The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	439191	460508	5296102	integrase,transposase	Shigella_phage(100.0%)	12	437694:437708	461674:461688
437694:437708	attL	GTTGCGGCACGCGCT	NA	NA	NA	NA
WP_087943921.1|439191_440336_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_070996162.1|440672_444167_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_124632114.1|444474_444966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|445155_446300_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124944745.1|446636_450641_+	avirulence protein	NA	NA	NA	NA	NA
WP_124632114.1|450948_451440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|451629_452774_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124944746.1|453110_456707_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_087943921.1|456813_457957_+|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124632114.1|458251_458743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|458932_460077_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_080670999.1|460103_460508_+|integrase	integrase	integrase	NA	NA	NA	NA
461674:461688	attR	GTTGCGGCACGCGCT	NA	NA	NA	NA
>prophage 2
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	1271578	1349619	5296102	tail,holin,integrase,head,portal,capsid,protease,terminase,plate	Stenotrophomonas_phage(45.1%)	86	1298737:1298752	1306791:1306806
WP_051373354.1|1271578_1273258_-|terminase	phage terminase large subunit	terminase	L7TLX3	Rhizobium_phage	55.0	4.1e-174
WP_029996063.1|1273257_1273503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029996064.1|1273499_1273772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080671008.1|1276018_1278052_-	DUF1983 domain-containing protein	NA	NA	NA	NA	NA
WP_051373356.1|1278048_1281672_-	hypothetical protein	NA	Q6UGD1	Escherichia_virus	20.1	7.0e-09
WP_029996069.1|1281679_1283872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144081050.1|1283858_1284323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051373358.1|1284315_1284777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144081051.1|1284773_1286894_-	hypothetical protein	NA	A0A1B1IW12	uncultured_Mediterranean_phage	30.1	4.1e-62
WP_051373360.1|1286890_1287484_-	hypothetical protein	NA	A0A2D2W5E6	Ralstonia_phage	44.0	2.2e-21
WP_029996074.1|1287636_1288587_-	hypothetical protein	NA	L7TJ83	Rhizobium_phage	43.1	1.7e-60
WP_144081052.1|1288660_1289452_-	hypothetical protein	NA	A0A1B1IWQ1	uncultured_Mediterranean_phage	34.8	7.5e-17
WP_029996076.1|1289570_1291136_-|head,tail	phage collar / T7-like phage head-to-tail joining protein	head,tail	L7TJ79	Rhizobium_phage	38.5	2.2e-89
WP_029996077.1|1291295_1291481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029996078.1|1291550_1292081_-	adenylate kinase	NA	L7TJ75	Rhizobium_phage	40.1	5.0e-25
WP_029996079.1|1292286_1293099_-	T7 exonuclease	NA	M1HMA9	Pelagibacter_phage	38.1	2.1e-38
WP_029996080.1|1293095_1293320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029996081.1|1293316_1293538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029996082.1|1293664_1294045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144081053.1|1294041_1294197_-	RecBCD nuclease inhibitor	NA	B6Z9G5	Kluyvera_phage	53.1	4.9e-05
WP_029996084.1|1294516_1296430_-	DNA polymerase	NA	A0A076YNV1	Mesorhizobium_phage	47.6	6.0e-161
WP_029996085.1|1296410_1297031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904326.1|1297027_1297273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042761575.1|1297304_1298939_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	55.0	8.5e-148
1298737:1298752	attL	AGAGCTGAGGCTTCGC	NA	NA	NA	NA
WP_016904329.1|1299092_1299473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145508516.1|1299475_1299847_-	lysozyme	NA	NA	NA	NA	NA
WP_080671009.1|1299837_1300440_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0F7L4K2	uncultured_marine_virus	37.3	3.5e-06
WP_080671010.1|1300318_1300996_-	DUF2815 family protein	NA	A0A2D2W4Z4	Ralstonia_phage	36.6	2.2e-17
WP_029996089.1|1301119_1301410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145508518.1|1301582_1304003_-	T3/T7 RNA polymerase	NA	L7TQW5	Rhizobium_phage	38.9	2.4e-159
WP_016850997.1|1304655_1305273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850998.1|1305289_1306246_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	55.3	1.7e-92
WP_078585787.1|1306470_1306692_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
WP_016850999.1|1306688_1306898_-	hypothetical protein	NA	NA	NA	NA	NA
1306791:1306806	attR	GCGAAGCCTCAGCTCT	NA	NA	NA	NA
WP_016851000.1|1306894_1307098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851001.1|1307163_1307388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851002.1|1307384_1307657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014091203.1|1307649_1307832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851003.1|1307824_1308199_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	1.7e-19
WP_145508521.1|1308328_1308601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145508524.1|1308600_1308888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472861.1|1308884_1309103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145508736.1|1309423_1312096_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.0	0.0e+00
WP_016851008.1|1312128_1312341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851009.1|1312337_1312616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008572766.1|1312626_1312947_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_078537260.1|1312949_1313198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828228.1|1313283_1313715_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
WP_016851031.1|1314321_1315308_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
WP_016851032.1|1315304_1315706_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
WP_029828231.1|1315718_1318589_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
WP_005922203.1|1318618_1318732_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029828232.1|1318740_1319043_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_016850450.1|1319088_1319598_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_029828235.1|1319627_1320794_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	1.1e-133
WP_016850452.1|1320805_1321165_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
WP_016850453.1|1321161_1321725_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
WP_016850454.1|1321867_1322542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850455.1|1322544_1322838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850456.1|1322911_1324711_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
WP_029828239.1|1324723_1325266_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
WP_016851159.1|1325258_1326149_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_078585788.1|1326244_1327783_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016851160.1|1327964_1328414_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
WP_016851161.1|1328401_1328821_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
WP_016851162.1|1328817_1329306_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	1.2e-28
WP_078585789.1|1329305_1329947_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
WP_005922189.1|1329943_1330219_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005929454.1|1330211_1330568_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|1330572_1330782_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029828243.1|1330781_1331249_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
WP_016851153.1|1331347_1332067_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
WP_029828245.1|1332070_1333084_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
WP_029828246.1|1333130_1333973_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
WP_033482900.1|1334094_1335879_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.5	7.3e-270
WP_016850658.1|1335878_1336892_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
WP_078585599.1|1336917_1337163_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
WP_029828252.1|1337080_1337782_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
WP_078585598.1|1337954_1338371_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026007262.1|1339298_1340198_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_016851285.1|1341339_1342461_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
WP_016851284.1|1343468_1343798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851283.1|1343983_1344181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851282.1|1346195_1347488_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1347580_1348207_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|1348332_1349619_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 3
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	3067665	3144907	5296102	tail,holin,integrase,head,portal,plate,terminase,tRNA,capsid	Stenotrophomonas_phage(55.26%)	83	3109991:3110037	3144984:3145030
WP_016848775.1|3067665_3070044_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005920300.1|3070169_3071165_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.6	3.0e-31
WP_003484828.1|3071415_3071775_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|3071785_3071983_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_077708941.1|3072229_3072772_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_016848774.1|3072820_3074725_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.3	1.8e-125
WP_078560288.1|3075038_3076169_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.4	1.7e-14
WP_078585579.1|3076297_3078076_-	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
WP_016848770.1|3077970_3079449_-	MFS transporter	NA	NA	NA	NA	NA
WP_016848769.1|3079445_3081632_-	Six-hairpin glycosidase-like protein	NA	NA	NA	NA	NA
WP_016848768.1|3081874_3083956_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_016848767.1|3084268_3087043_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_016848766.1|3087673_3089290_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_126936733.1|3090614_3091256_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_078585616.1|3092005_3092512_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_011051705.1|3092780_3093272_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_058958587.1|3093326_3094403_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_016851424.1|3094490_3095264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829174.1|3095310_3097764_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_005920266.1|3097864_3098176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005920263.1|3098168_3098585_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_078585620.1|3098641_3099484_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_078516287.1|3099534_3100593_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_016848703.1|3100589_3101759_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_005920257.1|3101755_3102523_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_078585621.1|3102519_3103566_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_005914237.1|3103675_3104086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005920253.1|3104419_3106093_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_005920251.1|3106129_3106372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016848701.1|3107244_3109266_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016848700.1|3109404_3109947_+	fimbrial protein	NA	NA	NA	NA	NA
3109991:3110037	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_080639735.1|3110173_3110419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145508564.1|3111462_3112452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508566.1|3112451_3113069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508568.1|3113134_3113833_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.9	6.7e-102
WP_010364016.1|3113750_3113996_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	52.5	1.8e-14
WP_145508570.1|3114021_3115044_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.1	2.0e-139
WP_145508572.1|3115043_3116828_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_145508574.1|3116949_3117792_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
WP_145508576.1|3117838_3118858_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.0	2.1e-136
WP_015472833.1|3118861_3119581_+|terminase	phage-related terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.6	5.3e-70
WP_145508578.1|3119678_3120146_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	51.0	3.7e-32
WP_145508581.1|3120145_3120355_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	58.0	1.6e-14
WP_145508583.1|3120359_3120716_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	7.7e-22
WP_145508744.1|3120708_3120984_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	4.6e-22
WP_145508585.1|3120980_3121622_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	63.3	2.2e-51
WP_145508588.1|3121621_3122110_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.0	2.9e-27
WP_145508590.1|3122106_3122526_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	5.7e-40
WP_145508592.1|3122513_3122972_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	57.2	4.2e-36
WP_145508594.1|3123010_3123226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508596.1|3123258_3123945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508599.1|3124102_3124993_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	54.4	3.6e-84
WP_145508601.1|3124985_3125534_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_145508603.1|3125537_3126743_+|tail	phage tail protein	tail	E5FFH1	Burkholderia_phage	38.9	3.7e-31
WP_145508605.1|3126696_3126972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508607.1|3127050_3127614_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	46.4	6.9e-25
WP_145508609.1|3127610_3127970_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.2e-35
WP_145508611.1|3127981_3129148_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.4	5.0e-134
WP_145508613.1|3129178_3129688_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	2.9e-70
WP_104554051.1|3129733_3130036_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	1.7e-25
WP_145508615.1|3130044_3130158_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	68.6	1.6e-05
WP_145508617.1|3130187_3133058_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.7	6.6e-188
WP_145508619.1|3133069_3133471_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	58.3	7.4e-37
WP_145508621.1|3133467_3134457_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.2	1.7e-90
WP_144080892.1|3134591_3135041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080931379.1|3135061_3136171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508623.1|3136431_3136869_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	39.8	3.2e-09
WP_029820449.1|3136940_3137198_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	44.6	6.6e-07
WP_029820451.1|3137200_3137521_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	53.3	1.3e-23
WP_029820452.1|3137531_3137810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005929517.1|3137806_3138019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508746.1|3138052_3140725_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	70.2	0.0e+00
WP_145508626.1|3141048_3141267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508628.1|3141263_3141551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508630.1|3141550_3141823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043087489.1|3141952_3142327_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	2.9e-19
WP_145508632.1|3142319_3142502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508634.1|3142494_3142767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508637.1|3142763_3142988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508748.1|3143053_3143257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508639.1|3143253_3143463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508641.1|3143420_3143678_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	57.4	1.2e-16
WP_145508643.1|3143677_3144907_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.7	6.2e-119
3144984:3145030	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
>prophage 4
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	3693214	3813417	5296102	tail,transposase,holin,integrase,head,portal,capsid,terminase,tRNA,plate	Stenotrophomonas_phage(43.75%)	117	3734207:3734251	3772234:3772278
WP_003482499.1|3693214_3693934_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003482501.1|3693947_3695972_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	6.7e-94
WP_003482503.1|3696245_3696770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482504.1|3696783_3699228_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_029829319.1|3699467_3701552_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_080573042.1|3701560_3701893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829321.1|3701908_3703351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829322.1|3703612_3705799_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_078585717.1|3706089_3706170_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_003482510.1|3706253_3707153_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_005921461.1|3707149_3707902_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_016849287.1|3707898_3708177_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_003482516.1|3708173_3709292_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_015463489.1|3709354_3709867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508683.1|3710303_3711818_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_016849290.1|3712118_3713153_+	ROK family protein	NA	NA	NA	NA	NA
WP_016849291.1|3713253_3715890_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_029829327.1|3716106_3720228_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.4	2.0e-44
WP_003482535.1|3720330_3720879_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011052052.1|3721359_3723156_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	1.5e-81
WP_005913671.1|3723294_3723792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851165.1|3723870_3724275_+	response regulator	NA	NA	NA	NA	NA
WP_005913667.1|3725540_3725651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011052054.1|3725742_3726453_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_016851168.1|3726661_3726868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078585719.1|3727019_3727334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851169.1|3727378_3729547_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_026007238.1|3729912_3730539_-	amino acid transporter	NA	NA	NA	NA	NA
WP_016851171.1|3730640_3731543_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003482555.1|3731815_3732175_-	response regulator	NA	NA	NA	NA	NA
WP_016851172.1|3732171_3733179_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016851173.1|3733453_3734128_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	33.8	4.1e-24
3734207:3734251	attL	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_026007239.1|3734396_3735596_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
WP_011038128.1|3735595_3735856_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.2e-18
WP_016851176.1|3735813_3736020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851177.1|3736016_3736289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851178.1|3736285_3736531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007240.1|3736527_3736803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851181.1|3736964_3737375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|3737453_3737717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573080.1|3737713_3737938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851184.1|3737988_3738207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573081.1|3738500_3741164_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011038118.1|3741191_3741431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038117.1|3741427_3741553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573074.1|3741731_3742043_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
WP_016851187.1|3742049_3742304_-	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_026007241.1|3742370_3742799_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
WP_080573075.1|3743105_3743570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573076.1|3743574_3743913_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.8e-07
WP_080573077.1|3743878_3744826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851189.1|3745112_3746099_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
WP_016851190.1|3746095_3746497_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_029996349.1|3746509_3749380_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
WP_005922203.1|3749409_3749523_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029996350.1|3749531_3749834_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_016851197.1|3749879_3750389_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
WP_016851114.1|3750419_3751586_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
WP_016851115.1|3751597_3751957_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
WP_016851116.1|3751953_3752517_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_080573069.1|3752595_3752871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851118.1|3752824_3754030_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
WP_026007225.1|3754033_3754582_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_016851120.1|3754574_3755465_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
WP_042761698.1|3755871_3756345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573070.1|3756356_3757181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851121.1|3757353_3757809_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.3e-37
WP_016851122.1|3757796_3758216_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
WP_016851123.1|3758212_3758701_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
WP_080671044.1|3758700_3759342_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	1.3e-48
WP_005922189.1|3759338_3759614_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005917737.1|3759606_3759963_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005917735.1|3759967_3760177_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029996352.1|3760176_3760644_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
WP_016851435.1|3760742_3761462_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
WP_029996353.1|3761465_3762482_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
WP_029996354.1|3762528_3763371_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
WP_033483117.1|3763492_3765277_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_029996356.1|3765276_3766299_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_053503138.1|3766324_3766570_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_029996358.1|3766487_3767183_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
WP_016851201.1|3767214_3767682_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_088091923.1|3767681_3768908_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016850467.1|3770914_3771400_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
WP_011038085.1|3771743_3772079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850466.1|3772515_3773199_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
3772234:3772278	attR	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_011052060.1|3773241_3774060_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003482562.1|3774066_3774585_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003482565.1|3774642_3775962_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_029829330.1|3776147_3777188_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016849299.1|3777177_3777627_-	protein TolR	NA	NA	NA	NA	NA
WP_003482569.1|3777784_3778564_-	protein TolQ	NA	NA	NA	NA	NA
WP_003482571.1|3778575_3779034_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003482572.1|3779086_3780127_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_016849298.1|3780166_3780397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921446.1|3780399_3782304_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
WP_003482577.1|3782500_3783085_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003482580.1|3783203_3783728_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482581.1|3783857_3784586_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029829331.1|3784675_3785353_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005913643.1|3785450_3785978_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016850983.1|3786400_3788167_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_029829333.1|3788325_3789069_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_016850980.1|3790017_3790302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007196.1|3790459_3790999_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
WP_098477664.1|3791271_3792374_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	7.7e-44
WP_087943921.1|3793387_3794532_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_087943921.1|3795024_3796168_+|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124632122.1|3796318_3796714_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_070996149.1|3797099_3800594_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_070996147.1|3800901_3801432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|3801582_3802727_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124632122.1|3803276_3803672_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_081341541.1|3804057_3807246_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_124632114.1|3807553_3808045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849980.1|3809608_3811156_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_016849979.1|3812454_3813417_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	4335081	4346851	5296102		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913455.1|4335081_4336428_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_016850199.1|4336474_4337878_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-48
WP_016850197.1|4338160_4339327_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
WP_029829443.1|4339667_4340567_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
WP_016851441.1|4340563_4341121_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_005913450.1|4341117_4342005_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_005920787.1|4342056_4343112_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
WP_016851442.1|4343331_4344078_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_016851443.1|4344077_4345022_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005920793.1|4345185_4345914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005913435.1|4345894_4346851_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
>prophage 6
NZ_CP041967	Xanthomonas citri pv. glycines strain K2 chromosome, complete genome	5296102	4558018	4612498	5296102	tail,holin,integrase,head,portal,plate,terminase,tRNA,capsid	Stenotrophomonas_phage(66.67%)	67	4580310:4580326	4597524:4597540
WP_026007245.1|4558018_4559209_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	57.2	2.9e-121
WP_016851204.1|4559534_4559879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050990064.1|4560674_4561901_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016851201.1|4561900_4562368_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_029829505.1|4562399_4563104_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	79.1	9.4e-112
WP_078560558.1|4563021_4563267_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.8	2.8e-15
WP_029829507.1|4563292_4564306_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	2.4e-140
WP_033837534.1|4564305_4566090_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.1	1.9e-270
WP_029829511.1|4566211_4567054_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	9.9e-68
WP_016851152.1|4567100_4568114_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	3.2e-137
WP_029829513.1|4568117_4568837_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	61.6	6.5e-68
WP_029829514.1|4568935_4569403_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.8e-31
WP_005917735.1|4569402_4569612_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005917737.1|4569616_4569973_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_015471780.1|4569965_4570241_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	2.3e-21
WP_078585862.1|4570237_4570879_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	62.1	1.2e-49
WP_016850284.1|4570878_4571367_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.3	1.3e-27
WP_016850283.1|4571363_4571783_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_016850282.1|4571770_4572226_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	57.4	4.4e-38
WP_078539024.1|4572495_4573326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850281.1|4574007_4574898_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	2.0e-82
WP_029829518.1|4574890_4575436_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	57.1	2.9e-52
WP_016850985.1|4575448_4577248_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.5	1.2e-81
WP_026007198.1|4577324_4577618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850987.1|4577620_4578295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850988.1|4578438_4579002_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.5	2.8e-26
WP_016850989.1|4578998_4579358_+|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	63.6	2.1e-35
WP_029829520.1|4579369_4580536_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.8	6.5e-134
4580310:4580326	attL	TGATCGAAACGATCAAC	NA	NA	NA	NA
WP_016851113.1|4580566_4581076_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	3.4e-71
WP_016851112.1|4581121_4581424_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	3.7e-25
WP_005922203.1|4581432_4581546_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029829524.1|4581575_4584446_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	50.3	3.3e-187
WP_016851191.1|4584458_4584860_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	58.3	7.4e-37
WP_016851192.1|4584856_4585843_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.4	5.0e-95
WP_016851193.1|4585919_4586219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829526.1|4587476_4587908_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	33.1	2.4e-09
WP_078585864.1|4587993_4588239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472857.1|4588241_4588562_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.8	7.4e-24
WP_016849266.1|4588572_4588851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849267.1|4588847_4589060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508757.1|4589093_4591766_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.4	0.0e+00
WP_026007204.1|4592089_4592308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851005.1|4592304_4592592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851004.1|4592591_4592864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849271.1|4592993_4593368_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.1	1.1e-18
WP_016849272.1|4593360_4593543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849273.1|4593535_4593808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|4593804_4594029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026006879.1|4594025_4594298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472866.1|4594294_4594504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849275.1|4594500_4594725_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	64.3	3.4e-15
WP_078585863.1|4594724_4595912_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	52.6	9.9e-114
WP_011052523.1|4596548_4596869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921936.1|4597061_4598939_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
4597524:4597540	attR	GTTGATCGTTTCGATCA	NA	NA	NA	NA
WP_003484398.1|4599047_4599488_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_033482975.1|4599588_4600503_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_003484403.1|4600670_4601192_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_078514904.1|4601231_4601441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849278.1|4601437_4602571_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	3.6e-28
WP_003484425.1|4602709_4603186_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_016849279.1|4603182_4604688_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_016849280.1|4604972_4606031_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016849281.1|4606031_4606856_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003484433.1|4607049_4608327_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_145508715.1|4608492_4610214_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_016849283.1|4610264_4611575_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_005921922.1|4611574_4612498_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
