The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	0	2949	3046673		Paramecium_bursaria_Chlorella_virus(100.0%)	2	NA	NA
WP_143865299.1|528_1224_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_143865301.1|1464_2949_+	protein kinase	NA	M1HJV9	Paramecium_bursaria_Chlorella_virus	22.5	5.6e-05
>prophage 2
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	9506	10826	3046673		Moraxella_phage(100.0%)	1	NA	NA
WP_143865313.1|9506_10826_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	26.2	7.6e-22
>prophage 3
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	15094	17271	3046673		Bacillus_virus(50.0%)	2	NA	NA
WP_082636467.1|15094_15865_-	MBL fold metallo-hydrolase	NA	G3MAC9	Bacillus_virus	33.6	2.9e-29
WP_143865317.1|15954_17271_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	25.1	3.8e-13
>prophage 4
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	22531	37504	3046673	tRNA	Tupanvirus(28.57%)	14	NA	NA
WP_058502745.1|22531_22822_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.3	9.4e-10
WP_143865325.1|22824_25206_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_143865329.1|25423_26437_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.3e-34
WP_058502748.1|26711_27071_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_058502749.1|27086_27287_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_058502750.1|27347_27884_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	30.5	1.9e-11
WP_143865331.1|27967_29875_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.5	3.5e-137
WP_143865333.1|30377_32825_+	DNA ligase D	NA	A0A291AUP8	Sinorhizobium_phage	39.2	1.0e-51
WP_143865335.1|32830_33601_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	35.2	2.4e-36
WP_135061154.1|34191_34695_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143865337.1|34715_35042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058502756.1|35195_35825_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_143865339.1|35835_36327_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_143865341.1|36343_37504_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	35.8	1.7e-57
>prophage 5
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	50044	51830	3046673		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_143865360.1|50044_50608_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.7	4.1e-25
WP_143865362.1|50597_51830_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	44.5	1.1e-83
>prophage 6
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	63245	66554	3046673		Tupanvirus(50.0%)	3	NA	NA
WP_143865370.1|63245_63788_+	hypothetical protein	NA	A0A2K9KZS4	Tupanvirus	35.2	6.7e-09
WP_143865372.1|64044_64548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143865374.1|64922_66554_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.3	2.1e-42
>prophage 7
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	74526	74757	3046673		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_058501937.1|74526_74757_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.9	3.5e-15
>prophage 8
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	77816	78725	3046673		Synechococcus_phage(100.0%)	1	NA	NA
WP_058501935.1|77816_78725_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	30.9	6.1e-39
>prophage 9
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	84600	85749	3046673		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_143865404.1|84600_85749_-	protein kinase	NA	A0A0G2YB36	Acanthamoeba_polyphaga_mimivirus	24.6	1.2e-07
>prophage 10
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	90310	93717	3046673	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_143865410.1|90310_90988_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.0	2.8e-28
WP_143869429.1|91371_92157_+	porin family protein	NA	NA	NA	NA	NA
WP_143865412.1|92313_93717_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	35.5	3.9e-77
>prophage 11
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	98035	98698	3046673		Mycobacterium_phage(100.0%)	1	NA	NA
WP_143865420.1|98035_98698_-	SAM-dependent methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	34.1	2.0e-18
>prophage 12
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	105933	108923	3046673		Pandoravirus(50.0%)	2	NA	NA
WP_143865434.1|105933_107058_-	CapA family protein	NA	S4VS02	Pandoravirus	52.2	1.1e-101
WP_143865436.1|107132_108923_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.2	3.0e-13
>prophage 13
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	112833	114378	3046673		Bacillus_virus(100.0%)	1	NA	NA
WP_143869430.1|112833_114378_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.5	4.1e-19
>prophage 14
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	122306	122786	3046673		Megavirus(100.0%)	1	NA	NA
WP_143869431.1|122306_122786_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	L7Y5F8	Megavirus	37.0	2.3e-16
>prophage 15
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	129471	130389	3046673		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_135061215.1|129471_130389_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	3.4e-21
>prophage 16
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	146185	146683	3046673		Tetraselmis_virus(100.0%)	1	NA	NA
WP_143865479.1|146185_146683_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.2	2.6e-23
>prophage 17
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	154350	157233	3046673		Streptomyces_phage(50.0%)	3	NA	NA
WP_135061230.1|154350_154677_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	58.0	1.4e-22
WP_143865495.1|154916_155645_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_058502665.1|155841_157233_+	class II fumarate hydratase	NA	A0A1B1ISB0	uncultured_Mediterranean_phage	23.2	3.6e-06
>prophage 18
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	167296	168934	3046673		Flamingopox_virus(100.0%)	1	NA	NA
WP_143865512.1|167296_168934_-	hypothetical protein	NA	A0A2H4X233	Flamingopox_virus	26.8	3.6e-05
>prophage 19
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	177157	179962	3046673		Bacillus_virus(50.0%)	3	NA	NA
WP_143865529.1|177157_177784_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.6	5.7e-12
WP_143865532.1|177783_178575_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_143865534.1|178633_179962_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	69.4	3.0e-26
>prophage 20
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	189547	190675	3046673		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_143869435.1|189547_190675_-	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	32.0	7.9e-36
>prophage 21
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	199483	205479	3046673		Acinetobacter_phage(50.0%)	3	NA	NA
WP_143865569.1|199483_202060_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.9	1.5e-21
WP_058501387.1|202263_204195_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_143865571.1|204213_205479_+	DUF444 family protein	NA	A0A219UQP6	Bacillus_phage	30.2	3.5e-08
>prophage 22
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	220771	222784	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143865589.1|220771_222784_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.4	6.4e-105
>prophage 23
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	226409	227042	3046673		Cedratvirus(100.0%)	1	NA	NA
WP_143865599.1|226409_227042_-	CatB-related O-acetyltransferase	NA	A0A285PXQ2	Cedratvirus	35.3	4.1e-18
>prophage 24
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	242117	254860	3046673		Indivirus(25.0%)	6	NA	NA
WP_058502161.1|242117_243308_-	elongation factor Tu	NA	A0A1V0SDG4	Indivirus	25.9	8.9e-14
WP_143869438.1|243327_245409_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.2	6.9e-62
WP_135061285.1|245429_245948_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_058502158.1|245969_246350_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_143865619.1|246460_250705_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	4.4e-71
WP_143865621.1|250753_254860_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.8	4.8e-22
>prophage 25
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	258320	259511	3046673		Indivirus(100.0%)	1	NA	NA
WP_058502161.1|258320_259511_-	elongation factor Tu	NA	A0A1V0SDG4	Indivirus	25.9	8.9e-14
>prophage 26
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	265495	265981	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143865628.1|265495_265981_-	dihydrofolate reductase	NA	A0A0A0RMZ5	Bacillus_phage	47.8	4.1e-26
>prophage 27
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	271144	272110	3046673		Catovirus(100.0%)	1	NA	NA
WP_143865632.1|271144_272110_+	phosphotransferase	NA	A0A1V0SB89	Catovirus	27.3	3.7e-10
>prophage 28
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	280825	283771	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143865645.1|280825_283771_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	21.5	9.9e-22
>prophage 29
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	287322	289124	3046673		Salmonella_phage(50.0%)	2	NA	NA
WP_143865652.1|287322_288588_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	42.8	3.8e-87
WP_058500778.1|288590_289124_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	47.3	3.0e-30
>prophage 30
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	301412	304533	3046673		Prochlorococcus_phage(100.0%)	3	NA	NA
WP_143865661.1|301412_302864_-	aminotransferase class V-fold PLP-dependent enzyme	NA	E3ST28	Prochlorococcus_phage	42.6	2.9e-91
WP_058500791.1|302857_303166_-	GTP cyclohydrolase	NA	NA	NA	NA	NA
WP_143865662.1|303165_304533_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3ST28	Prochlorococcus_phage	37.7	8.3e-56
>prophage 31
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	309584	314766	3046673		Bacillus_virus(50.0%)	5	NA	NA
WP_058500798.1|309584_310898_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	4.6e-35
WP_143865666.1|310948_311551_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_058500800.1|311563_312163_-	cytochrome c4	NA	NA	NA	NA	NA
WP_143865668.1|312236_312839_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_143865669.1|312888_314766_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.9	4.3e-87
>prophage 32
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	326454	327057	3046673		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_135061657.1|326454_327057_-	NAD(P)H:quinone oxidoreductase	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.2	6.3e-24
>prophage 33
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	336974	337622	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143865706.1|336974_337622_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	34.3	1.3e-19
>prophage 34
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	366509	368525	3046673		Indivirus(100.0%)	1	NA	NA
WP_143865748.1|366509_368525_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	23.4	1.1e-43
>prophage 35
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	395846	398175	3046673		Aeromonas_phage(50.0%)	4	NA	NA
WP_143865798.1|395846_396524_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	30.4	8.1e-12
WP_143865800.1|396677_397538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143865803.1|397545_397875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143865805.1|397878_398175_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	51.0	1.0e-06
>prophage 36
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	410568	412755	3046673		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_143865836.1|410568_412755_+	DUF1738 domain-containing protein	NA	B7SYD0	Stenotrophomonas_phage	25.8	1.4e-12
>prophage 37
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	421693	426538	3046673		Burkholderia_virus(33.33%)	7	NA	NA
WP_143865855.1|421693_422977_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.9	9.9e-35
WP_143865857.1|422983_423532_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.6	2.2e-15
WP_143865859.1|423558_424170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143865861.1|424141_424603_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143865863.1|424903_425143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869444.1|425177_425384_+	excisionase	NA	NA	NA	NA	NA
WP_143865865.1|425332_426538_+	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	47.3	3.8e-89
>prophage 38
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	454770	461174	3046673		Bacillus_virus(33.33%)	5	NA	NA
WP_143865911.1|454770_455670_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.7	1.3e-20
WP_143865913.1|455666_456029_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_143865915.1|456494_457979_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	72.7	2.0e-188
WP_143865917.1|458243_459392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143865919.1|459761_461174_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.1	3.5e-25
>prophage 39
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	465181	467599	3046673		Bacillus_virus(100.0%)	1	NA	NA
WP_143865925.1|465181_467599_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.7	3.1e-114
>prophage 40
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	474192	474441	3046673		Staphylococcus_phage(100.0%)	1	NA	NA
WP_143865932.1|474192_474441_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	44.0	2.3e-12
>prophage 41
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	479813	483667	3046673		Streptococcus_phage(50.0%)	4	NA	NA
WP_143865941.1|479813_480656_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	33.7	3.9e-32
WP_143865944.1|480697_482491_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_143869446.1|482519_482879_+	YraN family protein	NA	NA	NA	NA	NA
WP_135059493.1|483067_483667_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	32.5	3.8e-13
>prophage 42
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	492491	494732	3046673		Bacillus_virus(100.0%)	1	NA	NA
WP_143865963.1|492491_494732_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.7	8.8e-79
>prophage 43
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	509410	510268	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143865977.1|509410_510268_-	phosphatidylserine decarboxylase	NA	A0A2K9L6Z6	Tupanvirus	24.6	7.9e-12
>prophage 44
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	514574	515153	3046673		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_058503055.1|514574_515153_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	45.9	2.3e-47
>prophage 45
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	527860	530259	3046673		Klebsiella_phage(50.0%)	2	NA	NA
WP_143865998.1|527860_529366_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	35.2	5.7e-58
WP_143866000.1|529512_530259_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	30.5	6.0e-24
>prophage 46
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	550742	552868	3046673		Pseudomonas_phage(50.0%)	2	NA	NA
WP_143866037.1|550742_552506_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.8	6.7e-66
WP_143866039.1|552595_552868_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH27	Moraxella_phage	45.9	2.0e-06
>prophage 47
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	556311	559128	3046673	transposase,integrase	Moraxella_phage(50.0%)	2	547658:547671	566549:566562
547658:547671	attL	TTTCATGGAGAAAT	NA	NA	NA	NA
WP_143866048.1|556311_557565_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PHM8	Moraxella_phage	33.8	1.5e-56
WP_143866051.1|557952_559128_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	25.8	7.5e-21
566549:566562	attR	TTTCATGGAGAAAT	NA	NA	NA	NA
>prophage 48
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	567643	568579	3046673		Salmonella_phage(100.0%)	1	NA	NA
WP_143866061.1|567643_568579_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	49.3	6.7e-65
>prophage 49
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	585689	586622	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143866094.1|585689_586622_+	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	31.9	5.9e-37
>prophage 50
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	591811	594826	3046673		Leptospira_phage(100.0%)	1	NA	NA
WP_143866098.1|591811_594826_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	23.8	1.4e-74
>prophage 51
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	612373	614554	3046673		Lactococcus_phage(100.0%)	1	NA	NA
WP_143866120.1|612373_614554_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.3	2.9e-71
>prophage 52
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	617821	620650	3046673		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_143866129.1|617821_620650_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.5	0.0e+00
>prophage 53
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	626627	633363	3046673		Bacillus_phage(50.0%)	4	NA	NA
WP_143866136.1|626627_629315_-	DNA polymerase I	NA	A0A068EMS7	Bacillus_phage	26.8	2.4e-54
WP_058501853.1|629311_630364_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_143866138.1|630704_631934_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_143866140.1|632166_633363_-	serine hydrolase	NA	X2KYU1	Mycobacterium_phage	25.6	1.8e-09
>prophage 54
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	650281	651703	3046673		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_143869454.1|650281_651703_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	42.7	2.6e-105
>prophage 55
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	655446	661157	3046673		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_143866174.1|655446_656160_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	H8ZJK8	Ostreococcus_tauri_virus	37.7	7.0e-22
WP_058501791.1|656761_657931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869455.1|658119_659382_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	3.0e-20
WP_143866176.1|659536_659830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143866178.1|659929_660460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143866180.1|660692_661157_-	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	61.9	8.5e-45
>prophage 56
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	671195	679219	3046673		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_143866194.1|671195_673013_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.5	6.8e-130
WP_143866196.1|673286_674585_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_143869456.1|674763_675507_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_058500519.1|675589_676060_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.7	1.8e-26
WP_058500518.1|676185_676662_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_143866198.1|676792_678196_+	AAA family ATPase	NA	A0A2I7SAD7	Vibrio_phage	36.8	2.0e-73
WP_143866200.1|678208_679219_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	28.6	4.1e-44
>prophage 57
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	684210	686968	3046673		Lake_Baikal_phage(50.0%)	2	NA	NA
WP_058500511.1|684210_684426_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	53.1	8.8e-13
WP_143866208.1|684805_686968_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	36.5	1.1e-09
>prophage 58
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	702479	708966	3046673		Streptococcus_phage(33.33%)	6	NA	NA
WP_143866228.1|702479_703250_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	E4ZFQ0	Streptococcus_phage	30.7	1.6e-16
WP_143869461.1|703333_704623_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143866230.1|704615_705437_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	I7K2L0	Yersinia_phage	26.1	5.8e-12
WP_143866232.1|705510_707100_+	TolC family protein	NA	NA	NA	NA	NA
WP_143866234.1|707096_708251_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_143866236.1|708243_708966_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.1	1.3e-31
>prophage 59
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	723769	725422	3046673		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_143866262.1|723769_725422_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	28.7	6.5e-39
>prophage 60
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	734150	739702	3046673		Flavobacterium_phage(33.33%)	5	NA	NA
WP_058500993.1|734150_735752_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	37.0	1.1e-09
WP_115325374.1|735767_736301_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_058500995.1|736403_737273_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_143866277.1|737347_738028_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0D4D9V8	Escherichia_phage	36.3	6.9e-27
WP_143866279.1|738253_739702_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.8	8.2e-62
>prophage 61
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	747556	749204	3046673		Natrialba_phage(50.0%)	2	NA	NA
WP_143866292.1|747556_748327_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	33.5	4.3e-17
WP_143866294.1|748340_749204_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	37.7	4.8e-09
>prophage 62
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	760609	766916	3046673		Hokovirus(33.33%)	6	NA	NA
WP_058501308.1|760609_762907_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.0	3.5e-14
WP_058501307.1|762903_763710_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_058501306.1|763733_764504_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_058501305.1|764500_765295_+	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	72.7	4.1e-116
WP_058501304.1|765310_765706_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_058501303.1|765794_766916_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.4	4.7e-81
>prophage 63
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	772075	782390	3046673	protease	Pseudomonas_phage(20.0%)	12	NA	NA
WP_143866316.1|772075_772642_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.1	5.5e-70
WP_135059652.1|772732_773038_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_143866318.1|773314_774031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143866320.1|774023_774761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143869468.1|774839_775631_+	alpha/beta fold hydrolase	NA	A0A1V0SD13	Indivirus	29.5	2.8e-11
WP_143866322.1|775739_776861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143866324.1|776897_777848_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5K7	Streptococcus_phage	43.7	5.2e-65
WP_058501272.1|778168_778387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058501271.1|778489_778756_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_058501270.1|778857_779478_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_135059658.1|779536_781456_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	43.6	9.7e-119
WP_143869469.1|781568_782390_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.8	6.0e-17
>prophage 64
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	804698	807359	3046673		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_143866347.1|804698_807359_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.3	3.2e-27
>prophage 65
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	811532	813223	3046673		Acinetobacter_phage(50.0%)	3	NA	NA
WP_143866353.1|811532_812072_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	58.4	4.0e-54
WP_143866355.1|812085_812427_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_143866357.1|812680_813223_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.2	1.6e-47
>prophage 66
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	838814	840404	3046673		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_143866386.1|838814_840404_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.8	1.1e-59
>prophage 67
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	856230	857241	3046673		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_143866407.1|856230_857241_-	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	47.0	6.1e-72
>prophage 68
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	866358	910578	3046673	protease,tRNA,transposase	Pithovirus(12.5%)	42	NA	NA
WP_143866419.1|866358_867030_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_143866421.1|867036_868164_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_143866423.1|868357_869728_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_143866424.1|870253_871411_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_135059703.1|871411_872326_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_058502945.1|872419_872617_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_143866426.1|872630_873929_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.2	8.4e-74
WP_131780721.1|874085_874268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058502947.1|874630_875257_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_143866428.1|875259_876480_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_143866430.1|876472_877237_+	cytochrome c1	NA	NA	NA	NA	NA
WP_058502950.1|877534_878155_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_058502981.1|878163_878550_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.4	3.3e-26
WP_143866432.1|878610_880098_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_143866433.1|880094_880580_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_143866435.1|880576_881896_+	AMIN domain-containing protein	NA	A0A059WLJ5	Vibrio_phage	26.9	1.8e-15
WP_143866438.1|881886_883530_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.4	1.1e-51
WP_143866440.1|883522_884467_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_143866442.1|884747_884939_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_143866444.1|884935_885958_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_115325403.1|887335_887428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058502959.1|887466_887922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135059715.1|888027_888483_+	type IV secretion protein IcmV	NA	NA	NA	NA	NA
WP_143866446.1|888479_891452_+	type IVB secretion system protein DotA	NA	NA	NA	NA	NA
WP_115325369.1|891667_892795_-	Dot/Icm type IV secretion system ATPase DotB	NA	NA	NA	NA	NA
WP_058502963.1|892818_893727_-	type IV secretion system DotC family protein	NA	NA	NA	NA	NA
WP_058502982.1|893707_894193_-	type IVB secretion system lipoprotein DotD	NA	NA	NA	NA	NA
WP_143866448.1|894291_894852_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_143866451.1|894848_896156_-	insulinase family protein	NA	NA	NA	NA	NA
WP_058502966.1|896152_897478_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.3	1.5e-30
WP_143866453.1|897539_898607_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_058502983.1|898581_899232_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.2	8.9e-24
WP_143866456.1|899225_900155_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_058502969.1|900298_901159_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.7	1.2e-39
WP_143866458.1|901316_902186_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_143866461.1|902781_903495_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_143866463.1|903574_903871_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143865544.1|903910_904786_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_143866465.1|905272_907213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143866467.1|907690_908434_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.8	3.7e-18
WP_143866469.1|908426_909224_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_143866471.1|909225_910578_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 69
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	916045	917733	3046673	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_143866477.1|916045_916426_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	39.0	6.6e-11
WP_143866479.1|916455_917733_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	6.1e-93
>prophage 70
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	927157	928582	3046673		Synechococcus_phage(100.0%)	1	NA	NA
WP_143866499.1|927157_928582_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	51.0	2.5e-140
>prophage 71
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	933434	935948	3046673		Bacillus_virus(100.0%)	1	NA	NA
WP_143866505.1|933434_935948_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	40.1	4.8e-25
>prophage 72
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	945742	951405	3046673		Mycoplasma_phage(100.0%)	4	NA	NA
WP_058501775.1|945742_947113_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.6	1.5e-33
WP_143866516.1|947532_949518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058500702.1|949535_949964_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_143866518.1|949953_951405_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.7	1.8e-53
>prophage 73
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	958219	973281	3046673		Salicola_phage(12.5%)	15	NA	NA
WP_058500696.1|958219_958696_+	transcription elongation factor GreA	NA	A0A248SJQ8	Salicola_phage	35.5	2.6e-12
WP_058500695.1|958977_959649_-	acid phosphatase	NA	NA	NA	NA	NA
WP_143866522.1|959824_961231_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_143866524.1|961405_963298_+	cyclic nucleotide-binding domain-containing protein	NA	M1I190	Acanthocystis_turfacea_Chlorella_virus	29.6	8.1e-09
WP_058500692.1|963636_964098_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_058500691.1|964090_965539_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_143866526.1|965541_966294_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.5e-09
WP_143866528.1|966290_967571_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_115325284.1|967563_968808_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.0	1.3e-95
WP_058500688.1|968804_969254_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0P0M6T0	Mycobacterium_phage	34.8	1.2e-11
WP_058500687.1|969259_969595_+	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_058500686.1|969597_970554_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	1.5e-27
WP_135059771.1|970736_971420_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_143866530.1|971487_972687_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	2.4e-46
WP_058500454.1|972822_973281_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	2.4e-47
>prophage 74
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1019689	1023026	3046673		Bifidobacterium_phage(50.0%)	3	NA	NA
WP_143866569.1|1019689_1020481_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.3	3.9e-13
WP_143866571.1|1020779_1021925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143866573.1|1022099_1023026_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	39.2	4.3e-48
>prophage 75
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1034252	1035767	3046673		Oxyplax_ochracea_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_143869474.1|1034252_1035767_+	glycoside hydrolase family 18 protein	NA	A0A2L0WU86	Oxyplax_ochracea_nucleopolyhedrovirus	25.5	4.2e-16
>prophage 76
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1047665	1050776	3046673		Leptospira_phage(100.0%)	1	NA	NA
WP_143866598.1|1047665_1050776_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.3	1.1e-71
>prophage 77
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1061279	1062308	3046673		Serratia_phage(100.0%)	1	NA	NA
WP_143866620.1|1061279_1062308_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LYN9	Serratia_phage	36.1	3.8e-53
>prophage 78
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1070739	1074149	3046673		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_143869480.1|1070739_1071648_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.5	7.0e-19
WP_143866632.1|1071664_1072369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869481.1|1072406_1074149_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	E3T536	Cafeteria_roenbergensis_virus	23.9	1.4e-12
>prophage 79
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1078362	1083801	3046673		Bacillus_phage(50.0%)	4	NA	NA
WP_143866640.1|1078362_1079094_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	38.8	8.8e-12
WP_143866642.1|1079238_1079946_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143866644.1|1080052_1081615_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_143869483.1|1081824_1083801_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.7	3.2e-24
>prophage 80
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1086947	1089647	3046673		Ectropis_obliqua_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_143866648.1|1086947_1089647_+	hypothetical protein	NA	A0EYS4	Ectropis_obliqua_nucleopolyhedrovirus	62.5	2.6e-16
>prophage 81
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1098938	1100597	3046673		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_143866667.1|1098938_1100597_+	acetolactate synthase large subunit	NA	H8ZJ31	Ostreococcus_tauri_virus	22.6	1.1e-20
>prophage 82
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1123833	1128222	3046673	transposase	Infectious_spleen_and_kidney_necrosis_virus(50.0%)	5	NA	NA
WP_143866704.1|1123833_1124370_+	macro domain-containing protein	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	42.9	3.7e-28
WP_143866706.1|1124697_1124994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143866708.1|1124990_1125872_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_143866710.1|1125877_1127170_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_143866712.1|1127172_1128222_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.9	5.4e-23
>prophage 83
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1170844	1176127	3046673	integrase	Pseudomonas_phage(33.33%)	4	1169459:1169472	1176982:1176995
1169459:1169472	attL	AAATAATCGCCTTT	NA	NA	NA	NA
WP_143866770.1|1170844_1172590_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.9	9.3e-68
WP_143866772.1|1172679_1172952_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH27	Moraxella_phage	47.5	7.0e-07
WP_143866774.1|1173515_1174745_+	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_143866776.1|1174876_1176127_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0P0IKP2	Acinetobacter_phage	32.8	1.7e-47
1176982:1176995	attR	AAAGGCGATTATTT	NA	NA	NA	NA
>prophage 84
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1187338	1192621	3046673	integrase	Acinetobacter_phage(33.33%)	4	1181532:1181545	1194173:1194186
1181532:1181545	attL	GCATTTGATCATAT	NA	NA	NA	NA
WP_143866776.1|1187338_1188589_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0P0IKP2	Acinetobacter_phage	32.8	1.7e-47
WP_143866774.1|1188720_1189950_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_143866772.1|1190513_1190786_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH27	Moraxella_phage	47.5	7.0e-07
WP_143866770.1|1190875_1192621_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.9	9.3e-68
1194173:1194186	attR	ATATGATCAAATGC	NA	NA	NA	NA
>prophage 85
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1199926	1201894	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143866806.1|1199926_1201894_+	DEAD/DEAH box helicase family protein	NA	A0A127AW80	Bacillus_phage	32.2	4.1e-88
>prophage 86
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1213788	1216524	3046673		Hokovirus(100.0%)	1	NA	NA
WP_143866826.1|1213788_1216524_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.4	1.6e-50
>prophage 87
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1219932	1225808	3046673	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_143869487.1|1219932_1222698_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.8	2.4e-158
WP_143866835.1|1222760_1225808_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.6	5.4e-55
>prophage 88
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1228986	1230240	3046673		Aeromonas_phage(100.0%)	1	NA	NA
WP_058500900.1|1228986_1230240_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.0e-100
>prophage 89
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1236139	1241235	3046673	transposase	Wolbachia_phage(50.0%)	3	NA	NA
WP_143866854.1|1236139_1237573_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	4.8e-38
WP_143866856.1|1237858_1239538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143866859.1|1239615_1241235_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	34.1	1.6e-82
>prophage 90
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1252788	1255697	3046673		Escherichia_phage(50.0%)	2	NA	NA
WP_143866875.1|1252788_1253796_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	32.0	8.6e-34
WP_143866877.1|1254275_1255697_+	deoxyribodipyrimidine photo-lyase	NA	K7Y8W8	Megavirus	31.3	4.3e-63
>prophage 91
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1303538	1304629	3046673		Croceibacter_phage(50.0%)	2	NA	NA
WP_143866941.1|1303538_1304258_-	hypothetical protein	NA	I6R9X8	Croceibacter_phage	31.4	6.0e-13
WP_143866943.1|1304323_1304629_-	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	37.3	7.9e-07
>prophage 92
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1317114	1318347	3046673	integrase	Acinetobacter_phage(100.0%)	1	1316366:1316382	1322151:1322167
1316366:1316382	attL	ATGTTGCCAATGAAAAC	NA	NA	NA	NA
WP_143866954.1|1317114_1318347_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	33.1	2.8e-50
WP_143866954.1|1317114_1318347_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	33.1	2.8e-50
1322151:1322167	attR	GTTTTCATTGGCAACAT	NA	NA	NA	NA
>prophage 93
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1337200	1338206	3046673		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_143866994.1|1337200_1337707_-	antirestriction protein ArdA	NA	A0A1B1IVX9	uncultured_Mediterranean_phage	33.9	5.7e-18
WP_143866996.1|1337783_1338206_-	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	34.2	1.6e-13
>prophage 94
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1363186	1376915	3046673	integrase	Burkholderia_virus(11.11%)	16	1371965:1371978	1374541:1374554
WP_143867048.1|1363186_1363843_+	helix-turn-helix domain-containing protein	NA	Q6J1N3	Burkholderia_virus	22.8	7.1e-05
WP_143869493.1|1363874_1363913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867050.1|1364058_1364298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867052.1|1364310_1364574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867054.1|1364783_1366472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867056.1|1366478_1366841_-	DUF2513 domain-containing protein	NA	A0A1W6JNL0	Staphylococcus_phage	37.0	5.9e-09
WP_143867058.1|1366844_1367390_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.2	5.5e-43
WP_143867060.1|1367725_1368586_+	pirin family protein	NA	NA	NA	NA	NA
WP_143867062.1|1368642_1369269_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_143867065.1|1369599_1370997_-	GIY-YIG nuclease family protein	NA	I6R9X8	Croceibacter_phage	30.8	3.4e-12
WP_143867067.1|1371062_1371368_-	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	37.5	6.7e-06
WP_143867069.1|1371360_1372269_-	DNA polymerase III subunit epsilon	NA	A0A223W0B0	Agrobacterium_phage	34.5	6.4e-28
1371965:1371978	attL	TTTGTAATGCCTGT	NA	NA	NA	NA
WP_143867070.1|1372564_1373029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867073.1|1373028_1373613_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K5C2	Caulobacter_virus	30.6	1.2e-11
WP_143867075.1|1373754_1374621_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	30.3	1.5e-05
1374541:1374554	attR	ACAGGCATTACAAA	NA	NA	NA	NA
WP_143867077.1|1376300_1376915_+	recombinase family protein	NA	H2A0H0	Bacteroides_phage	41.5	1.3e-19
>prophage 95
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1398585	1399074	3046673		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_143867101.1|1398585_1399074_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	45.1	1.4e-26
>prophage 96
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1404952	1411893	3046673	tRNA,integrase	Pseudomonas_phage(20.0%)	6	1398019:1398032	1415550:1415563
1398019:1398032	attL	TCTGATAATAAAAA	NA	NA	NA	NA
WP_143869496.1|1404952_1405864_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	46.1	2.6e-66
WP_135060847.1|1406114_1407983_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.3	7.7e-36
WP_143867117.1|1408069_1409809_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	34.2	3.5e-59
WP_143867119.1|1409823_1410267_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	7.4e-22
WP_058502819.1|1410494_1410722_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_143867121.1|1410888_1411893_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.9	5.8e-91
1415550:1415563	attR	TTTTTATTATCAGA	NA	NA	NA	NA
>prophage 97
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1415542	1416046	3046673		Salmonella_phage(100.0%)	1	NA	NA
WP_058502814.1|1415542_1416046_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	50.9	6.4e-38
>prophage 98
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1429914	1441593	3046673		Bacillus_phage(40.0%)	10	NA	NA
WP_143867142.1|1429914_1431291_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	38.5	7.4e-36
WP_143867145.1|1431314_1432217_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_143867147.1|1432213_1432642_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_143867149.1|1432634_1433201_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_143867151.1|1433342_1435706_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	1.3e-19
WP_143867153.1|1436267_1436939_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_058502795.1|1436944_1438198_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.6	1.7e-26
WP_143867155.1|1438305_1439484_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	40.8	2.0e-21
WP_143867158.1|1439692_1440667_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_143867159.1|1440663_1441593_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.2	2.7e-26
>prophage 99
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1446801	1448496	3046673		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_143867167.1|1446801_1448496_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.5e-59
>prophage 100
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1451742	1453419	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143867172.1|1451742_1453419_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.0	1.9e-17
>prophage 101
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1461657	1462986	3046673		Microcystis_virus(100.0%)	1	NA	NA
WP_143867181.1|1461657_1462986_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	48.9	1.6e-16
>prophage 102
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1486084	1489156	3046673		Leptospira_phage(100.0%)	1	NA	NA
WP_143867210.1|1486084_1489156_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.6	1.5e-73
>prophage 103
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1500813	1501443	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143867238.1|1500813_1501443_+	guanylate kinase	NA	U5J9X2	Bacillus_phage	31.3	1.2e-17
>prophage 104
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1505835	1517250	3046673	tRNA	uncultured_Mediterranean_phage(40.0%)	10	NA	NA
WP_143867242.1|1505835_1507677_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	4.0e-45
WP_143867245.1|1507792_1509373_-	hypothetical protein	NA	M1ICE0	Paramecium_bursaria_Chlorella_virus	27.8	2.5e-27
WP_065235985.1|1509611_1510025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143867249.1|1510145_1511162_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_143867251.1|1511192_1512038_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	NA	NA	NA	NA
WP_058501624.1|1512304_1512640_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.7	8.9e-12
WP_143867253.1|1512661_1514533_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_058501626.1|1514662_1515580_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	8.9e-46
WP_058501627.1|1515802_1516144_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_143867255.1|1516140_1517250_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.4	2.5e-26
>prophage 105
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1537955	1538744	3046673		Mycobacterium_phage(100.0%)	1	NA	NA
WP_143867291.1|1537955_1538744_-	alpha/beta fold hydrolase	NA	A0A088FS12	Mycobacterium_phage	35.8	2.3e-05
>prophage 106
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1543166	1546436	3046673		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_143867302.1|1543166_1546436_+	DEAD/DEAH box helicase family protein	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	26.3	1.6e-36
>prophage 107
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1549670	1551059	3046673		Escherichia_phage(100.0%)	1	NA	NA
WP_143867310.1|1549670_1551059_+	replicative DNA helicase	NA	O80281	Escherichia_phage	57.4	1.6e-139
>prophage 108
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1558722	1566202	3046673		Enterobacteria_phage(50.0%)	8	NA	NA
WP_143867329.1|1558722_1559799_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	50.3	3.3e-92
WP_143867332.1|1559802_1560696_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_143867335.1|1560692_1561577_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.4	1.3e-105
WP_143867338.1|1561573_1562551_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.8	3.2e-41
WP_143867340.1|1562543_1563218_+	acetyltransferase	NA	NA	NA	NA	NA
WP_143867343.1|1563229_1564153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143867345.1|1564146_1565100_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143867348.1|1565083_1566202_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.7	8.1e-41
>prophage 109
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1569575	1572845	3046673		Shigella_phage(50.0%)	3	NA	NA
WP_143867360.1|1569575_1570616_+	acyltransferase family protein	NA	Q716G0	Shigella_phage	36.9	2.9e-45
WP_143867363.1|1570657_1571614_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_143867366.1|1571639_1572845_+	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	30.1	5.5e-27
>prophage 110
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1578044	1582713	3046673		Catovirus(25.0%)	4	NA	NA
WP_143867380.1|1578044_1579238_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	1.1e-27
WP_143869504.1|1579258_1580527_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	26.7	1.0e-23
WP_143867383.1|1580545_1581547_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	33.4	4.7e-40
WP_143867387.1|1581549_1582713_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	31.4	1.6e-36
>prophage 111
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1602281	1603418	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143867434.1|1602281_1603418_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A2K9L0G1	Tupanvirus	27.4	5.9e-23
>prophage 112
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1611958	1612162	3046673		Vibrio_phage(100.0%)	1	NA	NA
WP_058500542.1|1611958_1612162_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	1.9e-12
>prophage 113
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1622674	1624705	3046673		Ralstonia_phage(100.0%)	1	NA	NA
WP_143867467.1|1622674_1624705_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	1.9e-136
>prophage 114
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1630912	1634359	3046673		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_143867475.1|1630912_1634359_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	2.2e-190
>prophage 115
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1639959	1641837	3046673		Catovirus(100.0%)	1	NA	NA
WP_143869509.1|1639959_1641837_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.3	1.7e-22
>prophage 116
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1654424	1655351	3046673		Klosneuvirus(100.0%)	1	NA	NA
WP_143867501.1|1654424_1655351_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	33.8	1.3e-36
>prophage 117
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1673441	1675109	3046673		Catovirus(100.0%)	1	NA	NA
WP_143867530.1|1673441_1675109_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.3	2.9e-42
>prophage 118
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1694485	1699760	3046673	transposase	Bodo_saltans_virus(50.0%)	3	NA	NA
WP_143867555.1|1694485_1695856_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.9	1.3e-109
WP_143866606.1|1696064_1697162_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_143869511.1|1697420_1699760_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.2	6.0e-163
>prophage 119
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1713565	1718656	3046673	protease	Phage_21(25.0%)	4	NA	NA
WP_135060667.1|1713565_1714822_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	68.5	3.6e-13
WP_135060666.1|1715112_1715436_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.3	6.0e-13
WP_143867578.1|1715463_1717731_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	1.3e-165
WP_143867581.1|1717885_1718656_+	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	28.9	5.6e-09
>prophage 120
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1722484	1727060	3046673	protease	Mycoplasma_phage(33.33%)	5	NA	NA
WP_143867587.1|1722484_1723579_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.8	1.1e-29
WP_082636450.1|1723794_1724139_-	neurogenic locus notch	NA	NA	NA	NA	NA
WP_058500429.1|1724228_1724825_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_143869514.1|1724827_1725718_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4J8X5	uncultured_Caudovirales_phage	43.2	1.4e-11
WP_143867589.1|1725731_1727060_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	35.9	1.8e-39
>prophage 121
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1749076	1749835	3046673		Bacillus_virus(100.0%)	1	NA	NA
WP_143869516.1|1749076_1749835_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.9	3.6e-24
>prophage 122
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1769413	1772601	3046673		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_058502413.1|1769413_1770172_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	58.3	4.1e-81
WP_058502392.1|1770168_1770753_+	DedA family protein	NA	NA	NA	NA	NA
WP_143869517.1|1770764_1771502_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_058502390.1|1771578_1772601_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.2	1.3e-32
>prophage 123
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1778697	1785259	3046673		Bacillus_phage(25.0%)	7	NA	NA
WP_143867652.1|1778697_1780122_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	1.6e-22
WP_058502369.1|1780118_1780796_-	response regulator	NA	B5LWA6	Feldmannia_species_virus	28.4	4.3e-05
WP_135060633.1|1780795_1781362_-	septation protein A	NA	NA	NA	NA	NA
WP_143867654.1|1781670_1783149_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	40.3	7.5e-10
WP_143867655.1|1783212_1783974_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_143867658.1|1784033_1784252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143867660.1|1784404_1785259_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.9	2.9e-30
>prophage 124
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1796821	1799474	3046673		Pandoravirus(33.33%)	3	NA	NA
WP_143867676.1|1796821_1797295_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	36.7	1.3e-16
WP_143867678.1|1797284_1798604_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.2	4.1e-28
WP_143867680.1|1798751_1799474_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	37.2	7.5e-32
>prophage 125
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1823067	1825227	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143867713.1|1823067_1825227_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.4	6.6e-39
>prophage 126
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1833147	1835407	3046673		Stx2-converting_phage(50.0%)	2	NA	NA
WP_143867726.1|1833147_1834365_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.2	1.5e-64
WP_143867727.1|1834618_1835407_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.4	3.4e-17
>prophage 127
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1839397	1842441	3046673	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_143869521.1|1839397_1841053_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.9	7.2e-179
WP_135060594.1|1841064_1842441_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.3	2.5e-44
>prophage 128
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1857584	1861244	3046673		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_143867750.1|1857584_1858940_+	erythromycin esterase family protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	29.9	2.8e-11
WP_143867752.1|1858911_1859508_+	DNA ligase	NA	NA	NA	NA	NA
WP_143869523.1|1859581_1860508_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_143867754.1|1860497_1861244_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	40.6	7.6e-19
>prophage 129
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1865518	1866985	3046673		Cyanophage(100.0%)	1	NA	NA
WP_143867762.1|1865518_1866985_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.4	2.3e-83
>prophage 130
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1875326	1884846	3046673		Acanthocystis_turfacea_Chlorella_virus(25.0%)	7	NA	NA
WP_143867775.1|1875326_1875989_+	beta-phosphoglucomutase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	29.5	3.8e-14
WP_143867777.1|1876159_1877596_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.5	8.5e-27
WP_058501479.1|1877902_1878325_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_143867780.1|1878534_1879947_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.3	2.0e-92
WP_143867782.1|1879949_1880579_+	bifunctional nicotinamidase/pyrazinamidase	NA	NA	NA	NA	NA
WP_143867784.1|1880934_1882227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143867787.1|1882272_1884846_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.2	2.6e-119
>prophage 131
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1913385	1916132	3046673		Bacillus_virus(50.0%)	3	NA	NA
WP_143867824.1|1913385_1914468_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.8	3.4e-28
WP_143867826.1|1914471_1915347_+	DUF1189 family protein	NA	NA	NA	NA	NA
WP_143867828.1|1915343_1916132_+	alpha/beta fold hydrolase	NA	A0A223FN69	NY_014_poxvirus	26.4	4.5e-06
>prophage 132
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1920412	1923956	3046673	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_143869524.1|1920412_1921885_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	5.2e-96
WP_058501447.1|1921884_1923462_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_143869525.1|1923506_1923956_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	33.3	6.8e-07
>prophage 133
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1946605	1948294	3046673		Staphylococcus_phage(100.0%)	1	NA	NA
WP_143867870.1|1946605_1948294_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	6.3e-37
>prophage 134
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1952439	1952865	3046673		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_143867897.1|1952439_1952865_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.0	5.6e-19
>prophage 135
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1962737	1964162	3046673		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_143867908.1|1962737_1964162_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	5.3e-45
>prophage 136
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1969467	1970501	3046673		Klosneuvirus(50.0%)	2	NA	NA
WP_143867925.1|1969467_1970133_+	adenylate kinase	NA	A0A1V0SK76	Klosneuvirus	29.7	3.7e-09
WP_143867927.1|1970132_1970501_+	thioredoxin family protein	NA	E3PZ79	Roseovarius_sp._217_phage	34.9	9.2e-10
>prophage 137
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1975420	1979070	3046673		Bacillus_virus(50.0%)	2	NA	NA
WP_143867932.1|1975420_1977985_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.3	1.4e-109
WP_143867933.1|1977981_1979070_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	42.4	2.0e-76
>prophage 138
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	1993027	1998309	3046673		Bacillus_phage(50.0%)	7	NA	NA
WP_058501985.1|1993027_1993852_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	1.8e-50
WP_058501984.1|1993851_1994262_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_058501983.1|1994290_1995643_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.2	2.5e-20
WP_058501982.1|1995635_1996316_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	4.0e-35
WP_143867952.1|1996318_1997170_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_143867954.1|1997162_1997645_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_115325308.1|1997634_1998309_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	3.7e-49
>prophage 139
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2001561	2002921	3046673		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_143867962.1|2001561_2002362_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.4	2.8e-11
WP_143869529.1|2002354_2002921_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.0	7.7e-24
>prophage 140
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2007813	2010072	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143867974.1|2007813_2010072_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.7	5.8e-14
>prophage 141
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2014439	2015777	3046673		Streptococcus_phage(100.0%)	1	NA	NA
WP_143867980.1|2014439_2015777_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	1.3e-37
>prophage 142
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2022818	2024540	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143867992.1|2022818_2024540_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	8.6e-58
>prophage 143
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2032576	2040367	3046673	tRNA	Klosneuvirus(25.0%)	8	NA	NA
WP_143868004.1|2032576_2033893_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	1.1e-23
WP_143868006.1|2033964_2034912_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_143868008.1|2034908_2036054_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	24.6	2.3e-19
WP_143868011.1|2036037_2036757_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_143868013.1|2036753_2037410_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_143868015.1|2037623_2037935_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_143868017.1|2037931_2038576_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	27.9	1.1e-13
WP_143868019.1|2038588_2040367_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	25.1	2.7e-14
>prophage 144
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2046601	2049380	3046673		Catovirus(50.0%)	3	NA	NA
WP_143868023.1|2046601_2047327_-	AAA family ATPase	NA	A0A1V0SAA3	Catovirus	33.3	1.8e-17
WP_143868025.1|2047455_2047929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143868027.1|2048531_2049380_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.4	2.6e-39
>prophage 145
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2062837	2066901	3046673		Bacteriophage(33.33%)	5	NA	NA
WP_058502359.1|2062837_2063482_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	38.1	3.8e-27
WP_143868047.1|2063481_2064477_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_143868049.1|2064477_2065716_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_058502356.1|2065735_2065984_-	acyl carrier protein	NA	A0A1S5R3K8	Pseudomonas_phage	40.2	9.2e-06
WP_143868051.1|2066151_2066901_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-14
>prophage 146
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2071966	2072356	3046673		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_115325306.1|2071966_2072356_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	5.0e-22
>prophage 147
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2088199	2092353	3046673		Bradyrhizobium_phage(33.33%)	4	NA	NA
WP_143868067.1|2088199_2088910_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	41.0	9.7e-40
WP_143868069.1|2088913_2089354_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.7	7.1e-41
WP_143868071.1|2089365_2090769_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_143868073.1|2090832_2092353_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	35.1	3.4e-74
>prophage 148
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2104092	2104680	3046673		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_143868087.1|2104092_2104680_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	1.5e-22
>prophage 149
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2109551	2111441	3046673		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_143868104.1|2109551_2111441_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	5.2e-117
>prophage 150
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2137291	2139766	3046673	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_143868171.1|2137291_2139766_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.9	4.7e-190
>prophage 151
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2149390	2152478	3046673		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_143868212.1|2149390_2150365_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	25.4	1.9e-09
WP_143868219.1|2150345_2151077_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_143868225.1|2151086_2152478_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	6.1e-22
>prophage 152
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2156947	2168047	3046673		Mollivirus(28.57%)	9	NA	NA
WP_143868243.1|2156947_2158153_+	protein kinase	NA	A0A0G2Y6J2	Acanthamoeba_polyphaga_mimivirus	27.6	3.3e-08
WP_143868251.1|2158315_2158888_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.5	4.0e-20
WP_143868260.1|2158884_2160201_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_143868266.1|2160203_2161688_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	37.4	2.1e-68
WP_143868272.1|2161775_2162780_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.6	3.1e-31
WP_143868278.1|2162745_2164014_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_143868284.1|2164010_2165054_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	38.4	8.6e-53
WP_143868287.1|2165053_2167396_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	33.8	7.5e-97
WP_058502027.1|2167840_2168047_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.2	2.7e-11
>prophage 153
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2176115	2177387	3046673		Pandoravirus(100.0%)	1	NA	NA
WP_143869533.1|2176115_2177387_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	35.8	1.9e-33
>prophage 154
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2180480	2181455	3046673		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_058502712.1|2180480_2181455_+	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	7.6e-11
>prophage 155
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2187147	2190434	3046673		Bacillus_phage(50.0%)	2	NA	NA
WP_143868319.1|2187147_2188158_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.9	1.1e-09
WP_143869534.1|2188355_2190434_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	43.3	8.2e-39
>prophage 156
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2211817	2214172	3046673		Salmonella_phage(50.0%)	2	NA	NA
WP_143868349.1|2211817_2213065_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.0	1.1e-22
WP_143868351.1|2213428_2214172_+	C26 family cysteine hydrolase domain-containing family	NA	A0A2K9L2L9	Tupanvirus	29.1	1.6e-08
>prophage 157
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2217938	2218154	3046673		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_058501713.1|2217938_2218154_-	cold shock domain-containing protein	NA	F2Y2B9	Organic_Lake_phycodnavirus	51.2	2.1e-06
>prophage 158
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2227733	2230322	3046673	tRNA	Catovirus(50.0%)	2	NA	NA
WP_143868377.1|2227733_2229218_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.3	1.1e-88
WP_143868379.1|2229214_2230322_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	3.7e-06
>prophage 159
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2240051	2245236	3046673	tRNA	Klosneuvirus(33.33%)	4	NA	NA
WP_143868398.1|2240051_2242643_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	42.5	1.0e-91
WP_058501732.1|2242682_2243126_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_143869535.1|2243118_2244153_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.3	2.5e-113
WP_058501733.1|2244561_2245236_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	48.3	1.3e-41
>prophage 160
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2253352	2262558	3046673	tRNA	Acanthocystis_turfacea_Chlorella_virus(50.0%)	7	NA	NA
WP_143868414.1|2253352_2254378_-	agmatine deiminase family protein	NA	M1ICB7	Acanthocystis_turfacea_Chlorella_virus	38.3	7.6e-70
WP_143868416.1|2254377_2256279_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_143869537.1|2256293_2257148_-	carbon-nitrogen hydrolase	NA	M1I268	Acanthocystis_turfacea_Chlorella_virus	32.8	4.0e-32
WP_135060300.1|2257554_2258112_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_143868418.1|2258088_2258556_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_143868420.1|2258552_2261351_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	27.6	4.0e-89
WP_143868422.1|2261634_2262558_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	35.1	1.1e-08
>prophage 161
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2266656	2268798	3046673		Vibrio_phage(100.0%)	1	NA	NA
WP_143868428.1|2266656_2268798_-	type IV pilus secretin PilQ	NA	O80264	Vibrio_phage	25.4	8.3e-18
>prophage 162
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2275714	2280992	3046673		Acinetobacter_phage(66.67%)	5	NA	NA
WP_143868440.1|2275714_2277049_-	response regulator	NA	W8CYM9	Bacillus_phage	30.8	2.8e-08
WP_058501769.1|2277045_2278638_-	ATPase	NA	NA	NA	NA	NA
WP_131780714.1|2278822_2279059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135060288.1|2279166_2280186_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.6	1.7e-74
WP_143868443.1|2280182_2280992_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	49.0	2.7e-54
>prophage 163
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2330616	2335879	3046673		Bacillus_virus(33.33%)	4	NA	NA
WP_143868528.1|2330616_2331912_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	37.9	8.9e-76
WP_143868530.1|2331908_2332517_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_143868532.1|2332519_2334847_-	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	48.8	2.6e-86
WP_143868534.1|2334922_2335879_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.4	1.5e-64
>prophage 164
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2342669	2360137	3046673		Staphylococcus_phage(22.22%)	14	NA	NA
WP_143868544.1|2342669_2345486_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.8	1.5e-176
WP_143868546.1|2345503_2346613_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A060BQZ3	Podovirus	29.8	1.1e-37
WP_143868548.1|2346766_2348371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143868550.1|2348786_2349707_+	recombination-associated protein RdgC	NA	A0A067ZG66	Vibrio_phage	31.0	7.6e-29
WP_143868552.1|2350011_2350449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143868554.1|2350798_2351578_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_143868556.1|2352064_2352892_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.9	5.2e-53
WP_143868558.1|2352888_2354526_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.6	8.8e-153
WP_143868560.1|2354762_2355155_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_143868562.1|2355313_2356210_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_143868564.1|2356696_2357167_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	1.5e-25
WP_143868566.1|2357257_2358466_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	1.7e-97
WP_143868568.1|2358470_2359079_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.0	1.1e-20
WP_058502088.1|2359063_2360137_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	30.0	2.2e-35
>prophage 165
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2367435	2368869	3046673	transposase	Wolbachia_phage(100.0%)	1	NA	NA
WP_143868582.1|2367435_2368869_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.0	2.4e-37
>prophage 166
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2389254	2392017	3046673		Mollivirus(50.0%)	3	NA	NA
WP_143868596.1|2389254_2390004_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	23.3	3.7e-05
WP_143868598.1|2390013_2390559_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_143869540.1|2390946_2392017_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.0	5.2e-21
>prophage 167
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2407734	2410041	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143868617.1|2407734_2410041_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.7	5.4e-15
>prophage 168
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2422575	2424786	3046673		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_143868639.1|2422575_2424786_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	30.2	1.0e-23
>prophage 169
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2429471	2434277	3046673		Tupanvirus(50.0%)	2	NA	NA
WP_143868647.1|2429471_2431052_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	30.7	5.2e-09
WP_143868649.1|2431343_2434277_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.6	8.1e-16
>prophage 170
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2437531	2439361	3046673		Hokovirus(100.0%)	1	NA	NA
WP_143868656.1|2437531_2439361_+	DNA helicase RecQ	NA	A0A1V0SGM9	Hokovirus	37.3	3.9e-85
>prophage 171
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2445906	2447661	3046673	protease	Staphylococcus_phage(50.0%)	2	NA	NA
WP_143868668.1|2445906_2446509_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	3.2e-12
WP_143868670.1|2446722_2447661_+|protease	protease SohB	protease	A0A2I6UH21	Salinibacter_virus	31.1	4.9e-15
>prophage 172
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2452908	2459214	3046673		Planktothrix_phage(40.0%)	8	NA	NA
WP_143868681.1|2452908_2453970_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.2	1.4e-82
WP_143868683.1|2453969_2454887_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_143868685.1|2454917_2455643_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	5.6e-19
WP_143868687.1|2455639_2456152_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_143868689.1|2456132_2456705_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_143868691.1|2456701_2457229_-	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	46.7	3.2e-24
WP_143869543.1|2457241_2458204_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.9	2.0e-35
WP_143868693.1|2458416_2459214_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.0	2.4e-23
>prophage 173
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2466001	2466601	3046673		Acinetobacter_phage(100.0%)	1	NA	NA
WP_143868705.1|2466001_2466601_+	C26 family cysteine hydrolase domain-containing family	NA	A0A0P0IKJ1	Acinetobacter_phage	48.9	1.3e-53
>prophage 174
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2473550	2474180	3046673		Vibrio_phage(100.0%)	1	NA	NA
WP_143868721.1|2473550_2474180_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	39.4	8.3e-11
>prophage 175
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2479759	2483603	3046673	integrase	Moraxella_phage(50.0%)	4	2477523:2477536	2488370:2488383
2477523:2477536	attL	TTTATTAATTCTTC	NA	NA	NA	NA
WP_143868733.1|2479759_2481013_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHM8	Moraxella_phage	33.4	9.3e-54
WP_058500971.1|2481295_2481706_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143868735.1|2481789_2482578_+	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
WP_143868737.1|2482628_2483603_+	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	28.2	7.6e-19
2488370:2488383	attR	TTTATTAATTCTTC	NA	NA	NA	NA
>prophage 176
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2493620	2497284	3046673		Pseudomonas_phage(50.0%)	3	NA	NA
WP_143868749.1|2493620_2494115_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	48.2	5.9e-28
WP_143868751.1|2494221_2494494_-	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_143868753.1|2494749_2497284_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.9	1.4e-45
>prophage 177
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2508595	2511814	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143868761.1|2508595_2511814_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.7	2.3e-03
>prophage 178
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2515665	2517435	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143868769.1|2515665_2517435_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.3	5.7e-57
>prophage 179
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2520728	2523356	3046673		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_143868777.1|2520728_2523356_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.6	3.0e-62
>prophage 180
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2528415	2537214	3046673		Pike_perch_iridovirus(25.0%)	6	NA	NA
WP_143868787.1|2528415_2530023_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	52.4	1.9e-19
WP_143868789.1|2530032_2530809_+	gamma-carboxygeranoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_143868791.1|2530817_2532788_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_143868793.1|2532800_2533706_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.2	8.5e-41
WP_143868795.1|2533723_2535664_+	acetoacetate--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	24.5	2.0e-10
WP_135060042.1|2536188_2537214_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.8	1.4e-26
>prophage 181
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2545891	2548069	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143868810.1|2545891_2548069_-	DNA helicase II	NA	A7KV33	Bacillus_phage	38.5	3.4e-120
>prophage 182
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2558498	2559137	3046673		Catovirus(100.0%)	1	NA	NA
WP_058501176.1|2558498_2559137_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.8	2.0e-28
>prophage 183
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2562836	2568309	3046673	protease	Burkholderia_phage(25.0%)	4	NA	NA
WP_058501179.1|2562836_2563115_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	47.7	2.5e-15
WP_143868837.1|2563241_2565662_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.1	1.5e-212
WP_058501181.1|2566114_2567389_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.1e-134
WP_058501183.1|2567667_2568309_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	2.1e-57
>prophage 184
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2571738	2577537	3046673		Tupanvirus(33.33%)	6	NA	NA
WP_143868843.1|2571738_2573592_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.9	1.4e-69
WP_058501186.1|2573636_2573837_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_058501187.1|2573890_2574571_-	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	33.2	3.3e-21
WP_058501188.1|2574554_2574947_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_058501189.1|2574959_2575715_-	signal peptidase I	NA	NA	NA	NA	NA
WP_058501190.1|2575731_2577537_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	27.1	3.8e-24
>prophage 185
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2585460	2587188	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143868859.1|2585460_2587188_+	haloalkane dehalogenase	NA	A0A2K9KZN8	Tupanvirus	27.7	3.8e-05
>prophage 186
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2600825	2610445	3046673	tRNA	Tupanvirus(20.0%)	7	NA	NA
WP_143868880.1|2600825_2602499_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	5.8e-43
WP_143868882.1|2602532_2603558_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	71.2	8.2e-16
WP_143868884.1|2603614_2604799_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	1.4e-38
WP_143868886.1|2604973_2605627_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143868888.1|2605638_2607066_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_082636496.1|2607320_2608199_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.5	6.9e-72
WP_143868890.1|2608168_2610445_-	ankyrin repeat domain-containing protein	NA	A0A2L2DMI5	Acanthamoeba_polyphaga_mimivirus	25.8	3.8e-05
>prophage 187
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2614101	2615535	3046673	transposase	Wolbachia_phage(100.0%)	1	NA	NA
WP_143868896.1|2614101_2615535_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	4.8e-38
>prophage 188
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2623357	2624617	3046673		Burkholderia_virus(100.0%)	1	NA	NA
WP_143869548.1|2623357_2624617_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.8	1.1e-49
>prophage 189
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2629287	2630067	3046673		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_135059994.1|2629287_2630067_+	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	2.7e-11
>prophage 190
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2642965	2644054	3046673		Pseudomonas_phage(100.0%)	1	NA	NA
WP_143868926.1|2642965_2644054_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.5	2.5e-07
>prophage 191
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2650746	2658573	3046673		Pandoravirus(20.0%)	5	NA	NA
WP_143868938.1|2650746_2652057_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.5	2.6e-46
WP_135059981.1|2652435_2653584_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	56.7	7.3e-122
WP_143868940.1|2653601_2654723_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	2.9e-46
WP_058500649.1|2654829_2655972_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.8	3.5e-23
WP_058500648.1|2656626_2658573_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	51.7	1.2e-148
>prophage 192
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2668710	2671818	3046673		Leptospira_phage(100.0%)	1	NA	NA
WP_143868962.1|2668710_2671818_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	24.0	3.2e-79
>prophage 193
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2681828	2686462	3046673		Streptococcus_phage(50.0%)	5	NA	NA
WP_143868978.1|2681828_2683097_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	49.5	2.4e-110
WP_058500623.1|2683241_2683511_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_058500622.1|2683968_2684853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143868980.1|2684842_2685790_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_143868982.1|2685808_2686462_-	7-carboxy-7-deazaguanine synthase QueE	NA	M1PXL8	Cellulophaga_phage	23.9	5.3e-08
>prophage 194
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2689640	2694694	3046673		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_058500616.1|2689640_2690378_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	6.1e-13
WP_143868993.1|2690377_2691511_-	MlaE family lipid ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143868995.1|2691582_2692866_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_143868997.1|2693284_2694694_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	44.3	2.5e-111
>prophage 195
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2702394	2704638	3046673		Bacillus_phage(100.0%)	1	NA	NA
WP_143869012.1|2702394_2704638_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.0	6.2e-16
>prophage 196
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2716277	2723899	3046673	holin,transposase	Wolbachia_phage(33.33%)	8	NA	NA
WP_143869025.1|2716277_2717711_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.4	2.2e-38
WP_143869027.1|2718089_2718461_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_143869029.1|2718810_2719179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869031.1|2719190_2719460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869033.1|2719635_2720646_+	amidoligase enzyme	NA	NA	NA	NA	NA
WP_143869035.1|2720642_2721323_+	C26 family cysteine hydrolase domain-containing family	NA	A0A2P9FI75	Pseudomonas_phage	27.3	7.4e-05
WP_143869037.1|2721497_2722283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143869039.1|2722735_2723899_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.2	3.8e-25
>prophage 197
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2753974	2758753	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143869080.1|2753974_2758753_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.7	8.9e-121
>prophage 198
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2766198	2768417	3046673		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_143869092.1|2766198_2767137_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	28.3	1.3e-28
WP_143869094.1|2767133_2768417_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.4	2.2e-58
>prophage 199
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2777449	2779009	3046673		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_143869112.1|2777449_2779009_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	21.9	1.5e-16
>prophage 200
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2797943	2800417	3046673		Myxoma_virus(50.0%)	2	NA	NA
WP_143869145.1|2797943_2798747_+	serpin family protein	NA	K4J0Z1	Myxoma_virus	30.6	4.9e-24
WP_143869147.1|2798833_2800417_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	33.4	2.9e-36
>prophage 201
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2810439	2811483	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_143869157.1|2810439_2811483_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L698	Tupanvirus	37.7	1.1e-23
>prophage 202
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2824380	2827579	3046673		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_143869180.1|2824380_2826267_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.4	2.5e-71
WP_143869182.1|2826595_2827579_+	hypothetical protein	NA	V5L5P8	Insectomime_virus	32.1	4.6e-24
>prophage 203
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2831038	2831986	3046673		Cronobacter_phage(100.0%)	1	NA	NA
WP_143869188.1|2831038_2831986_-	TerC/Alx family metal homeostasis membrane protein	NA	K4F9T9	Cronobacter_phage	30.4	7.3e-27
>prophage 204
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2847525	2848338	3046673		Vibrio_phage(100.0%)	1	NA	NA
WP_143869215.1|2847525_2848338_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	45.5	4.6e-62
>prophage 205
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2853719	2866241	3046673	protease,tRNA	Cafeteria_roenbergensis_virus(14.29%)	12	NA	NA
WP_143869221.1|2853719_2854505_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.9	2.5e-33
WP_143869223.1|2854732_2855341_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_143869225.1|2855672_2856137_+	PH domain-containing protein	NA	A0A2H5BPU0	Salmonella_phage	36.0	6.0e-06
WP_143869227.1|2856324_2858607_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	36.1	4.3e-97
WP_135061044.1|2858754_2859195_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_143869229.1|2859196_2860267_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.3	9.1e-34
WP_143869231.1|2860263_2861289_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058500818.1|2861405_2861915_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.7	3.5e-15
WP_143869233.1|2862018_2862963_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.8	9.0e-09
WP_143869235.1|2862959_2864240_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_143869237.1|2864243_2864990_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_143869561.1|2865083_2866241_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	45.5	8.0e-76
>prophage 206
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2880609	2881542	3046673		Megavirus(100.0%)	1	NA	NA
WP_143869259.1|2880609_2881542_+	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	52.3	1.7e-12
>prophage 207
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2895761	2902161	3046673	protease	Erwinia_phage(33.33%)	8	NA	NA
WP_143869563.1|2895761_2897081_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.1	8.1e-40
WP_143869281.1|2897172_2897751_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_058502694.1|2897897_2898323_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_058502695.1|2898328_2898583_+	glutaredoxin 3	NA	A0A292GID4	Xanthomonas_phage	40.3	1.1e-06
WP_058502696.1|2898589_2899066_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_143869283.1|2899067_2900057_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_143869285.1|2900201_2901215_+	tubulin--tyrosine ligase family protein	NA	NA	NA	NA	NA
WP_143869287.1|2901288_2902161_+	LicD family protein	NA	A0A1V0SD50	Indivirus	50.0	4.9e-09
>prophage 208
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2914509	2915943	3046673	transposase	Wolbachia_phage(100.0%)	1	NA	NA
WP_143866854.1|2914509_2915943_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	4.8e-38
>prophage 209
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2921415	2922654	3046673		Salmonella_phage(100.0%)	1	NA	NA
WP_135061091.1|2921415_2922654_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	4.5e-16
>prophage 210
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2938965	2939853	3046673		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_143869335.1|2938965_2939853_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	34.3	5.3e-11
>prophage 211
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2967520	2968243	3046673		Paenibacillus_phage(100.0%)	1	NA	NA
WP_143869384.1|2967520_2968243_+	FliA/WhiG family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	26.7	2.9e-07
>prophage 212
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2974566	2975766	3046673	integrase	Salmonella_phage(100.0%)	1	2974530:2974553	2984340:2984363
2974530:2974553	attL	TGGTACCAAAAGTGGTACCAAAAT	NA	NA	NA	NA
WP_143869391.1|2974566_2975766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4QX09	Salmonella_phage	28.1	6.9e-38
WP_143869391.1|2974566_2975766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4QX09	Salmonella_phage	28.1	6.9e-38
2984340:2984363	attR	TGGTACCAAAAGTGGTACCAAAAT	NA	NA	NA	NA
>prophage 213
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	2994398	2998384	3046673		Planktothrix_phage(50.0%)	2	NA	NA
WP_143869403.1|2994398_2996207_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.2e-12
WP_143869404.1|2996491_2998384_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.7	9.0e-93
>prophage 214
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	3003769	3007422	3046673	transposase	uncultured_virus(66.67%)	3	NA	NA
WP_143866854.1|3003769_3005203_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	4.8e-38
WP_143869409.1|3005456_3007106_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.2	3.4e-173
WP_058501565.1|3007131_3007422_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	45.7	7.2e-18
>prophage 215
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	3016113	3020135	3046673		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_143869412.1|3016113_3016593_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	51.0	2.0e-33
WP_143869413.1|3016838_3017465_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_143869414.1|3017486_3018710_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058501574.1|3019187_3020135_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.8	1.6e-42
>prophage 216
NZ_CP041668	Legionella israelensis strain L18-01051 chromosome, complete genome	3046673	3027772	3028654	3046673		Tupanvirus(100.0%)	1	NA	NA
WP_058501581.1|3027772_3028654_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.4	2.6e-18
