The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032055	Acinetobacter baumannii strain A320 (RUH134) chromosome, complete genome	3896541	1115641	1127989	3896541		Acinetobacter_phage(95.65%)	24	NA	NA
WP_000004579.1|1115641_1116364_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_000147323.1|1116360_1116768_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|1116768_1117020_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000698529.1|1117021_1117954_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_001207474.1|1117950_1119072_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000064463.1|1119083_1119407_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000656405.1|1119399_1119690_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_001101038.1|1119689_1120133_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000051960.1|1120326_1120569_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|1120575_1120779_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|1120917_1121421_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|1121422_1122430_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370485.1|1122481_1122697_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000052252.1|1122711_1123464_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000703023.1|1123568_1123757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048916.1|1123767_1124088_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001180660.1|1124149_1124422_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000602535.1|1124493_1124718_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_000064627.1|1124710_1125592_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_001003671.1|1125594_1126395_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000647826.1|1126391_1126730_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_000462878.1|1126722_1127115_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100162.1|1127114_1127516_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_001277128.1|1127512_1127989_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 2
NZ_CP032055	Acinetobacter baumannii strain A320 (RUH134) chromosome, complete genome	3896541	1131947	1160621	3896541	terminase,capsid	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001136773.1|1131947_1132403_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
WP_000378523.1|1132463_1132898_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_000435230.1|1132866_1133508_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000729387.1|1133566_1134082_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_001132930.1|1134041_1135334_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000301495.1|1135373_1136714_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_000146970.1|1136723_1137830_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000004550.1|1137826_1138057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291451.1|1138072_1138225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589038.1|1138276_1138591_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_000056390.1|1138677_1139469_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000852265.1|1139482_1140433_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000524488.1|1140477_1140813_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000008459.1|1140816_1141197_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524257.1|1141197_1141566_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000540685.1|1141634_1141832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235282.1|1141839_1142133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248411.1|1142184_1142595_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000539749.1|1142566_1142935_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_001984404.1|1142891_1143335_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_001277696.1|1143336_1143555_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|1143663_1144185_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|1144281_1144635_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|1144634_1145813_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|1145865_1146783_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|1146852_1147368_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|1147870_1148170_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1148178_1148637_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|1148741_1149422_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|1149423_1149687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|1149814_1154125_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|1154215_1154803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|1154895_1155294_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|1155293_1155800_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|1155796_1156159_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000598554.1|1156151_1159577_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000433907.1|1159644_1160034_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|1160075_1160621_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 3
NZ_CP032055	Acinetobacter baumannii strain A320 (RUH134) chromosome, complete genome	3896541	1293117	1307914	3896541		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187844.1|1293117_1293666_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1293928_1295428_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1295429_1297805_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1297811_1298795_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1298805_1299501_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1299510_1300317_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1300326_1301376_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1301731_1304464_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1304543_1307243_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|1307338_1307914_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
>prophage 4
NZ_CP032055	Acinetobacter baumannii strain A320 (RUH134) chromosome, complete genome	3896541	2644813	2708385	3896541	transposase,tRNA,integrase	Escherichia_phage(29.41%)	60	2686043:2686102	2701054:2701880
WP_002000926.1|2644813_2645554_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_000912930.1|2645724_2646351_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000703552.1|2646361_2647141_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000026482.1|2647227_2648643_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001987632.1|2648856_2650101_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000546639.1|2650104_2651121_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_000654268.1|2651244_2651589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498918.1|2651806_2654032_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001060738.1|2654057_2654474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941316.1|2654742_2655231_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|2655287_2657867_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237344.1|2658168_2658975_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001026230.1|2658971_2659397_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001195082.1|2659488_2659911_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005133790.1|2660349_2661057_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001159802.1|2661217_2662267_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_001034598.1|2662326_2663106_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000776215.1|2663222_2663540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517792.1|2663662_2664982_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|2665046_2666213_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188823.1|2666488_2667514_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000199457.1|2667783_2670420_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001185176.1|2670485_2671766_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|2672012_2672267_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495836.1|2672336_2672903_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000735756.1|2672968_2673358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111760.1|2673596_2674154_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077405.1|2674197_2675196_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|2675307_2676627_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_002001404.1|2676949_2677147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256760.1|2677545_2679096_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000599996.1|2679119_2679950_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000226456.1|2680015_2680978_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000459997.1|2681488_2682211_+	pirin family protein	NA	NA	NA	NA	NA
WP_000107496.1|2682275_2682899_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000626177.1|2683423_2684383_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000600025.1|2684445_2685279_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
2686043:2686102	attL	TTGGCGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATG	NA	NA	NA	NA
WP_001067855.1|2686111_2686816_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000147567.1|2687849_2688410_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2688535_2688886_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|2689088_2690102_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_002089484.1|2690272_2690737_+	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_001102919.1|2690855_2691368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002018749.1|2691252_2691906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206316.1|2692318_2693110_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|2693273_2693621_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2693614_2694454_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2694581_2695082_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|2695588_2696353_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001375131.1|2696416_2696674_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
WP_000993245.1|2696911_2697124_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|2697189_2697426_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|2697422_2697788_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|2697805_2699491_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|2699529_2699955_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|2699982_2700258_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001067855.1|2700339_2701044_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000656305.1|2703169_2703547_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
2701054:2701880	attR	CATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGCCAAGGTACGTCTGTACGGGCGCATCGGTCAGGCGCTGATCGACGCCAAGCAATCAGGCCGCGATGCGTTTGCCGCCATCGAGGCCGTCATGTCCTGGGATTCCTTTGCCGAGAGCGTCACCGAGGCGCAGAAGCTCGCGCAACCCGATGACTTCGATTTCCTGCATCGCATCGGCGAGAGCTACGCCACCCTGCGCCGCTATGCACCGGAATTCCTTGCCGTGCTCAAGCTGCGGGCCGCGCCCGCCGCCAAAAACGTGCTTGATGCCATTGAGGTGCTGCGCGGCATGAACACCGACAACGCCCGCAAGCTGCCAGCCGATGCACCGACCGGCTTCATCAAGCCGCGCTGGCAGAAACTGGTGATGACCGACGCCGGCATCGACCGGCGCTACTACGAACTGTGCGCGCTGTCCGAGTTGAAGAACTCCCTGCGCTCGGGCGACATCTGGGTGCAGGGTTCACGCCAGTTCAAGGACTTCGAGGACTACCTGGTACCGCCCGAGAAGTTCACCAGCCTCAAGCAGTCCAGCGAATTGCCGCTGGCCGTGGCCACCGACTGCGAACAATATCTGCATGAGCGGCTGACGCTGCTGGAAGCACAACTTGCCACCGTCAACCGCATGGCGGCAGCCAACGACCTGCCGGATGCCATCATCACCGAGTCGGGCTTGAAGATCACGCCGCTGGATGCGGCGGTGCCCGACACCGCGCAGGCGCTGATAGACCAGACAGCCATGGTCCTGCCGCACGTCAAGATCACCGAACTGC	NA	NA	NA	NA
WP_000412211.1|2703747_2704407_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_031944978.1|2705394_2708385_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.0	0.0e+00
>prophage 5
NZ_CP032055	Acinetobacter baumannii strain A320 (RUH134) chromosome, complete genome	3896541	2870633	2918361	3896541	capsid,tail,holin,terminase,integrase,tRNA	Acinetobacter_phage(66.67%)	55	2861905:2861919	2888668:2888682
2861905:2861919	attL	TTTAATAATATTGAT	NA	NA	NA	NA
WP_001988581.1|2870633_2871680_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000537617.1|2871783_2873388_+|integrase	site-specific integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.1	1.4e-91
WP_000200051.1|2873390_2873582_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	83.9	4.4e-24
WP_000566934.1|2873643_2874234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958559.1|2874481_2874811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002016874.1|2874831_2875062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189398.1|2875233_2875551_-	hypothetical protein	NA	A0A1W5PUJ8	Salmonella_phage	58.5	9.6e-24
WP_001019749.1|2875551_2876097_-	N-acetylmuramidase	NA	A0A0B5KTG8	Acinetobacter_phage	89.4	1.1e-91
WP_000200151.1|2876155_2876380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999700.1|2876360_2876654_-|holin	holin	holin	NA	NA	NA	NA
WP_000371015.1|2876722_2877448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141976.1|2877447_2877771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002063943.1|2877771_2889009_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	35.9	3.9e-10
2888668:2888682	attR	ATCAATATTATTAAA	NA	NA	NA	NA
WP_000920736.1|2889075_2889747_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
WP_000778488.1|2889730_2890486_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000175075.1|2890492_2891191_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000985763.1|2891200_2891551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281459.1|2891605_2891947_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000191304.1|2892064_2896030_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	3.7e-165
WP_000720591.1|2896090_2896492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966689.1|2896572_2896977_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
WP_000838146.1|2897041_2897224_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185622.1|2897555_2898089_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_000094299.1|2898133_2899063_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	41.0	1.1e-54
WP_000121166.1|2899170_2899383_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_001132270.1|2899384_2899783_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_000539752.1|2899784_2900153_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
WP_000248323.1|2900124_2900529_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	93.2	3.4e-66
WP_001197735.1|2900537_2900951_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_000008492.1|2900907_2901297_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_000767881.1|2901301_2901967_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_000214195.1|2902031_2902988_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
WP_000770060.1|2903015_2903783_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
WP_000159880.1|2903896_2904211_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_000166323.1|2904279_2904792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741600.1|2905084_2906188_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	83.4	5.9e-177
WP_001286349.1|2906189_2907641_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.2	1.2e-259
WP_000102065.1|2907637_2909065_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	1.2e-251
WP_000729373.1|2909054_2909525_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
WP_000372127.1|2909583_2910225_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
WP_000377939.1|2910193_2910661_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
WP_000359988.1|2910650_2910824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837652.1|2911138_2911909_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
WP_001989822.1|2912094_2912325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|2912505_2913069_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001279874.1|2913090_2913375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|2913384_2913792_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001293626.1|2913788_2914190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039747.1|2914176_2914359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779000.1|2914355_2914754_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
WP_000755976.1|2914765_2915632_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
WP_000631609.1|2915628_2916087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049976.1|2916083_2917187_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
WP_000612880.1|2917183_2918038_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000108908.1|2918034_2918361_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	36.0	3.2e-06
