The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	1058208	1065348	4753449		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1058208_1058847_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590391.1|1058843_1060106_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	9.8e-136
WP_000847985.1|1060102_1061011_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1061206_1061974_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1062024_1062681_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1062786_1065348_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	1412037	1483073	4753449	portal,tail,plate,head,capsid,transposase,integrase,terminase,tRNA,protease,lysis	Shigella_phage(39.22%)	85	1409557:1409573	1454531:1454547
1409557:1409573	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1412037_1413471_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1413686_1414601_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|1414672_1415920_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1416449_1416650_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281200.1|1416774_1417119_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000120062.1|1417361_1417964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1418174_1418396_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001443983.1|1418494_1418776_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1418786_1418978_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1418950_1419133_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1419129_1419810_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1419806_1420592_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|1420597_1420894_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|1420968_1421112_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1421080_1421245_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065364.1|1421317_1421686_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_023156163.1|1421889_1422069_-	hypothetical protein	NA	M1FQU1	Enterobacteria_phage	98.3	1.5e-29
WP_085949154.1|1422370_1423518_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001204777.1|1423756_1424134_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|1424289_1424814_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|1425006_1425966_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_124038808.1|1426101_1426299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|1427300_1428447_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000839582.1|1428488_1428704_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135280.1|1428703_1429201_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|1429417_1429600_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001442258.1|1429690_1429984_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001337714.1|1430076_1430217_+	hypothetical protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
WP_001135213.1|1430508_1430859_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
WP_000929184.1|1430984_1431479_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_122986317.1|1431712_1433209_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_000605605.1|1433220_1433403_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_000466250.1|1433402_1434644_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_001442257.1|1434621_1435272_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000257499.1|1435286_1436492_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.0e-223
WP_000601360.1|1436541_1436742_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1436744_1437068_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702401.1|1437064_1437475_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000224835.1|1437449_1437956_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779292.1|1437952_1438513_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497753.1|1438521_1438692_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000155723.1|1438675_1440172_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.4	1.8e-277
WP_000090998.1|1440171_1440528_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|1440527_1440797_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_001314907.1|1440763_1440946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807204.1|1440938_1442774_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	1.4e-305
WP_000219916.1|1442834_1444163_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.2	3.0e-244
WP_000999503.1|1444159_1445239_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_000643722.1|1445238_1445787_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	1.8e-94
WP_000424728.1|1445786_1446212_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000785301.1|1446198_1447257_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000383556.1|1447247_1447832_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_000554702.1|1447835_1448759_+	hypothetical protein	NA	U5P0I1	Shigella_phage	84.0	2.4e-51
WP_000959491.1|1449338_1449926_-	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_000958707.1|1450119_1451277_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.4	3.8e-219
WP_000368131.1|1451588_1452521_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|1452814_1453570_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937819.1|1453751_1454810_-	hypothetical protein	NA	NA	NA	NA	NA
1454531:1454547	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|1455176_1456517_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1456888_1457173_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|1457352_1458663_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425062.1|1458662_1460807_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1461009_1461495_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|1462169_1462733_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112828.1|1462814_1465457_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_023156245.1|1465476_1466229_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000678664.1|1466245_1466752_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001433496.1|1466723_1466840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096096285.1|1466790_1467219_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|1467215_1467740_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001323815.1|1467741_1468599_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|1468720_1469272_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001295704.1|1469437_1470370_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|1470404_1471490_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043821.1|1471493_1472318_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447356.1|1472317_1473127_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|1473126_1473675_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1473708_1473987_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1474107_1476114_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1476272_1477493_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127749.1|1477776_1478955_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1478951_1479947_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699121.1|1480045_1481182_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_001289165.1|1481247_1482261_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|1482260_1483073_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	1682644	1692086	4753449		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569327.1|1682644_1683571_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1683575_1684307_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1684287_1684395_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1684454_1685186_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1685407_1687093_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1687089_1687809_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001442361.1|1687855_1688326_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	6.7e-82
WP_001295429.1|1688366_1688828_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1688952_1690953_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1690949_1692086_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	2248812	2312406	4753449	portal,tail,holin,integrase,terminase,protease,lysis	Enterobacteria_phage(40.0%)	72	2260993:2261008	2298520:2298535
WP_001260855.1|2248812_2249634_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2249733_2249817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2249909_2250245_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091819.1|2250641_2251895_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2252001_2252895_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2253029_2254250_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2254374_2255070_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071524606.1|2255022_2256315_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2256473_2257088_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526477.1|2257130_2257985_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2257986_2258604_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001515050.1|2258614_2261038_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
2260993:2261008	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_000041554.1|2261098_2263525_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|2263723_2264029_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2264136_2264847_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2264849_2265410_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2265444_2265786_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2265920_2266247_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2266452_2267667_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|2267678_2268698_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_072133799.1|2268755_2268866_+	transporter	NA	NA	NA	NA	NA
WP_000877001.1|2268885_2270166_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2270200_2270437_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048357.1|2270524_2272996_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2273089_2273281_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000783095.1|2273277_2273466_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|2273952_2274528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2274529_2274685_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|2274877_2275285_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2275362_2275590_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2275573_2276095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054496.1|2276075_2277041_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151185.1|2277081_2277507_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	5.4e-62
WP_023156363.1|2277879_2278587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402181.1|2278596_2278863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124062061.1|2279239_2279431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112017485.1|2279507_2279702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000096969.1|2280095_2281445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122653675.1|2281868_2281976_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000813254.1|2282078_2282234_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000981001.1|2282450_2282702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032190755.1|2282768_2283047_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.8e-11
WP_001265024.1|2283048_2284104_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	3.2e-87
WP_000140005.1|2284104_2284485_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.7e-35
WP_000762931.1|2284481_2285303_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000839572.1|2285738_2285954_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193284.1|2285958_2286303_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.1e-36
WP_000369848.1|2286268_2286541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992051.1|2286646_2287189_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.2	9.5e-96
WP_000700650.1|2287185_2287722_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	4.2e-72
WP_000085745.1|2287890_2288583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|2289154_2289649_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001700320.1|2289648_2291751_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|2291747_2291960_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077688660.1|2291887_2293468_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	2.4e-288
WP_001360054.1|2293412_2295440_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|2295526_2295850_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_023156367.1|2295842_2296118_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	97.8	2.5e-44
WP_000677108.1|2296129_2296708_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2296704_2297106_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|2297117_2297861_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|2297921_2298308_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_023156369.1|2298316_2298646_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	8.4e-55
2298520:2298535	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_023156370.1|2298617_2301683_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447247.1|2301682_2302012_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|2302021_2302720_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_024170790.1|2302725_2303469_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_000090847.1|2303405_2304008_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_144114341.1|2304068_2307563_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_032236520.1|2307630_2308230_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.7e-106
WP_144114342.1|2308294_2311825_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_001613101.1|2311824_2312406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
>prophage 5
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	3119211	3129400	4753449	transposase	Shigella_phage(50.0%)	10	NA	NA
WP_023156184.1|3119211_3119472_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	6.2e-37
WP_023156185.1|3119561_3121559_-	hypothetical protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_023156186.1|3121558_3122947_-	hypothetical protein	NA	A0A220NR03	Salmonella_phage	64.2	2.9e-149
WP_077695480.1|3122956_3123631_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.4	1.4e-80
WP_023156188.1|3123651_3124107_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	2.6e-86
WP_023156189.1|3124106_3124955_-	hypothetical protein	NA	Q716G6	Shigella_phage	91.8	2.9e-99
WP_023156190.1|3124954_3126373_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	2.1e-275
WP_023156191.1|3126381_3126864_-	hypothetical protein	NA	Q9AYZ5	Salmonella_phage	98.8	2.7e-86
WP_000375637.1|3126838_3127024_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_085949154.1|3128252_3129400_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 6
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	3346773	3405526	4753449	portal,tail,capsid,head,transposase,integrase,terminase,tRNA,protease,lysis	Enterobacteria_phage(48.89%)	62	3355254:3355300	3395319:3395365
WP_000420935.1|3346773_3347910_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383946.1|3348178_3350416_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3350402_3353375_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3353375_3354266_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3354448_3355210_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3355254:3355300	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3355722_3356676_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|3356862_3358347_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3358530_3358836_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|3358892_3359561_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3359926_3360040_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3360108_3360342_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|3360658_3361249_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|3361346_3361922_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279163.1|3361921_3364882_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_001233071.1|3364946_3365546_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_041520804.1|3365616_3369030_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090895.1|3369090_3369723_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|3369659_3370403_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|3370408_3371107_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3371106_3371436_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001774776.1|3371432_3374012_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000459457.1|3374004_3374439_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|3374420_3374843_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_023566742.1|3374858_3375599_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	5.6e-131
WP_000683125.1|3375606_3376002_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	6.5e-70
WP_000975086.1|3375998_3376577_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000752996.1|3376588_3376942_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_023566743.1|3376953_3377349_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	7.4e-58
WP_023156389.1|3377390_3378416_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.5e-187
WP_001549228.1|3378471_3378804_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123333.1|3378813_3380133_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001324962.1|3380113_3381715_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000198149.1|3381711_3381918_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_023156388.1|3381914_3383840_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453603.1|3383814_3384360_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001663509.1|3384748_3384982_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_001537735.1|3385040_3385451_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001059339.1|3385753_3386278_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139682.1|3386480_3386633_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_024175646.1|3386661_3386868_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	91.2	4.2e-28
WP_000255946.1|3387077_3388100_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|3388096_3388879_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_021534987.1|3389043_3389541_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_000839596.1|3389540_3389756_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|3390329_3391427_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_085949154.1|3391749_3392897_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_144114352.1|3392865_3393045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443983.1|3393018_3393300_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3393398_3393617_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3393664_3393943_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3393914_3394286_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|3394141_3395305_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|3395639_3396272_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3395319:3395365	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250423.1|3396274_3396790_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691058.1|3396800_3397808_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001442278.1|3397820_3400430_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988366.1|3400460_3401153_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3401372_3401915_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|3402395_3403262_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3403263_3403476_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3403583_3404105_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3404140_3405526_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 7
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	3667542	3682919	4753449	integrase	Enterobacteria_phage(81.82%)	15	3671071:3671084	3684776:3684789
WP_000667026.1|3667542_3669741_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121356.1|3669750_3670707_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3670685_3671096_+	transcriptional regulator	NA	NA	NA	NA	NA
3671071:3671084	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_144114355.1|3671713_3674047_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|3674061_3674382_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459307.1|3674517_3674973_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_001244665.1|3674965_3675253_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_144114356.1|3675245_3675845_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.0	1.7e-50
WP_001149160.1|3675841_3676108_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_144114357.1|3676658_3677393_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.1	4.4e-128
WP_000984201.1|3677389_3677635_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_144114358.1|3677649_3678222_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.4	1.5e-96
WP_024236189.1|3678425_3680048_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.8	3.1e-09
WP_021546002.1|3680044_3681748_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021546001.1|3681749_3682919_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	9.7e-146
3684776:3684789	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
>prophage 8
NZ_CP041919	Escherichia coli strain Ec40743 chromosome, complete genome	4753449	4421068	4522570	4753449	portal,tail,plate,head,capsid,holin,integrase,tRNA,terminase,protease,lysis	Escherichia_phage(33.33%)	100	4486202:4486248	4519782:4519828
WP_000187022.1|4421068_4422169_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4422208_4422568_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_122985946.1|4422567_4423218_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4423548_4424949_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4424931_4425849_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_000382180.1|4426100_4427384_-	MFS transporter	NA	NA	NA	NA	NA
WP_000690934.1|4427450_4428665_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
WP_001230081.1|4429162_4430536_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4430596_4431373_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4431380_4432385_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001295506.1|4432538_4433690_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005579.1|4434041_4436693_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556296.1|4436875_4438609_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274608.1|4438757_4439609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|4439595_4439937_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204101.1|4439938_4440817_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184826.1|4440782_4443080_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4443130_4443451_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4443465_4444545_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174095.1|4444853_4447355_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4447366_4448029_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000349589.1|4448039_4449143_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|4449417_4450035_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001297632.1|4450061_4450967_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|4451060_4453241_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4453569_4454460_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4454808_4457241_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001352864.1|4457243_4458404_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4458680_4458998_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797342.1|4459181_4459790_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_144114359.1|4461021_4465206_-	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	2.3e-24
WP_000710769.1|4465365_4465578_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001350069.1|4465780_4467979_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4468134_4469160_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|4469251_4470211_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4470303_4470834_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|4470843_4472175_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4472241_4473168_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4473260_4473746_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4473830_4474076_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4474500_4475346_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4475368_4476877_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4477012_4478023_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|4478119_4478866_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4478870_4479299_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4479325_4479625_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4479836_4480277_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4480377_4480977_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4481084_4481852_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708994.1|4481906_4482662_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045687.1|4482768_4483758_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4484077_4485040_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4485220_4486123_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4486202:4486248	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4486359_4486578_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882966.1|4486659_4487823_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_023156265.1|4487822_4488302_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	1.3e-83
WP_023156266.1|4488316_4490764_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	99.4	0.0e+00
WP_000785970.1|4490756_4490876_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4490908_4491184_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4491240_4491759_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_023156267.1|4491771_4492962_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_023156269.1|4493284_4494325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023156270.1|4494488_4495016_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	9.8e-90
WP_041520905.1|4495019_4497149_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	55.9	2.8e-143
WP_023156273.1|4497159_4497690_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	5.6e-101
WP_001121474.1|4497682_4498591_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127163.1|4498595_4498943_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_023156274.1|4498939_4499575_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	2.9e-112
WP_023156275.1|4499652_4500408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023156276.1|4500404_4500863_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.4	2.4e-44
WP_000917188.1|4500855_4501323_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_072134039.1|4501285_4501459_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_021038205.1|4501430_4501856_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	4.7e-66
WP_023156278.1|4501843_4502269_-	hypothetical protein	NA	Q858W1	Yersinia_virus	88.7	5.5e-59
WP_001144101.1|4502283_4502781_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4502780_4503062_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|4503065_4503269_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_023156279.1|4503268_4503778_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	99.4	7.3e-90
WP_024175633.1|4503877_4504621_-|terminase	terminase endonuclease subunit	terminase	Q83VT2	Escherichia_phage	99.6	8.1e-122
WP_023156281.1|4504624_4505698_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	2.5e-201
WP_001085948.1|4505756_4506611_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_144114360.1|4506784_4508557_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_023156283.1|4508556_4509591_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	6.0e-200
WP_023156284.1|4509892_4511905_-	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	32.6	5.8e-05
WP_023156285.1|4511909_4512938_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.6	6.7e-50
WP_023156286.1|4513205_4513430_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	88.5	8.8e-24
WP_023156287.1|4513429_4513882_-	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	96.6	2.0e-78
WP_023156288.1|4513860_4516167_-	replication endonuclease	NA	Q858T4	Yersinia_virus	98.2	0.0e+00
WP_023156289.1|4516156_4516432_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	95.6	3.6e-43
WP_001113264.1|4516428_4516653_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_023156290.1|4516652_4516955_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	6.1e-44
WP_000557703.1|4516954_4517179_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_144114361.1|4517242_4517743_-	replication protein B	NA	M1SV55	Escherichia_phage	99.4	7.6e-92
WP_001308180.1|4517739_4517937_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	7.3e-30
WP_001308179.1|4517912_4518185_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4518321_4518615_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4518684_4519665_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4519851_4520352_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4519782:4519828	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4520501_4521200_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4521196_4522570_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP041920	Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence	122471	19005	51688	122471	transposase,bacteriocin,protease,integrase	Escherichia_phage(33.33%)	38	18953:19012	44588:45408
18953:19012	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067858.1|19005_19710_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_094932091.1|19746_20583_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|20576_20924_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|21129_21918_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|22048_22522_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|22679_23693_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|23895_24246_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_073520228.1|24581_25286_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
WP_050491481.1|25310_25760_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	2.5e-49
WP_001138064.1|25762_28729_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_031610367.1|28737_29154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334656.1|29288_29522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|29630_29897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|29896_30391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|30446_31049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132019.1|31402_32749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|33027_34908_+	colicin	NA	NA	NA	NA	NA
WP_000762580.1|34925_35273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|35391_35739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|35756_36347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|36343_36604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072657438.1|36706_36904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|37174_37525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796228.1|37568_38258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016493.1|38254_39046_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|39223_39577_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|39626_40442_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000203272.1|40685_41213_+	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|41570_41852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|42315_42552_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001067858.1|43889_44594_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_144114364.1|45651_46602_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	99.3	1.7e-172
44588:45408	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGGACTTTTCAAGTCTCGGAAGGTTTCTTCAATCTGCATTCGCTTCGAATAGATATTAACAAGTTGTTTGGGTGTTCGAATTTCAACAGGTAAGTTAGTTGCTAGAACCCATGGCTCCTTTGCCGACGCTGAGTAGATTTTAGGTGACGGGTGGTGACAATGAGTCCGTGTCGAGCGCTGATTTTTTCGGCCTTTAGAGCGAGATTTATACAATAGAATTTGGCATGAGATTGGATTGCTTTTAGTCAGCCTCTTATAGCCTAAAGTCTTTGAGTGACTAGATGACATATCATGTAAGTTGCTGATAGGTTTCCAGTTTTCCGCTCCTAGGTCTGCATATTGTACTTTTCCTCTTACTCGACTTAACCAGTACCAACCCAGCTTCTCAACGGATTTATACCATGGCACTTTAAAGCCAGCATCACTGACAATGAGCGGTGTGGTGTTACTCGGTAGAATGCTCGCAAGGTCGGCTAGAAATTGGTCATGAGCTTTCTTTGAACATTGCTCTGAAAGCGGGAACGCTTTCTCATAAAGAGTAACAGAACGACCGTGTAGTGCGACTGAAGCTCGCAATACCATAAGTCGTTTTTGCTCACGAATATCAGACCAGTCAACAAGTACAATGGGCATCGTATTGCCCGAACAGATAAAGCTAGCATGCCAACGGTATACAGCGAGTCGCTCTTTGTGGAGGTGACGATTACCTAACAATCGGTCGATTCGTTTGATGTTATGTTTTGTTCTCGCTTTGGTTGGCAGG	NA	NA	NA	NA
WP_001067858.1|46611_47316_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|47618_48479_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001262765.1|48755_50066_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000439434.1|50350_50683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|50684_50942_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|51034_51688_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP041921	Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence	65845	0	1905	65845	integrase	Pseudomonas_phage(100.0%)	2	NA	NA
WP_034169411.1|115_541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000486716.1|780_1905_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	40.1	3.0e-43
>prophage 2
NZ_CP041921	Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence	65845	25220	25502	65845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000638823.1|25220_25502_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.2	2.2e-24
>prophage 3
NZ_CP041921	Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence	65845	31027	31981	65845		Tupanvirus(100.0%)	1	NA	NA
WP_072089442.1|31027_31981_-	SPFH/Band 7/PHB domain protein	NA	A0A2K9L3L2	Tupanvirus	29.5	6.1e-21
>prophage 4
NZ_CP041921	Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence	65845	37695	50084	65845	transposase	Salmonella_phage(25.0%)	24	NA	NA
WP_015387337.1|37695_38361_-	P-loop NTPase	NA	A4JWV7	Burkholderia_virus	37.5	1.3e-06
WP_001025393.1|38947_39463_+	J domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	40.6	7.3e-05
WP_001083904.1|39566_40109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001230709.1|40105_40360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151456.1|40356_40599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393253.1|40735_41068_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_087587947.1|41114_41990_-	class A extended-spectrum beta-lactamase CTX-M-199	NA	A0A1B0VBP7	Salmonella_phage	90.3	1.1e-138
WP_000608644.1|42242_43505_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_072643818.1|43889_44195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855120.1|44263_44593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001419744.1|44799_45087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427403.1|45173_45497_+	hypothetical protein	NA	A0A0F6WCW0	Sinorhizobium_phage	46.5	4.6e-13
WP_000866036.1|45538_45748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814381.1|45844_46069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000702247.1|46120_46381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132407.1|46370_46622_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015057144.1|46533_46845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525236.1|46863_47085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545938.1|47171_47450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681608.1|47869_48136_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.4	8.9e-15
WP_001481829.1|48242_48425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833470.1|48982_49165_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000466318.1|49189_49627_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	34.7	9.5e-14
WP_063078684.1|49757_50084_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	90.3	2.4e-25
>prophage 5
NZ_CP041921	Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence	65845	60713	62879	65845		Streptococcus_phage(100.0%)	1	NA	NA
WP_143830450.1|60713_62879_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.4	3.9e-31
>prophage 1
NZ_CP041922	Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence	96668	4124	88266	96668	transposase,holin,tail,head,integrase	Escherichia_phage(72.73%)	93	7675:7696	54203:54224
WP_001697749.1|4124_4589_-	hypothetical protein	NA	Q71TB7	Escherichia_phage	98.7	4.3e-89
WP_061356656.1|7304_8342_-	antirepressor	NA	Q71TN2	Escherichia_phage	92.5	1.8e-172
7675:7696	attL	TCGGCAGCCAGGCGTAGGGCTT	NA	NA	NA	NA
WP_072033176.1|8338_8560_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	100.0	5.3e-37
WP_001484178.1|8593_8764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000039791.1|9182_9695_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_072661242.1|9698_10238_+	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	99.4	1.2e-45
WP_000188920.1|10318_10885_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_000523980.1|10895_11507_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_072661241.1|11521_12403_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	98.6	4.1e-173
WP_072833027.1|12484_15877_+	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	95.9	0.0e+00
WP_000002800.1|15876_16233_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047923.1|16229_17663_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_001189838.1|17662_18499_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_001286326.1|18577_19012_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_144114368.1|19023_22044_+|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	94.8	0.0e+00
WP_063117167.1|22043_22622_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_124842119.1|22665_23238_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_024235795.1|23726_24260_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	3.5e-95
WP_144114369.1|24262_25783_-|tail	phage tail protein	tail	A0A222YYI1	Escherichia_phage	91.3	1.7e-275
WP_029401675.1|25830_26391_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	99.5	4.7e-98
WP_000332810.1|26518_26800_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
WP_000887652.1|26867_27197_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580770.1|27193_27637_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_029401676.1|27623_28226_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.0	3.0e-98
WP_029401677.1|28227_30147_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_029401678.1|30143_30509_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	2.3e-45
WP_089477056.1|30521_33509_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_001165932.1|33498_33810_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_000724558.1|34551_35664_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	96.0	4.6e-198
WP_000068862.1|35897_36386_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_001345478.1|36555_37113_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_071600712.1|37248_37425_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	96.6	7.2e-29
WP_000132937.1|37404_38424_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_024200402.1|38416_40126_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_089477057.1|40201_46969_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.9	0.0e+00
WP_000224043.1|47002_47443_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|47439_47688_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_033545800.1|47749_48700_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_089477058.1|48742_49384_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	92.0	1.3e-107
WP_000848375.1|49572_50133_-	Ref family protein	NA	A0A077SL37	Escherichia_phage	100.0	5.0e-100
WP_001224236.1|50380_50692_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
WP_000067530.1|50742_51774_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	100.0	9.9e-195
WP_000542336.1|51781_52003_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_001312283.1|52414_52528_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|52546_52642_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|52607_52817_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|52927_53779_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_085949154.1|54361_55509_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
54203:54224	attR	TCGGCAGCCAGGCGTAGGGCTT	NA	NA	NA	NA
WP_001561086.1|55869_56913_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.4	2.5e-206
WP_000113018.1|56940_57120_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_024236459.1|57124_57505_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	2.5e-63
WP_001190712.1|57504_57726_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506727.1|57798_58188_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	98.4	1.1e-69
WP_001133670.1|58362_58935_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	100.0	6.7e-108
WP_024134677.1|59346_59544_-	hypothetical protein	NA	Q71TI2	Escherichia_phage	98.5	7.5e-27
WP_001261544.1|59854_60217_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_077252779.1|60213_60822_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	68.0	2.4e-63
WP_129467571.1|61276_61540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144114370.1|61713_62346_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	78.6	3.8e-80
WP_032243331.1|62364_63093_-	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	58.2	3.5e-77
WP_001774486.1|63234_63495_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	98.8	1.5e-43
WP_000675643.1|63487_64069_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
WP_072661257.1|64263_64770_-	3'-phosphatase	NA	A0A077SK53	Escherichia_phage	98.2	1.2e-92
WP_000107675.1|64842_66105_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	7.8e-234
WP_000267620.1|66106_66325_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_000684870.1|66406_67108_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.1	1.7e-142
WP_001354545.1|67104_67782_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484110.1|67778_68405_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_012817939.1|68302_68965_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000096174.1|68906_69062_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943607.1|69128_69707_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000840931.1|69709_69955_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|70101_70479_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141915.1|70488_71706_+	hypothetical protein	NA	Q71T88	Escherichia_phage	100.0	1.4e-224
WP_000896801.1|71709_72438_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602717.1|72424_73210_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212025.1|73211_74228_+	hypothetical protein	NA	Q1MVH7	Enterobacteria_phage	100.0	3.5e-192
WP_000535208.1|74220_74853_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_023155375.1|74899_75898_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	1.4e-193
WP_001276603.1|75897_77262_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_000234831.1|77734_77899_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_000900640.1|77898_78324_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_001068935.1|78515_78707_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_024134673.1|79095_79281_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
WP_000660973.1|80078_82343_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.4	0.0e+00
WP_000472529.1|82339_83245_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|83237_83522_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001311689.1|83796_83976_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_089477060.1|83984_84773_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	1.9e-121
WP_000007769.1|84812_85235_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_001393253.1|85636_85969_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_015387340.1|86015_86891_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001310555.1|87249_88266_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
