The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041763	Gordonia sp. HY186 chromosome, complete genome	3233079	1188675	1225140	3233079	protease,integrase,capsid	Mycobacterium_phage(12.5%)	33	1188500:1188525	1197367:1197392
1188500:1188525	attL	GGTGCCCCCGGCAGGACTCGAACCTG	NA	NA	NA	NA
WP_143965380.1|1188675_1189809_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	39.5	9.0e-64
WP_143965381.1|1190896_1192009_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143965382.1|1192231_1192705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965383.1|1192701_1192902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965384.1|1192980_1193274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965385.1|1193388_1193610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965386.1|1193779_1194061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965387.1|1194053_1194533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965388.1|1194665_1195517_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_143965389.1|1196712_1197096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143965390.1|1197516_1199577_+	copper resistance protein CopD	NA	NA	NA	NA	NA
1197367:1197392	attR	GGTGCCCCCGGCAGGACTCGAACCTG	NA	NA	NA	NA
WP_132993827.1|1199583_1199904_-	TIGR02611 family protein	NA	NA	NA	NA	NA
WP_132993720.1|1200344_1202018_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.4	9.5e-46
WP_143965391.1|1202084_1206587_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_132993718.1|1206612_1207095_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_132993826.1|1207124_1207802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965392.1|1207823_1209449_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_132993716.1|1209471_1209864_-	globin	NA	NA	NA	NA	NA
WP_132993715.1|1210020_1210269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965393.1|1210255_1210723_+	DUF5130 family protein	NA	NA	NA	NA	NA
WP_143965394.1|1210738_1212340_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_143965395.1|1212361_1214947_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.3	7.3e-45
WP_132993711.1|1215003_1215507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143965396.1|1215583_1216192_+	DsbA family protein	NA	NA	NA	NA	NA
WP_143965397.1|1216188_1217211_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_143965398.1|1217225_1217705_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_132993707.1|1217719_1218514_+	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	25.6	1.6e-11
WP_143965399.1|1218577_1219492_+	PE-PPE domain-containing protein	NA	A0A1C9EHZ6	Gordonia_phage	32.7	2.3e-09
WP_132993705.1|1219584_1220295_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_143965400.1|1220757_1222176_+	trigger factor	NA	NA	NA	NA	NA
WP_132993704.1|1222438_1223017_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	2.5e-38
WP_132993703.1|1223067_1223748_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	39.6	3.5e-31
WP_132993702.1|1223862_1225140_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.8	1.1e-142
>prophage 2
NZ_CP041763	Gordonia sp. HY186 chromosome, complete genome	3233079	2255400	2264119	3233079		Yellowstone_lake_phycodnavirus(16.67%)	7	NA	NA
WP_143965625.1|2255400_2258316_+	DEAD/DEAH box helicase family protein	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	27.9	1.8e-39
WP_143965626.1|2258312_2259098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143965627.1|2259156_2260152_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	84.3	7.7e-152
WP_132991813.1|2260208_2262404_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.7	1.1e-211
WP_143965628.1|2262430_2262919_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	Q4Z9B0	Staphylococcus_phage	30.4	3.5e-09
WP_132991815.1|2262929_2263163_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	65.8	1.7e-22
WP_132991816.1|2263561_2264119_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	31.0	9.3e-06
