The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	886454	904954	4855239	tRNA,integrase,tail	Morganella_phage(27.27%)	22	882296:882309	897528:897541
882296:882309	attL	ACGGCGTAAACGCG	NA	NA	NA	NA
WP_010989230.1|886454_887552_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003339.1|887562_889080_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_000133999.1|889155_889701_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244323.1|889965_890724_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_001131482.1|891041_892268_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	5.0e-145
WP_000884061.1|892404_892722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929410.1|892739_893198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133422.1|893446_893644_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	6.6e-07
WP_000412530.1|893643_894078_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	1.5e-30
WP_000151280.1|894091_894679_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	53.9	1.6e-48
WP_122815458.1|894720_895467_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001024423.1|895463_895727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064544.1|895723_895924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064170.1|895920_896547_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.6	2.9e-24
WP_000628971.1|896556_896904_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	62.2	6.2e-32
WP_001244101.1|896896_899653_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.5	7.7e-303
897528:897541	attR	ACGGCGTAAACGCG	NA	NA	NA	NA
WP_000126707.1|899991_900438_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000245846.1|900449_900725_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000676494.1|900823_901297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235158.1|901451_901622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000436982.1|901621_901942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338659.1|901951_904954_+|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	49.8	7.5e-118
>prophage 2
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	1200911	1294250	4855239	plate,holin,portal,tRNA,tail,integrase,head,terminase,capsid,transposase,lysis	Salmonella_phage(54.55%)	87	1235805:1235840	1266702:1266737
WP_000830284.1|1200911_1202072_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	3.0e-38
WP_000301886.1|1202184_1202691_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000980379.1|1204451_1204937_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	84.5	8.0e-70
WP_000980503.1|1206103_1206319_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_000342601.1|1206869_1208033_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196139.1|1208040_1210221_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533862.1|1210217_1211627_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237663.1|1211691_1223166_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1223785_1224268_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1224417_1224894_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1224883_1225174_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1225339_1225678_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1225826_1227488_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1227573_1228452_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1228575_1229166_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287930.1|1229200_1229806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1229926_1231213_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1231232_1232024_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460055.1|1232189_1233551_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1233803_1234052_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1234070_1234619_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1234663_1235431_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1235471_1235819_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1235805:1235840	attL	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
WP_000972010.1|1235963_1236182_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000627821.1|1236257_1237427_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.7e-211
WP_000978860.1|1237423_1237909_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	1.0e-85
WP_000069519.1|1237923_1240368_-|tail	phage tail tape measure protein	tail	Q6K1G6	Salmonella_virus	94.5	0.0e+00
WP_085984508.1|1240360_1240516_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029732.1|1240512_1240848_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
WP_001207677.1|1240910_1241429_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279028.1|1241444_1242623_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
WP_000122996.1|1242757_1243306_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
WP_000104704.1|1243318_1245295_-|tail	tail fiber protein	tail	S4TP62	Salmonella_phage	99.2	0.0e+00
WP_001285354.1|1245305_1245836_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
WP_000246672.1|1245828_1246737_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
WP_000127176.1|1246743_1247091_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	96.5	1.0e-55
WP_001094747.1|1247087_1247729_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
WP_001293102.1|1247797_1248247_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
WP_001169074.1|1248239_1248707_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001394645.1|1248669_1248843_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_000866101.1|1248814_1249228_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
WP_001144116.1|1249224_1249722_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134660.1|1249708_1250005_-|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_000868400.1|1250008_1250212_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000207472.1|1250211_1250718_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
WP_000203472.1|1250811_1251561_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
WP_001247243.1|1251564_1252632_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_001085933.1|1252708_1253563_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
WP_000156057.1|1253728_1255501_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_000795048.1|1255497_1256244_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
WP_000044288.1|1256240_1257263_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
WP_000209112.1|1257493_1257664_+	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	96.4	7.2e-26
WP_001180838.1|1257784_1257979_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.5e-19
WP_001222154.1|1258517_1258751_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_000232650.1|1258754_1258937_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_000170594.1|1259054_1261277_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
WP_000238509.1|1261273_1262104_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
WP_000027690.1|1262107_1262386_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
WP_000752606.1|1262386_1262608_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
WP_001246239.1|1262607_1262835_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
WP_000085638.1|1262904_1263105_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
WP_000916538.1|1263091_1263319_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
WP_000883912.1|1263326_1263836_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
WP_001278192.1|1263886_1264240_-	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_001096997.1|1264353_1265199_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
WP_000823622.1|1265207_1265546_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
WP_000218691.1|1265570_1266620_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
WP_001030981.1|1266872_1268093_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
1266702:1266737	attR	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
WP_001212379.1|1268085_1268604_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1269043_1270114_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1270123_1271245_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210989.1|1271302_1272211_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200083.1|1272171_1273332_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1273431_1273479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1273582_1273921_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1274192_1274930_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1275061_1276042_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992643.1|1276038_1276770_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1276899_1279473_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985658.1|1285427_1285883_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_000807807.1|1285986_1287288_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	2.0e-43
WP_001264473.1|1287284_1287608_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1287652_1289008_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1289122_1291783_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183647.1|1291836_1292517_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1292589_1293009_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997371.1|1293212_1294250_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	1522945	1596846	4855239	holin,tail,integrase,tRNA,head,protease,terminase,lysis	Salmonella_phage(59.74%)	102	1512030:1512045	1600741:1600756
1512030:1512045	attL	GGCCTGATAAGCGCAG	NA	NA	NA	NA
WP_000716011.1|1522945_1523884_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
WP_001208732.1|1524145_1524349_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
WP_001538065.1|1524445_1524790_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	95.6	3.6e-56
WP_001538064.1|1524867_1525167_-	hypothetical protein	NA	G9L655	Escherichia_phage	98.0	1.6e-52
WP_000002089.1|1525260_1525542_-	hypothetical protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	5.9e-49
WP_063389752.1|1525534_1526221_-	DUF551 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	91.0	1.0e-62
WP_000582226.1|1526231_1526987_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	2.4e-150
WP_086016725.1|1526986_1527433_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	98.2	5.3e-52
WP_000665846.1|1527429_1527807_-	hypothetical protein	NA	I6R9B7	Salmonella_phage	89.6	1.9e-55
WP_001214775.1|1527803_1527974_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	5.1e-24
WP_000753553.1|1527990_1528305_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	96.2	6.5e-49
WP_000041317.1|1528316_1528799_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_000065844.1|1528782_1529685_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.8	2.6e-146
WP_000604111.1|1529681_1529990_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_001243355.1|1530075_1530228_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1530212_1530347_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000776966.1|1530422_1530734_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	99.0	9.3e-56
WP_000394576.1|1531057_1531348_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	75.8	5.1e-32
WP_000213980.1|1531387_1531588_-	Restriction inhibitor protein ral	NA	A0A1R3Y5S4	Salmonella_virus	93.9	9.6e-30
WP_129464611.1|1531711_1531918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216176.1|1531927_1532266_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	98.2	9.2e-57
WP_000856894.1|1532616_1533279_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
WP_000067726.1|1533397_1533613_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_000424138.1|1533720_1534011_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_000166968.1|1534031_1534193_+	hypothetical protein	NA	I6R9C7	Salmonella_phage	100.0	1.0e-21
WP_000539344.1|1534179_1535028_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	8.5e-152
WP_023199529.1|1535138_1537019_+	toprim domain-containing protein	NA	A0A0M4R313	Salmonella_phage	99.2	0.0e+00
WP_001064629.1|1537019_1537298_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	97.8	1.9e-47
WP_001000121.1|1537368_1537647_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	93.4	4.3e-44
WP_000814615.1|1537643_1538054_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	7.2e-72
WP_001254249.1|1538050_1538227_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.0e-27
WP_001537967.1|1538229_1538667_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	38.3	6.4e-10
WP_000950971.1|1538659_1538833_+	protein ninF	NA	A0A220NQX7	Salmonella_phage	100.0	5.6e-26
WP_001537969.1|1538825_1539128_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	100.0	3.8e-54
WP_000002249.1|1539120_1539411_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	99.0	6.5e-51
WP_000861017.1|1539407_1539803_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1V0E5J0	Salmonella_phage	100.0	1.2e-71
WP_001287665.1|1539799_1540369_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|1540365_1540569_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_000219140.1|1540549_1540729_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	98.3	1.2e-23
WP_001235465.1|1540725_1541349_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
WP_016063343.1|1541782_1542106_+|holin	phage holin, lambda family	holin	K7P7D0	Enterobacteria_phage	100.0	1.7e-52
WP_000229392.1|1542089_1542566_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_144298498.1|1542562_1543000_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	99.3	7.7e-72
WP_001543881.1|1542987_1543140_+	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_023994441.1|1543344_1543866_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_000147264.1|1544330_1544762_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_047596098.1|1544745_1546065_+|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	99.1	3.5e-261
WP_047596097.1|1546197_1547547_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	100.0	7.5e-259
WP_047596096.1|1547506_1548433_+|head	SPP1 gp7 family phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	100.0	9.6e-173
WP_047596095.1|1548435_1549701_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	100.0	7.5e-237
WP_047596094.1|1549713_1550163_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	100.0	3.3e-78
WP_047596093.1|1550180_1551257_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	100.0	1.4e-207
WP_047596092.1|1551266_1551560_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	100.0	2.3e-48
WP_047596091.1|1551619_1552021_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	100.0	7.0e-72
WP_047596089.1|1552192_1552555_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	100.0	1.6e-67
WP_047720616.1|1552642_1553041_+	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	90.9	1.3e-62
WP_047720618.1|1553037_1553424_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	94.5	2.1e-65
WP_058656652.1|1553441_1554176_+	immunoglobulin domain-containing protein	NA	H6WRU1	Salmonella_phage	86.0	2.1e-114
WP_058656653.1|1554212_1554866_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.2	1.3e-112
WP_045892280.1|1554888_1555113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063132376.1|1555181_1555403_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	80.3	4.2e-26
WP_052938576.1|1555416_1555872_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	54.5	3.5e-27
WP_064505239.1|1555997_1556165_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	76.4	2.7e-17
WP_052938578.1|1557095_1557824_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	64.6	4.7e-74
WP_017384095.1|1557956_1558310_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	100.0	4.2e-60
WP_052928623.1|1558411_1558699_+	hypothetical protein	NA	A0A1V0E5N1	Salmonella_phage	100.0	1.8e-45
WP_144298499.1|1558760_1561937_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	56.2	5.9e-238
WP_126680757.1|1561991_1562204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045340953.1|1562261_1562609_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	96.5	1.1e-60
WP_144298500.1|1562645_1563350_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.9	2.7e-135
WP_144298515.1|1563349_1564069_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	83.3	2.7e-122
WP_144298501.1|1564011_1564539_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	95.9	2.6e-66
WP_047596076.1|1564548_1567728_+|tail	phage tail protein	tail	A0A1V0E5M1	Salmonella_phage	96.1	0.0e+00
WP_144298502.1|1567736_1568696_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	6.2e-183
WP_144298503.1|1568706_1570005_+|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	98.8	5.9e-245
WP_000958643.1|1570076_1571246_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.2	2.7e-228
WP_000377772.1|1571559_1572501_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
WP_000776787.1|1572789_1573545_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001537977.1|1573605_1574913_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030904.1|1575283_1575568_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001248132.1|1575745_1577056_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000214144.1|1577055_1579203_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195800.1|1579411_1579897_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000730794.1|1579996_1580548_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001537978.1|1580713_1581646_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918460.1|1581681_1582767_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	1.6e-89
WP_000750429.1|1582770_1583595_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000368599.1|1583594_1584404_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001066345.1|1584403_1584952_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559749.1|1584984_1585260_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000816083.1|1585311_1587312_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817159.1|1587471_1588686_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001142912.1|1588783_1589440_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000847544.1|1589506_1590025_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000118253.1|1590024_1590393_-	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000433429.1|1590561_1590810_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	58.6	3.1e-17
WP_001051267.1|1590982_1591357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127731.1|1591536_1592715_+	MFS transporter	NA	NA	NA	NA	NA
WP_000553395.1|1592711_1593713_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699178.1|1593816_1594953_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_001289141.1|1595020_1596034_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000016631.1|1596033_1596846_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1600741:1600756	attR	CTGCGCTTATCAGGCC	NA	NA	NA	NA
>prophage 4
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	1809891	1819062	4855239	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569166.1|1809891_1810839_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824852.1|1810822_1811554_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1811534_1811642_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1811701_1812433_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1812655_1814341_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1814337_1815057_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1815103_1815571_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000703137.1|1816329_1816788_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195343.1|1817028_1819062_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	2013041	2020268	4855239		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|2013041_2013461_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457659.1|2013463_2014732_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.7e-225
WP_000208509.1|2015177_2015390_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2015400_2015589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|2015849_2017028_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107439.1|2017677_2017989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377038.1|2018068_2018764_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_001157313.1|2018837_2020268_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP030029	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC098 chromosome, complete genome	4855239	4441095	4488152	4855239	plate,tRNA,tail	Burkholderia_phage(36.36%)	49	NA	NA
WP_001182232.1|4441095_4442094_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039336.1|4442181_4443492_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4443738_4444254_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001538094.1|4444353_4444563_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4444584_4444698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128115.1|4444694_4446020_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4446198_4446807_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4446915_4447284_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4447454_4449875_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4449973_4450846_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4450859_4451357_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4451537_4452455_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4452618_4453977_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4454065_4455175_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4455536_4456727_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382564.1|4456858_4458403_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4458417_4459308_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4459473_4459884_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750800.1|4460026_4462123_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977963.1|4462122_4462860_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_161126850.1|4462856_4463525_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4463558_4463801_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790025.1|4464244_4465894_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4466238_4467588_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4467718_4468066_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4468642_4468930_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001270433.1|4468932_4469538_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	2.7e-59
WP_000777266.1|4469550_4469865_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449432.1|4470024_4470480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4470476_4470674_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729844.1|4470663_4472091_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
WP_000907495.1|4472090_4472615_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003637.1|4472666_4472984_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4472943_4473072_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262483.1|4473168_4475523_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	1.8e-66
WP_000271425.1|4475522_4476476_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269717.1|4476475_4476685_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001538099.1|4476672_4477716_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	1.5e-76
WP_000679395.1|4477725_4478448_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4478774_4479137_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4479133_4480063_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_001095010.1|4480062_4481610_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4481773_4482133_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951739.1|4482123_4483239_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	4.1e-101
WP_000359506.1|4483231_4483864_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368197.1|4483866_4485624_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.2e-51
WP_024133467.1|4485628_4486234_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084337.1|4486230_4486686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|4487423_4488152_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
