The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	2224484	2267984	5342084	capsid,tail,holin,tRNA,plate,terminase,lysis,integrase,portal,head	Escherichia_phage(28.89%)	52	2217388:2217403	2245740:2245755
2217388:2217403	attL	AGGCGGTGGAAATAGC	NA	NA	NA	NA
WP_004150925.1|2224484_2227727_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_071531177.1|2228699_2229014_+	HdeB family protein	NA	NA	NA	NA	NA
WP_002917638.1|2229082_2229355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718525.1|2230027_2231044_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.7	9.8e-195
WP_077270161.1|2231043_2231631_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	95.8	1.1e-100
WP_058655896.1|2231746_2232010_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	92.0	6.5e-42
WP_070544410.1|2232040_2232550_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	7.3e-90
WP_023343330.1|2232557_2232758_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_000963463.1|2232721_2233060_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_023333493.1|2233127_2233355_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	98.7	1.3e-30
WP_070544409.1|2233354_2233576_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	2.7e-33
WP_070544408.1|2233576_2233849_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	77.0	2.6e-33
WP_070544407.1|2233845_2234127_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	51.3	1.5e-12
WP_143441734.1|2234117_2236343_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.0	0.0e+00
WP_064388418.1|2236458_2236899_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	82.5	5.7e-59
WP_085287314.1|2236981_2237713_+	hypothetical protein	NA	Q37850	Escherichia_phage	90.5	2.9e-124
WP_070544315.1|2237842_2238643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102067839.1|2238730_2238940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065807921.1|2238988_2240032_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	4.4e-166
WP_064184062.1|2240031_2241801_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	2.8e-306
WP_065807922.1|2241966_2242821_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.6e-126
WP_065807923.1|2242894_2243953_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	2.3e-162
WP_070544313.1|2243956_2244700_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.7	1.5e-99
WP_009309691.1|2244796_2245303_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_065807925.1|2245302_2245506_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	77.6	1.6e-24
WP_004195910.1|2245510_2245801_+|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
2245740:2245755	attR	AGGCGGTGGAAATAGC	NA	NA	NA	NA
WP_065807926.1|2245787_2246285_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.9	7.9e-81
WP_065807927.1|2246281_2246713_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	1.4e-41
WP_141119850.1|2246594_2246846_+|holin	holin	holin	S4TNY4	Salmonella_phage	70.0	2.2e-23
WP_065807929.1|2246808_2247276_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	76.8	1.3e-64
WP_070544311.1|2247268_2247718_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	2.5e-49
WP_065807931.1|2247786_2248428_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	78.4	4.0e-93
WP_065807932.1|2248424_2248772_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	76.5	1.1e-44
WP_065807933.1|2248776_2249685_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.5	2.1e-111
WP_065807955.1|2249677_2250367_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	59.9	1.0e-57
WP_070544309.1|2250373_2252371_+	hypothetical protein	NA	H7BUR7	unidentified_phage	24.3	4.7e-07
WP_070544307.1|2252380_2253460_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	40.9	1.4e-58
WP_065807936.1|2253472_2253745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070544305.1|2253872_2254949_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	43.6	3.3e-31
WP_004195732.1|2255059_2256241_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.4	2.3e-195
WP_014343412.1|2256254_2256770_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|2256830_2257106_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|2257120_2257258_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_070544303.1|2257250_2259692_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	73.0	2.4e-295
WP_032420037.1|2259705_2260185_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	6.9e-66
WP_064143469.1|2260184_2261351_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.4	8.1e-177
WP_032420109.1|2261418_2261637_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|2261994_2262501_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|2262600_2264442_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|2264660_2266406_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|2266517_2266733_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|2266970_2267984_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 2
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	2773020	2781972	5342084	integrase	Enterobacteria_phage(83.33%)	10	2772388:2772410	2782022:2782044
2772388:2772410	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_080790103.1|2773020_2775354_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_080790101.1|2775368_2775689_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004185275.1|2775685_2775913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080790098.1|2775909_2776461_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	2.1e-34
WP_130941929.1|2776675_2776879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080790093.1|2777274_2778012_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	58.8	4.6e-69
WP_080790090.1|2778008_2778242_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	61.7	3.1e-19
WP_080790088.1|2778259_2778826_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_052455064.1|2779195_2780095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437168.1|2780778_2781972_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.1	1.4e-104
2782022:2782044	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
>prophage 3
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	3233468	3240373	5342084	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3233468_3234332_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023307294.1|3234342_3235116_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|3235356_3236250_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3236495_3237857_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3238175_3238898_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3238894_3240373_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	4290636	4301523	5342084		Escherichia_phage(87.5%)	9	NA	NA
WP_004190234.1|4290636_4293744_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|4293798_4295064_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|4295094_4296183_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|4296269_4296530_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|4296827_4297688_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|4297708_4298470_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4298730_4299633_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|4299644_4300910_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|4300902_4301523_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	4576950	4629653	5342084	tail,holin,protease,terminase,integrase	Salmonella_phage(16.07%)	72	4574284:4574299	4626959:4626974
4574284:4574299	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_032436934.1|4576950_4578216_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.3e-209
WP_020804455.1|4578217_4578637_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	2.5e-35
WP_004892499.1|4579188_4579611_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_032436930.1|4580343_4580610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049124524.1|4580622_4581702_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	41.2	2.8e-59
WP_050484817.1|4581711_4583679_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	67.8	1.2e-39
WP_032436928.1|4583754_4586823_-	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
WP_017880229.1|4586819_4587200_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_032436926.1|4587209_4587692_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	3.7e-83
WP_143441750.1|4587678_4588152_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.3	3.6e-59
WP_032436924.1|4588466_4588802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143441751.1|4588885_4591783_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.8	3.2e-105
WP_050484820.1|4591856_4592225_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	38.7	4.9e-11
WP_004190632.1|4592333_4593017_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	42.4	4.9e-41
WP_004190635.1|4593083_4593281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|4593418_4593901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032436918.1|4593953_4595126_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	5.5e-24
WP_004190640.1|4595149_4595542_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_008807839.1|4595538_4596090_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004217344.1|4596091_4596475_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|4596461_4596695_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_032436916.1|4596704_4596959_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	1.0e-20
WP_004217348.1|4596960_4597356_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|4597677_4598631_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032436914.1|4598641_4599421_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.0	2.7e-67
WP_032436910.1|4599933_4601046_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.8	7.4e-111
WP_008807834.1|4601029_4602430_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|4602429_4603737_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_016831936.1|4603714_4604719_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.5	2.3e-34
WP_016831935.1|4605067_4605313_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	6.7e-33
WP_016831934.1|4605597_4605819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075206832.1|4605925_4606114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831932.1|4606559_4606760_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
WP_016831930.1|4606943_4607219_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	2.0e-09
WP_004899661.1|4607221_4607851_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	77.5	3.1e-90
WP_008806056.1|4607850_4608132_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
WP_032437153.1|4608118_4608514_-	membrane protein	NA	G8C7V8	Escherichia_phage	72.3	7.2e-45
WP_032436907.1|4609218_4609908_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.1	1.5e-61
WP_009483890.1|4609904_4610045_-	YlcG family protein	NA	NA	NA	NA	NA
WP_016831926.1|4610041_4610680_-	protein ninG	NA	H6WRY9	Salmonella_phage	68.9	4.1e-74
WP_032413853.1|4610672_4610843_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_004223230.1|4610848_4611445_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_008807825.1|4611892_4612885_-|protease	periplasmic serine protease	protease	NA	NA	NA	NA
WP_032426283.1|4612898_4613102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050484816.1|4613281_4613575_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	58.2	3.0e-11
WP_008807822.1|4613892_4614186_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	83.5	3.8e-43
WP_048264484.1|4614185_4614491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032436904.1|4614483_4614681_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	64.7	3.5e-08
WP_004218528.1|4615098_4615401_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019704107.1|4615397_4616135_-	Replication protein 14	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
WP_032437151.1|4616131_4617109_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	76.7	1.3e-63
WP_020804197.1|4617168_4617966_-	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	6.1e-91
WP_001548453.1|4618051_4618273_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004178811.1|4618312_4618546_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|4618650_4619340_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178801.1|4619362_4619482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426564.1|4619702_4620776_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	86.8	3.8e-181
WP_032436902.1|4620814_4621018_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	7.8e-19
WP_004151303.1|4621445_4621640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426276.1|4621728_4622013_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	2.5e-39
WP_016831908.1|4622029_4622776_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_032426275.1|4622772_4623396_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_032426563.1|4623424_4623952_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
WP_032436900.1|4623948_4624170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254754.1|4624166_4624823_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	62.7	1.3e-67
WP_012542038.1|4624819_4625128_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_004892750.1|4625135_4625375_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_072001757.1|4625384_4625699_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004892753.1|4625595_4626783_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004151901.1|4626959_4627850_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
4626959:4626974	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|4627849_4628842_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|4628843_4629653_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	4743099	4811659	5342084	capsid,tail,tRNA,plate,terminase,integrase,portal,head	Enterobacteria_phage(51.43%)	79	4748327:4748344	4784456:4784473
WP_002901088.1|4743099_4743600_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|4743716_4744163_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|4744146_4744938_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190880.1|4745039_4746224_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|4746255_4746948_-	CTP synthase	NA	NA	NA	NA	NA
WP_004190885.1|4747093_4747603_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_023279122.1|4747589_4747946_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190888.1|4747935_4748175_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
4748327:4748344	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|4748439_4748691_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_032442249.1|4748734_4749874_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.7	2.7e-145
WP_040206812.1|4750028_4751201_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	3.8e-158
WP_023300887.1|4751200_4751716_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	1.7e-57
WP_040206809.1|4751761_4752079_+	hypothetical protein	NA	B9A7B2	Serratia_phage	53.8	5.1e-17
WP_032440702.1|4752078_4752237_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040206805.1|4752223_4755199_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.6e-219
WP_040206804.1|4755214_4755682_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	64.1	5.0e-53
WP_052454877.1|4755790_4757536_+	AIPR family protein	NA	NA	NA	NA	NA
WP_023339951.1|4757788_4758886_-	hypothetical protein	NA	G4KKN6	Yersinia_phage	48.9	1.8e-08
WP_023339950.1|4758885_4759098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040206799.1|4759094_4762121_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_032457349.1|4762110_4763034_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	9.9e-53
WP_032411305.1|4763035_4763386_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	2.1e-27
WP_032457348.1|4763382_4763970_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	2.2e-61
WP_040206796.1|4763966_4764602_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	1.0e-56
WP_040206794.1|4764598_4765066_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_050594805.1|4765066_4765342_-	hypothetical protein	NA	B6SD31	Bacteriophage	34.1	6.6e-05
WP_072044116.1|4765247_4765577_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_023339943.1|4765588_4766134_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_040206791.1|4766130_4766415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|4766405_4766606_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213109.1|4766605_4767121_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_032457346.1|4767233_4768091_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	1.1e-69
WP_143441753.1|4768140_4769175_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_004213106.1|4769184_4770024_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
WP_004213105.1|4770180_4771908_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_004213104.1|4771901_4772963_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	3.1e-143
WP_099751683.1|4773563_4775714_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_143441754.1|4775706_4777098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065907435.1|4779597_4780533_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.4	6.0e-82
WP_004131528.1|4780529_4780757_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
WP_023328078.1|4780765_4781332_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_004213098.1|4781328_4781553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143441755.1|4781621_4781894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009486498.1|4781909_4782287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328080.1|4782302_4782521_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|4782541_4782820_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|4782940_4783240_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_023287454.1|4783355_4784339_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|4784604_4785618_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
4784456:4784473	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|4785675_4785777_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|4785776_4785851_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|4785968_4786094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|4786153_4786417_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|4786547_4787186_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|4787275_4788190_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|4788851_4789895_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004190896.1|4790197_4791406_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004190899.1|4791478_4793263_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|4793269_4794160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|4794280_4795789_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|4796099_4796786_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004190902.1|4797394_4798027_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|4798593_4798791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|4798906_4799917_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|4799913_4801320_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|4801375_4802263_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004190904.1|4802279_4802786_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|4802812_4803307_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|4803397_4803583_-	general stress protein	NA	NA	NA	NA	NA
WP_004190910.1|4804205_4805399_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|4805511_4805739_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140532.1|4805759_4805945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|4806188_4806512_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004190914.1|4806504_4806897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190918.1|4806893_4807607_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150800.1|4807879_4809130_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|4809370_4810021_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|4810037_4810496_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004190921.1|4810552_4811659_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	4956908	4968914	5342084	transposase	Stx2-converting_phage(33.33%)	11	NA	NA
WP_009308366.1|4956908_4957439_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
WP_048328122.1|4957435_4957975_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.1	6.5e-81
WP_004199490.1|4957976_4958192_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_003031976.1|4958639_4959044_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|4959040_4959388_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|4959436_4960975_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_143441761.1|4960978_4961137_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	77.3	3.9e-10
WP_135676413.1|4961161_4961566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279614.1|4961594_4964519_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.2	2.6e-195
WP_032415171.1|4964518_4965901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049245313.1|4966208_4968914_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	24.8	9.1e-30
>prophage 8
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	4973473	4999720	5342084	integrase,protease	Pectobacterium_phage(38.1%)	36	4982129:4982143	5000205:5000219
WP_023279620.1|4973473_4973947_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.9	8.1e-27
WP_004191051.1|4973985_4974981_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_023279621.1|4974991_4975750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503969.1|4975736_4976060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279622.1|4976062_4977727_-	hypothetical protein	NA	A0A221SAN2	Ralstonia_phage	39.1	5.9e-104
WP_009308353.1|4977726_4979121_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_004191060.1|4979205_4979658_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	3.2e-49
WP_023279623.1|4979664_4979925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279624.1|4979908_4980142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279625.1|4980138_4980495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071838253.1|4980482_4980806_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	2.3e-25
WP_023279627.1|4980795_4981389_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	1.8e-79
WP_023279629.1|4981828_4982170_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.1e-44
4982129:4982143	attL	CGCGCGCTGCGCGGC	NA	NA	NA	NA
WP_004151290.1|4982162_4982411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279631.1|4983357_4983570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279632.1|4983566_4983779_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	3.6e-11
WP_023279635.1|4984230_4984635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279638.1|4985403_4986189_-	chromosome partitioning protein ParB	NA	C7BGF1	Burkholderia_phage	51.4	2.6e-62
WP_004141586.1|4986228_4986462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|4986465_4987116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143441757.1|4987154_4988543_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.5	8.9e-106
WP_048328137.1|4988539_4989508_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.1e-38
WP_016197573.1|4989525_4989684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|4989767_4990214_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_032427033.1|4990274_4990469_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032427032.1|4990549_4990936_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	4.5e-15
WP_077258387.1|4991908_4992142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048328127.1|4992185_4992470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048328128.1|4992502_4994644_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.1	1.7e-100
WP_048328131.1|4994643_4995210_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	4.6e-53
WP_004141609.1|4995211_4995397_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_071595839.1|4995446_4995641_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	66.1	4.4e-11
WP_004199480.1|4995606_4995831_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_025712918.1|4995834_4996863_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
WP_004176629.1|4997138_4998791_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191089.1|4999060_4999720_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	47.1	1.1e-37
5000205:5000219	attR	CGCGCGCTGCGCGGC	NA	NA	NA	NA
>prophage 9
NZ_CP041644	Klebsiella pneumoniae strain NKU_Kleb8A7 chromosome, complete genome	5342084	5096227	5105690	5342084	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004191145.1|5096227_5097949_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
WP_002898014.1|5097993_5098695_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|5099048_5099267_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|5099386_5101666_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|5101696_5102014_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|5102339_5102561_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004191149.1|5102637_5104578_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_004191152.1|5104574_5105690_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP041645	Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence	114444	2948	65825	114444	transposase,protease	uncultured_Caudovirales_phage(33.33%)	45	NA	NA
WP_000227969.1|2948_4025_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011977766.1|6057_6393_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|6565_6847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|6900_7512_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001445937.1|7696_8653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|9033_9738_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004186996.1|13350_14166_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186997.1|14190_15699_+	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	7.6e-34
WP_004186998.1|15708_16431_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186999.1|16430_17267_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_100206809.1|17307_18762_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004181705.1|19541_20192_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004181707.1|20531_21776_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004181708.1|21784_22558_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_004187003.1|22554_23361_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_004181711.1|23373_24957_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_004187005.1|24956_26702_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004187010.1|28160_28625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187015.1|31027_31528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187017.1|31570_32926_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004187019.1|32941_33226_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
WP_004187025.1|33215_33464_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004187027.1|34426_34690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|34704_34968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013307885.1|35211_35493_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
WP_004152117.1|35527_36097_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|36202_38998_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004187033.1|39432_40182_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|40168_41131_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032238678.1|42545_42791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187040.1|42759_45345_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.5e-23
WP_001067855.1|45503_46208_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003026799.1|46358_46625_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004187044.1|46612_47095_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077251107.1|47305_48652_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_031591821.1|48811_49516_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_032423376.1|51163_51343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023343081.1|52118_53396_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_023307506.1|53458_55456_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	4.1e-19
WP_001114073.1|57062_57416_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_004118102.1|57463_57826_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_060579424.1|57843_59595_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004118136.1|59642_60932_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.1e-170
WP_004118138.1|60944_61370_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_014839879.1|64232_65825_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
>prophage 2
NZ_CP041645	Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence	114444	105759	112939	114444	transposase	Escherichia_phage(57.14%)	10	NA	NA
WP_001067855.1|105759_106464_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002437846.1|107014_107290_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002210543.1|107494_107824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738601.1|108101_108479_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011152976.1|108679_109339_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|109397_110102_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_143441762.1|110113_110548_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	100.0	4.9e-71
WP_001235713.1|110552_111110_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|111292_112153_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|112234_112939_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
