3514333_3514666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145239434.1|3514673_3515135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244660.1|3515286_3515520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145239437.1|3515592_3515856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145239440.1|3515810_3516119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145239443.1|3516173_3516464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145239446.1|3516465_3517359_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	2.4e-40
WP_145239449.1|3517488_3519669_+	recombinase family protein	NA	NA	NA	NA	NA
WP_145239452.1|3519729_3520026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145239454.1|3519857_3520898_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.4	3.0e-50
>prophage 4
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	3845545	3923687	7795793	transposase,holin,protease,integrase	Salmonella_phage(11.11%)	50	3874919:3874938	3922590:3922609
WP_145240073.1|3845545_3845974_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_145244678.1|3846093_3847872_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_145240075.1|3848026_3848926_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_145240077.1|3849010_3849184_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	58.5	4.4e-07
WP_145240079.1|3849362_3849566_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_145240080.1|3849717_3852507_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145240082.1|3852767_3853955_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145240084.1|3855356_3855743_+	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_145240086.1|3855789_3856398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240088.1|3856524_3857409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240090.1|3857412_3859713_+	DNA polymerase I	NA	A0A1S6L2A0	Mycobacterium_phage	23.6	5.4e-07
WP_145240092.1|3859916_3860696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240094.1|3861016_3861196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240096.1|3861810_3862821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240098.1|3863619_3865848_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_145244679.1|3866664_3867435_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	35.7	6.8e-31
WP_145240100.1|3869383_3870634_+	DNA modification methylase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	48.4	6.6e-92
WP_145240102.1|3870657_3870864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240104.1|3870913_3871309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240106.1|3871305_3871605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240107.1|3871601_3871796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240109.1|3871792_3872260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240111.1|3872256_3872472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240113.1|3872468_3872747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240115.1|3872743_3873325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240116.1|3873557_3875408_+	hypothetical protein	NA	NA	NA	NA	NA
3874919:3874938	attL	GCGGGCGATGCGGGCCGAGC	NA	NA	NA	NA
WP_145240117.1|3875495_3875678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240119.1|3876071_3879254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145240121.1|3880401_3881487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145240123.1|3881932_3882604_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145240125.1|3882676_3886345_+	protein kinase	NA	A0A1J0F9C3	Only_Syngen_Nebraska_virus	28.4	5.2e-12
WP_145240127.1|3886445_3889688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244680.1|3890632_3891997_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	45.1	1.6e-99
WP_145240129.1|3892848_3895935_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_145240131.1|3896235_3897501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240133.1|3897568_3898156_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145240135.1|3898142_3901163_+	protein kinase	NA	Q6LDV2	Moloney_murine_leukemia_virus	25.9	2.4e-10
WP_145240136.1|3901191_3903204_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_145240138.1|3905585_3908177_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145240140.1|3908243_3914756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240142.1|3915356_3915641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145240144.1|3915672_3916299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145240146.1|3916993_3917176_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	59.6	1.0e-09
WP_145240148.1|3917745_3918294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145240150.1|3918303_3918702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145240152.1|3918745_3919771_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_145240154.1|3919802_3920744_-	radical SAM protein	NA	NA	NA	NA	NA
WP_145240156.1|3920740_3922381_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	29.6	4.0e-20
WP_145240158.1|3922395_3922947_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
3922590:3922609	attR	GCTCGGCCCGCATCGCCCGC	NA	NA	NA	NA
WP_145240160.1|3923162_3923687_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	4502493	4638626	7795793	transposase,protease,integrase	Acinetobacter_phage(16.67%)	97	4506209:4506224	4605273:4605291
WP_145241039.1|4502493_4503855_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145241041.1|4504189_4504651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241042.1|4505130_4505709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241044.1|4505784_4506546_+	3'-5' exonuclease	NA	I6R9X8	Croceibacter_phage	37.3	3.6e-32
4506209:4506224	attL	CCGGCGCCGTCCGCGA	NA	NA	NA	NA
WP_145241046.1|4506649_4507360_+	hypothetical protein	NA	NA	NA	NA	NA
4506209:4506224	attL	CCGGCGCCGTCCGCGA	NA	NA	NA	NA
WP_145241048.1|4507409_4507625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241050.1|4507621_4508173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241052.1|4508347_4508947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241054.1|4509342_4510836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241056.1|4510975_4512343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241058.1|4512460_4512733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241060.1|4512707_4514969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241062.1|4515408_4516650_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145241064.1|4516867_4520383_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145241066.1|4520415_4522269_-	protein kinase	NA	A0A291AU40	Pandoravirus	28.9	2.1e-09
WP_145241068.1|4522741_4523500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241070.1|4523715_4524069_+	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_145241072.1|4524209_4525631_+	hypothetical protein	NA	A0A1S7FYZ0	Listeria_phage	28.9	1.9e-18
WP_145241074.1|4525627_4526491_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_145241076.1|4526490_4527960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241078.1|4528112_4528319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241080.1|4528705_4529146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241082.1|4529221_4529809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241084.1|4529791_4530820_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145244709.1|4531124_4531523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241086.1|4531601_4532132_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_145241088.1|4532202_4532646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241090.1|4532786_4533476_+	VIT family protein	NA	NA	NA	NA	NA
WP_145241092.1|4533479_4534061_+	response regulator	NA	NA	NA	NA	NA
WP_145241094.1|4534573_4535938_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145244710.1|4536456_4537446_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_145241096.1|4537785_4538043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241098.1|4538520_4538730_+	hypothetical protein	NA	NA	NA	NA	NA
4538297:4538312	attR	CCGGCGCCGTCCGCGA	NA	NA	NA	NA
WP_145241100.1|4539006_4539219_+	hypothetical protein	NA	NA	NA	NA	NA
4538297:4538312	attR	CCGGCGCCGTCCGCGA	NA	NA	NA	NA
WP_145241102.1|4539525_4539900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145233609.1|4540462_4541857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241104.1|4541933_4542998_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145241106.1|4543115_4543835_+	VIT family protein	NA	NA	NA	NA	NA
WP_145241108.1|4543806_4545210_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145241110.1|4545204_4545438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241112.1|4546481_4547546_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145241114.1|4547636_4548131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241116.1|4548310_4548598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241118.1|4548829_4549489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241120.1|4549451_4549856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241122.1|4550744_4551029_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_145241124.1|4551122_4552604_+	alpha-amylase	NA	NA	NA	NA	NA
WP_145241126.1|4552749_4563111_-	protein kinase	NA	A0A1V0SBL0	Catovirus	27.9	2.3e-09
WP_145241128.1|4563135_4568334_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	32.2	3.4e-17
WP_145241130.1|4568481_4569057_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145241132.1|4569155_4571897_+	protein kinase	NA	A0A1D6Y713	Golden_Marseillevirus	29.7	3.6e-18
WP_145241134.1|4571926_4574458_+	transporter substrate-binding protein	NA	A0A0M4JBJ9	Mollivirus	29.4	1.7e-14
WP_145241137.1|4574462_4577708_+	protein kinase	NA	A0A0M4JT11	Mollivirus	28.2	3.1e-08
WP_145233609.1|4578059_4579454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241139.1|4579835_4581083_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145241141.1|4581291_4583610_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	42.4	1.6e-83
WP_145233609.1|4584072_4585467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241143.1|4585702_4585981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241145.1|4587347_4587620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241146.1|4587919_4588456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241148.1|4589364_4589745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241150.1|4589915_4591082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241152.1|4591094_4591451_+	hypothetical protein	NA	E5DQF6	Aeromonas_phage	48.1	1.2e-27
WP_145241154.1|4591509_4592004_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	38.5	3.8e-11
WP_145241156.1|4592081_4592495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241157.1|4592994_4594047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241159.1|4594027_4595455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241161.1|4595821_4596112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241163.1|4596167_4597316_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145241165.1|4597207_4598098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241167.1|4598107_4598386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241169.1|4598417_4599083_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145241171.1|4599212_4599491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241173.1|4599861_4600236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241175.1|4600315_4600918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241177.1|4601007_4602585_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_145241179.1|4602933_4603173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241181.1|4603244_4608770_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_145241183.1|4608803_4609079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241185.1|4609333_4609795_+	hypothetical protein	NA	A0A125RNK2	Pseudomonas_phage	46.9	6.5e-13
WP_145241187.1|4610042_4611344_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	34.6	1.6e-32
WP_145241189.1|4611864_4615131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241191.1|4615127_4621631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241193.1|4621627_4623475_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_145241195.1|4623511_4624798_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	27.1	4.6e-08
WP_145241197.1|4625154_4625721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241199.1|4625730_4626132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241201.1|4626162_4626555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244711.1|4626825_4627827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241203.1|4628254_4629426_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	1.9e-56
WP_145241205.1|4629751_4631809_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_145241207.1|4631784_4632938_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.3	4.0e-59
WP_145241210.1|4632756_4634037_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_145241212.1|4633975_4634806_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145241203.1|4634843_4636015_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	1.9e-56
WP_145241214.1|4635963_4636278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145241216.1|4637708_4638626_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	29.5	1.4e-22
>prophage 6
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	4646843	4707728	7795793	transposase,integrase	Acinetobacter_phage(12.5%)	48	4681206:4681224	4704548:4704566
WP_145241203.1|4646843_4648015_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	1.9e-56
WP_145241226.1|4648395_4649298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241228.1|4649414_4650851_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145241230.1|4650974_4651904_+	trehalose utilization protein	NA	NA	NA	NA	NA
WP_145241232.1|4652012_4653554_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_145244712.1|4653605_4654580_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_145241235.1|4654674_4656183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241237.1|4656319_4656844_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_145241239.1|4656927_4657503_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145244713.1|4660620_4661433_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145241242.1|4661507_4661978_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145241244.1|4662080_4663892_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	8.8e-37
WP_145241246.1|4664866_4669669_-	protein kinase	NA	A0A1V0SDC3	Indivirus	31.4	1.7e-15
WP_145241248.1|4669724_4670300_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145241250.1|4670450_4670705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241252.1|4670770_4671013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241254.1|4671342_4671537_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_145241258.1|4672471_4673098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241260.1|4673165_4673702_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145241262.1|4673725_4674280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241264.1|4674315_4674603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241266.1|4675645_4676383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145233609.1|4676403_4677798_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241269.1|4677801_4678551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241271.1|4678893_4685943_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
4681206:4681224	attL	GGTCCGGGGGATCAACCTG	NA	NA	NA	NA
WP_145241273.1|4685876_4686266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241275.1|4686332_4687157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241277.1|4687350_4687917_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145241279.1|4687994_4690712_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	36.6	2.4e-30
WP_145241108.1|4690768_4692172_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_145241110.1|4692166_4692400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145241281.1|4692857_4694000_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_145244714.1|4694013_4694223_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_145241283.1|4694186_4695539_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	28.2	1.3e-05
WP_145241285.1|4695520_4695694_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_145241287.1|4695932_4696271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241289.1|4696209_4697346_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145241291.1|4697487_4698648_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	4.2e-24
WP_145241293.1|4698985_4699537_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_145241295.1|4699551_4701192_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	30.9	7.2e-22
WP_145241297.1|4701188_4702130_+	radical SAM protein	NA	NA	NA	NA	NA
WP_145241299.1|4702161_4703187_+	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_145241301.1|4703308_4704088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244711.1|4704245_4705247_+|transposase	transposase	transposase	NA	NA	NA	NA
4704548:4704566	attR	GGTCCGGGGGATCAACCTG	NA	NA	NA	NA
WP_145241303.1|4705469_4706108_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_145241305.1|4706154_4706433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145241307.1|4706429_4707305_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.8	2.8e-41
WP_145241310.1|4707311_4707728_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	4766164	4796948	7795793	transposase,protease	Acinetobacter_phage(50.0%)	18	NA	NA
WP_145241203.1|4766164_4767336_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	1.9e-56
WP_145241404.1|4767468_4769592_-	recombinase family protein	NA	NA	NA	NA	NA
WP_145241405.1|4769730_4770819_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145241407.1|4770911_4771844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145234612.1|4772008_4772767_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145234610.1|4772796_4773141_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145241409.1|4773281_4777457_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_145241411.1|4777962_4778748_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_145241413.1|4778744_4781171_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145241415.1|4781274_4781631_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_145241417.1|4781635_4783738_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145241419.1|4783734_4785171_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_145244718.1|4785239_4786544_+	MFS transporter	NA	NA	NA	NA	NA
WP_145241421.1|4786628_4786913_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_145241423.1|4787072_4790312_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145241425.1|4790447_4792472_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	43.9	1.6e-103
WP_145241427.1|4792592_4795118_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_145233609.1|4795553_4796948_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	7226804	7261756	7795793	transposase,integrase	uncultured_Mediterranean_phage(100.0%)	30	7217157:7217174	7256707:7256724
7217157:7217174	attL	CCGCCGGCCGGGCCGCGT	NA	NA	NA	NA
WP_145244124.1|7226804_7227953_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145244125.1|7228470_7229670_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IUW9	uncultured_Mediterranean_phage	28.4	7.4e-24
WP_145244126.1|7229835_7231101_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_145244802.1|7231152_7231848_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_145244803.1|7232035_7233862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244127.1|7234701_7235994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244128.1|7236000_7236828_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145244129.1|7236846_7237512_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_145244130.1|7237508_7238630_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145244804.1|7238587_7239235_+	acyltransferase	NA	NA	NA	NA	NA
WP_145244131.1|7239227_7240367_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_145244132.1|7240371_7241532_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_145244133.1|7241580_7242231_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_145244134.1|7242330_7245024_-	glucosidase	NA	NA	NA	NA	NA
WP_145244135.1|7245121_7245400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145233609.1|7245468_7246863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145244136.1|7246886_7247159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244137.1|7247186_7248812_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_145244138.1|7248833_7249730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244139.1|7249762_7251550_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_145234612.1|7251704_7252463_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_145234610.1|7252492_7252837_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145244140.1|7252876_7253434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244141.1|7253471_7254833_-	redoxin family protein	NA	NA	NA	NA	NA
WP_145244142.1|7255081_7255672_+	signal peptidase II	NA	NA	NA	NA	NA
WP_145244143.1|7255668_7256313_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_145244144.1|7256317_7257007_-	DUF4058 family protein	NA	NA	NA	NA	NA
7256707:7256724	attR	ACGCGGCCCGGCCGGCGG	NA	NA	NA	NA
WP_145244145.1|7257233_7259753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244146.1|7260081_7260660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145239544.1|7260835_7261756_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP036273	Planctomycetes bacterium ETA_A1 chromosome, complete genome	7795793	7350937	7366643	7795793	portal,terminase,capsid,transposase	Propionibacterium_phage(50.0%)	15	NA	NA
WP_145244224.1|7350937_7351588_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_145244225.1|7351614_7351818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244226.1|7352015_7353545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244227.1|7353624_7354314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244228.1|7354310_7354967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244229.1|7354989_7355829_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_145244230.1|7356179_7357583_-|portal	phage portal protein	portal	A0A1D8ETC8	Propionibacterium_phage	22.4	1.6e-09
WP_145244231.1|7357613_7357799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145233609.1|7358048_7359443_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145244232.1|7359729_7361238_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_145244233.1|7362680_7363163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244234.1|7363352_7363862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145244235.1|7364039_7364279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145244236.1|7364275_7365973_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	26.9	3.7e-21
WP_145244237.1|7365902_7366643_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
