The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	1226476	1298384	5231646	capsid,holin,terminase,head,plate,integrase,tail,protease,portal	Stenotrophomonas_phage(55.0%)	79	1219749:1219766	1259158:1259175
1219749:1219766	attL	GGCAAGACCACGCTGCTG	NA	NA	NA	NA
WP_003490845.1|1226476_1228558_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_124632115.1|1229162_1229231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011050660.1|1229435_1230080_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016849001.1|1230348_1231647_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029828204.1|1231714_1232749_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016850314.1|1232962_1233709_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|1233739_1235206_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_033482896.1|1235401_1236226_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016850317.1|1236369_1236579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828209.1|1238197_1238617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849994.1|1238802_1239546_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011050667.1|1240025_1240568_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016849993.1|1240548_1241685_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033482898.1|1241907_1243434_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003483747.1|1243605_1245708_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_011050669.1|1245820_1247164_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.5e-29
WP_003483753.1|1247221_1247911_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_033482899.1|1248093_1249740_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005915911.1|1249889_1250198_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	3.6e-07
WP_003483760.1|1250194_1250590_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003483762.1|1250815_1251823_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_016850996.1|1251962_1252724_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_016850997.1|1253420_1254038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850998.1|1254054_1255011_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	55.3	1.7e-92
WP_078585787.1|1255235_1255457_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
WP_016850999.1|1255453_1255663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851000.1|1255659_1255863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851001.1|1255928_1256153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851002.1|1256149_1256422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014091203.1|1256414_1256597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851003.1|1256589_1256964_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	1.7e-19
WP_016849270.1|1257093_1257366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849269.1|1257365_1257653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472861.1|1257649_1257868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078585791.1|1258188_1260861_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
1259158:1259175	attR	CAGCAGCGTGGTCTTGCC	NA	NA	NA	NA
WP_016851008.1|1260893_1261106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851009.1|1261102_1261381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008572766.1|1261391_1261712_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_078537260.1|1261714_1261963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828228.1|1262048_1262480_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
WP_145592928.1|1262756_1263068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851031.1|1263086_1264073_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
WP_016851032.1|1264069_1264471_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
WP_029828231.1|1264483_1267354_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
WP_005922203.1|1267383_1267497_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029828232.1|1267505_1267808_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_016850450.1|1267853_1268363_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_145592929.1|1268392_1269559_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.9	2.5e-133
WP_016850452.1|1269570_1269930_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
WP_016850453.1|1269926_1270490_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
WP_016850454.1|1270632_1271307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850455.1|1271309_1271603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850456.1|1271676_1273476_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
WP_029828239.1|1273488_1274031_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
WP_016851159.1|1274023_1274914_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_078585788.1|1275009_1276548_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016851160.1|1276729_1277179_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
WP_016851161.1|1277166_1277586_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
WP_145592930.1|1277582_1278071_-	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	50.3	1.7e-27
WP_078585789.1|1278070_1278712_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
WP_005922189.1|1278708_1278984_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005929454.1|1278976_1279333_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|1279337_1279547_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029828243.1|1279546_1280014_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
WP_016851153.1|1280112_1280832_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
WP_029828245.1|1280835_1281849_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
WP_029828246.1|1281895_1282738_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
WP_145592931.1|1282859_1284644_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.3	1.2e-269
WP_016850658.1|1284643_1285657_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
WP_078585599.1|1285682_1285928_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
WP_029828252.1|1285845_1286547_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
WP_078585598.1|1286719_1287136_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026007262.1|1288063_1288963_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_016851285.1|1290104_1291226_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
WP_016851284.1|1292233_1292563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851283.1|1292748_1292946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851282.1|1294960_1296253_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1296345_1296972_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|1297097_1298384_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 2
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	2029839	2040676	5231646	tRNA	Micromonas_pusilla_virus(16.67%)	13	NA	NA
WP_005915030.1|2029839_2031516_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.4	1.9e-41
WP_005915033.1|2031601_2032243_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_003481871.1|2032415_2033450_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_003481873.1|2033761_2034250_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_016849897.1|2034351_2037000_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
WP_003481884.1|2037139_2037352_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_033482667.1|2037572_2037797_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_029828732.1|2037783_2038005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828734.1|2038138_2038357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828735.1|2038353_2038797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828737.1|2038793_2039012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033482666.1|2039008_2039764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828741.1|2039767_2040676_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.9	3.1e-43
>prophage 3
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	2060756	2081942	5231646	capsid,portal,tail,head	Xanthomonas_phage(21.43%)	20	NA	NA
WP_029828818.1|2060756_2061413_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	44.5	2.4e-37
WP_050595539.1|2061409_2061913_+	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.0	1.6e-20
WP_029828821.1|2061909_2062188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828826.1|2063218_2063719_+	DUF1441 family protein	NA	A0A2H4EYX7	Aeromonas_phage	38.3	3.2e-21
WP_029828829.1|2063693_2065781_+	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	42.5	2.3e-153
WP_029828831.1|2065782_2065998_+	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	41.9	8.0e-06
WP_033482662.1|2065990_2067493_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	48.3	4.2e-109
WP_029828834.1|2067482_2068886_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.9	1.2e-41
WP_033482660.1|2068888_2069560_+|head	head decoration protein	head	NA	NA	NA	NA
WP_050595538.1|2069631_2070636_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	40.8	1.6e-56
WP_029828838.1|2070683_2071460_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	34.9	7.3e-25
WP_029828840.1|2071456_2071777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828843.1|2071769_2072201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828844.1|2072240_2072984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828845.1|2072980_2073460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828847.1|2073621_2076339_+|tail	phage tail tape measure protein	tail	C4ML16	Xanthomonas_virus	34.0	2.4e-94
WP_029828849.1|2076338_2076695_+	hypothetical protein	NA	Q52PL1	Xanthomonas_phage	44.4	1.6e-19
WP_029828851.1|2076691_2077159_+	DUF1833 family protein	NA	Q52PL0	Xanthomonas_phage	46.5	8.0e-35
WP_029828853.1|2077158_2077551_+	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	52.8	4.1e-32
WP_033482658.1|2077541_2081942_+	hypothetical protein	NA	C4ML20	Xanthomonas_virus	50.7	0.0e+00
>prophage 4
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	3641945	3760700	5231646	capsid,tRNA,holin,transposase,terminase,head,plate,integrase,tail,portal	Stenotrophomonas_phage(44.68%)	117	3682938:3682982	3720965:3721009
WP_003482499.1|3641945_3642665_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003482501.1|3642678_3644703_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	6.7e-94
WP_003482503.1|3644976_3645501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482504.1|3645514_3647959_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_029829319.1|3648198_3650283_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_080573042.1|3650291_3650624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145593056.1|3650639_3652082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829322.1|3652343_3654530_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_078585717.1|3654820_3654901_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_003482510.1|3654984_3655884_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_005921461.1|3655880_3656633_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_016849287.1|3656629_3656908_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_003482516.1|3656904_3658023_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_015463489.1|3658085_3658598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849289.1|3659034_3660549_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_016849290.1|3660849_3661884_+	ROK family protein	NA	NA	NA	NA	NA
WP_016849291.1|3661984_3664621_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_145592961.1|3664837_3668959_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	27.8	7.6e-44
WP_003482535.1|3669061_3669610_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_145592962.1|3670090_3671887_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	8.9e-82
WP_005913671.1|3672025_3672523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851165.1|3672601_3673006_+	response regulator	NA	NA	NA	NA	NA
WP_005913667.1|3674271_3674382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011052054.1|3674473_3675184_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_016851168.1|3675392_3675599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145592963.1|3675750_3676065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851169.1|3676109_3678278_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_026007238.1|3678643_3679270_-	amino acid transporter	NA	NA	NA	NA	NA
WP_016851171.1|3679371_3680274_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003482555.1|3680546_3680906_-	response regulator	NA	NA	NA	NA	NA
WP_016851172.1|3680902_3681910_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016851173.1|3682184_3682859_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	33.8	4.1e-24
3682938:3682982	attL	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_026007239.1|3683127_3684327_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
WP_011038128.1|3684326_3684587_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.2e-18
WP_016851176.1|3684544_3684751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851177.1|3684747_3685020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851178.1|3685016_3685262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007240.1|3685258_3685534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851181.1|3685695_3686106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|3686184_3686448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573080.1|3686444_3686669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851184.1|3686719_3686938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573081.1|3687231_3689895_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011038118.1|3689922_3690162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038117.1|3690158_3690284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573074.1|3690462_3690774_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
WP_016851187.1|3690780_3691035_-	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_026007241.1|3691101_3691530_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
WP_080573075.1|3691836_3692301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573076.1|3692305_3692644_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.8e-07
WP_080573077.1|3692609_3693557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851189.1|3693843_3694830_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
WP_016851190.1|3694826_3695228_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_029996349.1|3695240_3698111_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
WP_005922203.1|3698140_3698254_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029996350.1|3698262_3698565_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_016851197.1|3698610_3699120_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
WP_016851114.1|3699150_3700317_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
WP_016851115.1|3700328_3700688_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
WP_016851116.1|3700684_3701248_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_080573069.1|3701326_3701602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851118.1|3701555_3702761_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
WP_026007225.1|3702764_3703313_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_144363119.1|3703305_3704196_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
WP_042761698.1|3704602_3705076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573070.1|3705087_3705912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851121.1|3706084_3706540_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.3e-37
WP_016851122.1|3706527_3706947_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
WP_016851123.1|3706943_3707432_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
WP_080671044.1|3707431_3708073_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	1.3e-48
WP_005922189.1|3708069_3708345_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005917737.1|3708337_3708694_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005917735.1|3708698_3708908_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029996352.1|3708907_3709375_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
WP_016851435.1|3709473_3710193_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
WP_029996353.1|3710196_3711213_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
WP_029996354.1|3711259_3712102_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
WP_033483117.1|3712223_3714008_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_029996356.1|3714007_3715030_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_053503138.1|3715055_3715301_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_029996358.1|3715218_3715914_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
WP_016851201.1|3715945_3716413_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_088091923.1|3716412_3717639_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016850467.1|3719645_3720131_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
WP_011038085.1|3720474_3720810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850466.1|3721246_3721930_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
3720965:3721009	attR	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_011052060.1|3721972_3722791_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003482562.1|3722797_3723316_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003482565.1|3723373_3724693_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_029829330.1|3724878_3725919_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016849299.1|3725908_3726358_-	protein TolR	NA	NA	NA	NA	NA
WP_003482569.1|3726515_3727295_-	protein TolQ	NA	NA	NA	NA	NA
WP_003482571.1|3727306_3727765_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003482572.1|3727817_3728858_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_016849298.1|3728897_3729128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921446.1|3729130_3731035_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
WP_003482577.1|3731231_3731816_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003482580.1|3731934_3732459_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482581.1|3732588_3733317_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029829331.1|3733406_3734084_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005913643.1|3734181_3734709_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016850983.1|3735131_3736898_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_029829333.1|3737056_3737800_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_016850980.1|3738749_3739034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007196.1|3739191_3739731_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
WP_098477664.1|3740003_3741106_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	7.7e-44
WP_088091918.1|3742119_3743264_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_145592964.1|3743262_3743568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124632122.1|3743601_3743997_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_070996149.1|3744382_3747877_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_124632114.1|3748184_3748676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|3748865_3750010_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124632122.1|3750559_3750955_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_145592965.1|3751340_3754529_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_124632114.1|3754836_3755328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849980.1|3756891_3758439_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_016849979.1|3759737_3760700_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	4282396	4290427	5231646		Enterobacteria_phage(42.86%)	7	NA	NA
WP_005913455.1|4282396_4283743_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_005913454.1|4283789_4285193_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
WP_016850197.1|4285475_4286642_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
WP_029829443.1|4286982_4287882_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
WP_016851441.1|4287878_4288436_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_005913450.1|4288432_4289320_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_005920787.1|4289371_4290427_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
>prophage 6
NZ_CP041963	Xanthomonas citri pv. glycines strain 1157 chromosome, complete genome	5231646	4505843	4564005	5231646	capsid,tRNA,holin,terminase,head,plate,integrase,tail,portal	Stenotrophomonas_phage(64.86%)	68	4512233:4512250	4549887:4549904
WP_145593062.1|4505843_4507034_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	57.5	2.2e-121
WP_080766532.1|4507359_4507704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145592980.1|4508692_4509349_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_145592981.1|4509383_4513385_+	hypothetical protein	NA	NA	NA	NA	NA
4512233:4512250	attL	AGCGCAGCAGCGGCCGCA	NA	NA	NA	NA
WP_145593064.1|4513317_4514061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145592983.1|4514104_4515181_-	AAA family ATPase	NA	H2BD62	Pseudomonas_phage	34.3	2.8e-38
WP_145592984.1|4515275_4515980_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.8	1.3e-105
WP_053503138.1|4515897_4516143_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_045714288.1|4516168_4517191_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	1.5e-139
WP_042773814.1|4517190_4518975_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	1.0e-271
WP_145592985.1|4519096_4519939_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	1.4e-66
WP_145592987.1|4519986_4521000_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	3.2e-137
WP_145592989.1|4521003_4521723_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.9	1.2e-69
WP_145592990.1|4521821_4522289_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	4.1e-31
WP_005917735.1|4522288_4522498_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_145592992.1|4522502_4522859_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_015471780.1|4522851_4523127_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	2.3e-21
WP_145592993.1|4523123_4523765_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	62.1	7.1e-50
WP_145592994.1|4523764_4524253_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.0	5.8e-28
WP_145592996.1|4524249_4524669_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_145592997.1|4524656_4525115_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	55.4	2.1e-35
WP_145593000.1|4525088_4526426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145593002.1|4526543_4527434_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	54.4	9.5e-85
WP_040260070.1|4527426_4527972_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.9e-51
WP_145593003.1|4527984_4529784_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.6	9.5e-84
WP_078584036.1|4529861_4530155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593005.1|4530156_4530831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040260203.1|4530973_4531537_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_040260201.1|4531533_4531893_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.9	8.6e-37
WP_008572742.1|4531904_4533071_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.7	4.2e-133
WP_016850450.1|4533100_4533610_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_145593007.1|4533655_4533958_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	9.8e-26
WP_005922203.1|4533966_4534080_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_040260197.1|4534109_4536980_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.6	3.6e-202
WP_040260195.1|4536992_4537394_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.2e-39
WP_145593009.1|4537390_4538377_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	5.5e-94
WP_145593012.1|4538983_4539415_-	XRE family transcriptional regulator	NA	E5E3P4	Burkholderia_phage	34.4	2.4e-09
WP_078537260.1|4539500_4539749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593014.1|4539751_4540072_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	4.4e-24
WP_145593016.1|4540082_4540361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593018.1|4540357_4540570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593065.1|4540603_4543276_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.0	0.0e+00
WP_015472861.1|4543596_4543815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508524.1|4543811_4544099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043104761.1|4544098_4544371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593067.1|4544560_4544875_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	50.5	6.0e-18
WP_014091203.1|4544867_4545050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040260175.1|4545042_4545315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|4545311_4545536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593069.1|4545601_4545805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145593020.1|4545801_4546011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849275.1|4546007_4546232_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	64.3	3.4e-15
WP_145593022.1|4546231_4547419_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	52.1	3.2e-112
WP_011052523.1|4548055_4548376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921936.1|4548568_4550446_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
4549887:4549904	attR	AGCGCAGCAGCGGCCGCA	NA	NA	NA	NA
WP_003484398.1|4550554_4550995_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_033482975.1|4551095_4552010_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_003484403.1|4552177_4552699_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_078514904.1|4552738_4552948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849278.1|4552944_4554078_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	3.6e-28
WP_003484425.1|4554216_4554693_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_016849279.1|4554689_4556195_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_016849280.1|4556479_4557538_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016849281.1|4557538_4558363_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003484433.1|4558556_4559834_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_016849282.1|4559999_4561721_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016849283.1|4561771_4563082_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_005921922.1|4563081_4564005_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
