The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041961	Xanthomonas citri pv. glycines strain 1018 chromosome, complete genome	5128239	1234895	1306803	5128239	portal,capsid,integrase,head,plate,protease,tail,holin,terminase	Stenotrophomonas_phage(57.5%)	78	1228168:1228185	1267577:1267594
1228168:1228185	attL	GGCAAGACCACGCTGCTG	NA	NA	NA	NA
WP_003490845.1|1234895_1236977_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_124632115.1|1237581_1237650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011050660.1|1237854_1238499_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016849001.1|1238767_1240066_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029828204.1|1240133_1241168_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016850314.1|1241381_1242128_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|1242158_1243625_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_033482896.1|1243820_1244645_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016850317.1|1244788_1244998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828209.1|1246616_1247036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849994.1|1247221_1247965_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011050667.1|1248444_1248987_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016849993.1|1248967_1250104_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033482898.1|1250326_1251853_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003483747.1|1252024_1254127_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_011050669.1|1254239_1255583_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.5e-29
WP_003483753.1|1255640_1256330_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_033482899.1|1256512_1258159_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005915911.1|1258308_1258617_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	3.6e-07
WP_003483760.1|1258613_1259009_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003483762.1|1259234_1260242_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_016850996.1|1260381_1261143_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_016850997.1|1261839_1262457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850998.1|1262473_1263430_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	55.3	1.7e-92
WP_078585787.1|1263654_1263876_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
WP_016850999.1|1263872_1264082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851000.1|1264078_1264282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851001.1|1264347_1264572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851002.1|1264568_1264841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014091203.1|1264833_1265016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851003.1|1265008_1265383_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	1.7e-19
WP_016849270.1|1265512_1265785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849269.1|1265784_1266072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472861.1|1266068_1266287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078585791.1|1266607_1269280_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
1267577:1267594	attR	CAGCAGCGTGGTCTTGCC	NA	NA	NA	NA
WP_016851008.1|1269312_1269525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851009.1|1269521_1269800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008572766.1|1269810_1270131_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_078537260.1|1270133_1270382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828228.1|1270467_1270899_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
WP_016851031.1|1271505_1272492_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
WP_016851032.1|1272488_1272890_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
WP_029828231.1|1272902_1275773_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
WP_005922203.1|1275802_1275916_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029828232.1|1275924_1276227_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_016850450.1|1276272_1276782_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_029828235.1|1276811_1277978_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	1.1e-133
WP_016850452.1|1277989_1278349_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
WP_016850453.1|1278345_1278909_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
WP_016850454.1|1279051_1279726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850455.1|1279728_1280022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850456.1|1280095_1281895_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
WP_029828239.1|1281907_1282450_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
WP_016851159.1|1282442_1283333_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_078585788.1|1283428_1284967_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016851160.1|1285148_1285598_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
WP_016851161.1|1285585_1286005_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
WP_016851162.1|1286001_1286490_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	1.2e-28
WP_078585789.1|1286489_1287131_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
WP_005922189.1|1287127_1287403_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005929454.1|1287395_1287752_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|1287756_1287966_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029828243.1|1287965_1288433_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
WP_016851153.1|1288531_1289251_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
WP_029828245.1|1289254_1290268_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
WP_029828246.1|1290314_1291157_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
WP_033482900.1|1291278_1293063_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.5	7.3e-270
WP_016850658.1|1293062_1294076_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
WP_078585599.1|1294101_1294347_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
WP_029828252.1|1294264_1294966_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
WP_078585598.1|1295138_1295555_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026007262.1|1296482_1297382_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_016851285.1|1298523_1299645_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
WP_016851284.1|1300652_1300982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851283.1|1301167_1301365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851282.1|1303379_1304672_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1304764_1305391_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|1305516_1306803_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 2
NZ_CP041961	Xanthomonas citri pv. glycines strain 1018 chromosome, complete genome	5128239	3596032	3719386	5128239	portal,capsid,transposase,integrase,head,plate,tRNA,tail,holin,terminase	Stenotrophomonas_phage(45.65%)	115	3637025:3637069	3675061:3675105
WP_003482499.1|3596032_3596752_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003482501.1|3596765_3598790_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	6.7e-94
WP_003482503.1|3599063_3599588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482504.1|3599601_3602046_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_029829319.1|3602285_3604370_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_080573042.1|3604378_3604711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829321.1|3604726_3606169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829322.1|3606430_3608617_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_078585717.1|3608907_3608988_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_003482510.1|3609071_3609971_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_005921461.1|3609967_3610720_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_016849287.1|3610716_3610995_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_003482516.1|3610991_3612110_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_015463489.1|3612172_3612685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849289.1|3613121_3614636_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_016849290.1|3614936_3615971_+	ROK family protein	NA	NA	NA	NA	NA
WP_016849291.1|3616071_3618708_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_029829327.1|3618924_3623046_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.4	2.0e-44
WP_003482535.1|3623148_3623697_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011052052.1|3624177_3625974_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	1.5e-81
WP_005913671.1|3626112_3626610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851165.1|3626688_3627093_+	response regulator	NA	NA	NA	NA	NA
WP_005913667.1|3628358_3628469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011052054.1|3628560_3629271_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_016851168.1|3629479_3629686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144363121.1|3629837_3630152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144363120.1|3630196_3632365_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_026007238.1|3632730_3633357_-	amino acid transporter	NA	NA	NA	NA	NA
WP_016851171.1|3633458_3634361_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003482555.1|3634633_3634993_-	response regulator	NA	NA	NA	NA	NA
WP_016851172.1|3634989_3635997_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016851173.1|3636271_3636946_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	33.8	4.1e-24
3637025:3637069	attL	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_026007239.1|3637223_3638423_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
WP_011038128.1|3638422_3638683_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.2e-18
WP_016851176.1|3638640_3638847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851177.1|3638843_3639116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851178.1|3639112_3639358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007240.1|3639354_3639630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851181.1|3639791_3640202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|3640280_3640544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573080.1|3640540_3640765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851184.1|3640815_3641034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573081.1|3641327_3643991_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011038118.1|3644018_3644258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038117.1|3644254_3644380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573074.1|3644558_3644870_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
WP_016851187.1|3644876_3645131_-	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_026007241.1|3645197_3645626_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
WP_080573075.1|3645932_3646397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573076.1|3646401_3646740_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.8e-07
WP_080573077.1|3646705_3647653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851189.1|3647939_3648926_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
WP_016851190.1|3648922_3649324_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_029996349.1|3649336_3652207_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
WP_005922203.1|3652236_3652350_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029996350.1|3652358_3652661_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_016851197.1|3652706_3653216_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
WP_016851114.1|3653246_3654413_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
WP_016851115.1|3654424_3654784_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
WP_016851116.1|3654780_3655344_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_080573069.1|3655422_3655698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851118.1|3655651_3656857_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
WP_026007225.1|3656860_3657409_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_144363119.1|3657401_3658292_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
WP_042761698.1|3658698_3659172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573070.1|3659183_3660008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144363117.1|3660180_3660636_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.7e-37
WP_016851122.1|3660623_3661043_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
WP_016851123.1|3661039_3661528_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
WP_080671044.1|3661527_3662169_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	1.3e-48
WP_005922189.1|3662165_3662441_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005917737.1|3662433_3662790_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005917735.1|3662794_3663004_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029996352.1|3663003_3663471_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
WP_016851435.1|3663569_3664289_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
WP_029996353.1|3664292_3665309_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
WP_029996354.1|3665355_3666198_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
WP_033483117.1|3666319_3668104_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_029996356.1|3668103_3669126_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_053503138.1|3669151_3669397_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_029996358.1|3669314_3670010_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
WP_016851201.1|3670041_3670509_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_088091923.1|3670508_3671735_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016850467.1|3673741_3674227_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
WP_011038085.1|3674570_3674906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850466.1|3675342_3676026_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
3675061:3675105	attR	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_011052060.1|3676068_3676887_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003482562.1|3676893_3677412_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003482565.1|3677469_3678789_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_029829330.1|3678974_3680015_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016849299.1|3680004_3680454_-	protein TolR	NA	NA	NA	NA	NA
WP_003482569.1|3680611_3681391_-	protein TolQ	NA	NA	NA	NA	NA
WP_003482571.1|3681402_3681861_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003482572.1|3681913_3682954_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_016849298.1|3682993_3683224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921446.1|3683226_3685131_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
WP_003482577.1|3685327_3685912_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003482580.1|3686030_3686555_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482581.1|3686684_3687413_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029829331.1|3687502_3688180_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005913643.1|3688277_3688805_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016850983.1|3689227_3690994_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_029829333.1|3691152_3691896_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_016850980.1|3692844_3693129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007196.1|3693286_3693826_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
WP_098477664.1|3694098_3695201_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	7.7e-44
WP_087943921.1|3696214_3697359_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_124632122.1|3697908_3698304_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_145525914.1|3698689_3702184_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_124632114.1|3702491_3702983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849979.1|3707390_3708353_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
WP_026007111.1|3710648_3711926_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_005913639.1|3712237_3712531_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003489572.1|3712987_3714232_+	MFS transporter	NA	NA	NA	NA	NA
WP_029996360.1|3717235_3719386_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 3
NZ_CP041961	Xanthomonas citri pv. glycines strain 1018 chromosome, complete genome	5128239	4231285	4243055	5128239		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913455.1|4231285_4232632_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_005913454.1|4232678_4234082_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
WP_016850197.1|4234364_4235531_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
WP_029829443.1|4235871_4236771_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
WP_016851441.1|4236767_4237325_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_005913450.1|4237321_4238209_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_005920787.1|4238260_4239316_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
WP_016851442.1|4239535_4240282_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_016851443.1|4240281_4241226_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_144363104.1|4241389_4242118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005913435.1|4242098_4243055_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
