The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041638	Thalassotalea sp. PS06 chromosome, complete genome	3795229	1111219	1120916	3795229		Staphylococcus_phage(25.0%)	11	NA	NA
WP_143580203.1|1111219_1112434_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.6	3.7e-31
WP_143580204.1|1112459_1112840_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.7e-54
WP_143580205.1|1112856_1113180_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	3.4e-24
WP_143580206.1|1113206_1113734_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_143580207.1|1113750_1115613_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.5	1.7e-107
WP_143580208.1|1115615_1115954_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_143580209.1|1116095_1117352_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	52.6	1.4e-97
WP_143580210.1|1117469_1117931_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_144035457.1|1118000_1119101_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	1.8e-48
WP_143580211.1|1119113_1119773_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	4.6e-36
WP_143580212.1|1119806_1120916_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.7	1.4e-61
>prophage 2
NZ_CP041638	Thalassotalea sp. PS06 chromosome, complete genome	3795229	2104949	2167766	3795229	integrase,tRNA,protease,transposase	Vibrio_phage(20.0%)	49	2140854:2140876	2161736:2161758
WP_143580985.1|2104949_2105900_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_143580986.1|2105903_2106320_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_143580987.1|2106431_2109086_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	6.2e-23
WP_143580988.1|2109112_2110609_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_143580989.1|2110639_2111095_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_143580990.1|2111696_2112545_-	sugar-binding protein	NA	NA	NA	NA	NA
WP_143580991.1|2112547_2115640_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_143580992.1|2115626_2117000_-	MFS transporter	NA	NA	NA	NA	NA
WP_143580993.1|2117145_2117916_-	slipin family protein	NA	NA	NA	NA	NA
WP_144035522.1|2117920_2119267_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_143580994.1|2119821_2120451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143580995.1|2120545_2120758_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_143580996.1|2120778_2122191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143580997.1|2122200_2122992_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_144035523.1|2123049_2125482_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_143580998.1|2125762_2126065_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_143580999.1|2126261_2126843_+	HutD family protein	NA	NA	NA	NA	NA
WP_143581000.1|2127080_2127869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143581001.1|2128004_2128277_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_143581002.1|2128403_2129957_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_144035524.1|2130253_2131396_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_143581003.1|2131457_2132411_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_143581004.1|2132475_2133318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143581005.1|2133424_2134330_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SYT2	Cyanophage	33.3	3.6e-39
WP_143581006.1|2134330_2135365_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_143581007.1|2135364_2135805_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_143581008.1|2135815_2136673_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_143581009.1|2137056_2138436_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.1	5.6e-60
WP_143581010.1|2138513_2138801_+	ferritin	NA	NA	NA	NA	NA
WP_143581011.1|2138956_2140276_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
2140854:2140876	attL	ATAATGAACAATCGCTACCGCAT	NA	NA	NA	NA
WP_143581012.1|2141348_2142290_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M5M609	Bacillus_phage	36.8	1.2e-05
WP_143581013.1|2142279_2142813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581014.1|2143883_2144228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143581015.1|2144358_2145399_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	6.3e-173
WP_143581016.1|2146884_2147280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581017.1|2147303_2148188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581018.1|2148476_2148776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581019.1|2148772_2156203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581020.1|2156864_2157410_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	9.7e-40
WP_143581021.1|2157546_2158656_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143581022.1|2158659_2159145_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143581023.1|2159131_2159341_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	47.4	1.4e-07
WP_143581024.1|2159470_2160409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581025.1|2160456_2161716_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.1	2.3e-108
WP_143581026.1|2161979_2162327_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
2161736:2161758	attR	ATAATGAACAATCGCTACCGCAT	NA	NA	NA	NA
WP_143581027.1|2162338_2163088_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_143581028.1|2163225_2164560_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_143581029.1|2164560_2165403_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	27.5	1.0e-16
WP_143581030.1|2165849_2167766_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	43.8	1.5e-116
>prophage 3
NZ_CP041638	Thalassotalea sp. PS06 chromosome, complete genome	3795229	2596150	2603328	3795229		Bacillus_thuringiensis_phage(16.67%)	8	NA	NA
WP_143581371.1|2596150_2596909_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	44.4	9.3e-49
WP_143581372.1|2597283_2598252_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_143581374.1|2598552_2599407_-	sigma-70 family RNA polymerase sigma factor	NA	A0A248SJA5	Salicola_phage	35.1	5.2e-40
WP_143581375.1|2599396_2599699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143581376.1|2599695_2600121_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.7	2.4e-09
WP_143581377.1|2600425_2600908_-	Hsp20 family protein	NA	A0A1D8KTE9	Synechococcus_phage	42.6	3.5e-17
WP_144035543.1|2601132_2602521_-	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.2	6.7e-53
WP_143581378.1|2603118_2603328_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	71.6	1.6e-19
