The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	0	15654	4948013	integrase	Bacillus_phage(50.0%)	10	7473:7484	17887:17898
WP_001773979.1|1651_3817_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_000140400.1|4007_4967_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001313954.1|5223_6936_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.8	1.8e-31
WP_001304269.1|6922_8725_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
7473:7484	attL	TTTATTACTGGC	NA	NA	NA	NA
WP_001286281.1|8717_9998_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703047.1|10025_11330_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024193506.1|11523_12786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	1.2e-72
WP_001325918.1|13123_13921_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001773978.1|14382_15219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001773977.1|15435_15654_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
17887:17898	attR	GCCAGTAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	21836	22706	4948013		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001608367.1|21836_22706_-	restriction endonuclease	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	28.7	7.0e-16
>prophage 3
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	43025	44246	4948013	integrase	Ralstonia_phage(100.0%)	1	42457:42470	45481:45494
42457:42470	attL	CAGATAAAACCAAA	NA	NA	NA	NA
WP_001773946.1|43025_44246_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
WP_001773946.1|43025_44246_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	7.4e-80
45481:45494	attR	TTTGGTTTTATCTG	NA	NA	NA	NA
>prophage 4
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	48296	60665	4948013		Bacillus_phage(33.33%)	12	NA	NA
WP_001347103.1|48296_48968_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826707.1|48967_50326_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|50433_51285_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824392.1|51880_52939_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.5e-92
WP_001330593.1|53503_53869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298512.1|53908_54604_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157268.1|54670_56089_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|56069_56540_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|56528_57449_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_001773945.1|57621_58539_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|58617_58800_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001773944.1|58970_60665_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
>prophage 5
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	76992	79257	4948013		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000737290.1|76992_78075_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
WP_001538888.1|78588_79257_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.4e-80
>prophage 6
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	91058	91811	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|91058_91811_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 7
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	103804	105319	4948013		Cedratvirus(100.0%)	1	NA	NA
WP_001538880.1|103804_105319_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	7.4e-13
>prophage 8
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	115406	119675	4948013		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001313042.1|115406_117068_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_001533408.1|117358_118219_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036385.1|118221_119271_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763860.1|119285_119675_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
>prophage 9
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	124202	125936	4948013	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001773938.1|124202_125936_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	9.8e-86
>prophage 10
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	132551	134602	4948013		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|132551_133295_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|133335_133731_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639272.1|133783_134602_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 11
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	138495	145556	4948013		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|138495_139017_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024913.1|139018_139621_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|139690_139756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|139894_140506_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|140514_141525_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|141669_142455_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|142451_143207_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|143285_144218_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|144233_145556_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 12
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	149554	151030	4948013		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|149554_151030_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 13
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	159086	163555	4948013		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944258.1|159086_159749_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|159772_160429_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|160530_160761_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|160899_161274_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879311.1|161277_162150_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000984819.1|162162_162504_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812744.1|162898_163555_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
>prophage 14
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	171052	173101	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|171052_173101_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 15
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	178433	178643	4948013		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|178433_178643_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 16
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	184283	185840	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|184283_185840_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 17
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	189702	197808	4948013	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855012.1|189702_191064_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.5e-41
WP_000457334.1|191137_191317_+	YoaH family protein	NA	NA	NA	NA	NA
WP_071525875.1|191436_191796_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|192157_192502_-	RidA family protein	NA	NA	NA	NA	NA
WP_001773936.1|192633_194544_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	5.0e-91
WP_001220981.1|194601_195297_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290578.1|195336_195918_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077572252.1|196122_197808_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 18
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	206775	212063	4948013	transposase	Bacillus_phage(66.67%)	4	NA	NA
WP_001298230.1|206775_208266_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621384.1|208446_209922_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000526115.1|210140_210599_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_001538829.1|210779_212063_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 19
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	215381	216236	4948013		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|215381_216236_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 20
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	225049	229135	4948013		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723717.1|225049_226030_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
WP_000719088.1|226166_226925_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001357805.1|227042_228401_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135068.1|228493_229135_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 21
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	234061	238075	4948013		Streptococcus_phage(50.0%)	2	NA	NA
WP_001538825.1|234061_236008_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
WP_001538824.1|236374_238075_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	38.8	6.2e-93
>prophage 22
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	244384	245038	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_001538821.1|244384_245038_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-10
>prophage 23
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	251801	253022	4948013		Klosneuvirus(100.0%)	1	NA	NA
WP_001538818.1|251801_253022_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 24
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	260498	261326	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|260498_261326_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 25
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	276280	295818	4948013	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_001144202.1|276280_278209_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|278212_278755_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|278851_279049_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|279101_279458_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|279580_279625_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_001538809.1|279908_280892_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672319.1|280906_283294_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|283298_283598_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956502.1|283698_284679_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154199.1|284740_285292_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029464.1|285291_286041_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|286118_286583_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001538808.1|287604_289041_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001313872.1|289044_289236_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|289367_290414_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|290570_291404_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069357.1|291736_294115_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.4e-172
WP_171768477.1|294171_295818_-	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	8.9e-20
>prophage 26
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	314291	319375	4948013		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367169.1|314291_314660_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_001304330.1|314668_316156_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|316165_316912_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000907966.1|316886_318158_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001538803.1|318154_319375_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	7.6e-93
>prophage 27
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	327665	329932	4948013		Escherichia_phage(50.0%)	3	NA	NA
WP_001362847.1|327665_328334_+	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
WP_001538799.1|328330_329116_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587583.1|329119_329932_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 28
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	335438	344230	4948013		Orpheovirus(20.0%)	9	NA	NA
WP_000493948.1|335438_336080_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|336119_337268_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|337558_338770_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_001538795.1|338882_339815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|339811_340837_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|341135_341225_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701050.1|341390_342560_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|342705_343287_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101199.1|343414_344230_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 29
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	349626	350148	4948013		Salmonella_phage(100.0%)	1	NA	NA
WP_001298528.1|349626_350148_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 30
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	357067	414216	4948013	tRNA,protease,head,portal,capsid,tail,integrase,terminase	uncultured_Caudovirales_phage(66.67%)	58	375744:375760	402424:402440
WP_001295400.1|357067_358342_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001296097.1|358403_359264_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765756.1|359307_359913_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100937.1|360018_361521_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|362131_362767_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289646.1|362766_363462_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920791.1|363465_364086_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001773932.1|364089_365148_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_001538789.1|365148_367278_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|367270_367849_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|367848_368430_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|368506_368947_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217951.1|369032_369248_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|369520_369646_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282531.1|369888_370929_+	oxidoreductase	NA	NA	NA	NA	NA
WP_001773931.1|370964_371966_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459359.1|372069_373242_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125604.1|373251_374844_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
375744:375760	attL	ACCATCAGCGCCGTGGT	NA	NA	NA	NA
WP_000483362.1|376157_376925_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|377153_377744_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001538788.1|378133_379945_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
WP_001075831.1|379941_381315_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001538786.1|381353_382619_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043353.1|382663_384172_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170679.1|384272_385448_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|385646_387293_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001538785.1|387435_388839_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001538784.1|388835_389765_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001538783.1|389840_391142_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.9	5.0e-18
WP_001298660.1|391145_391865_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|391993_392329_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520815.1|392325_393048_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_154832306.1|393084_394467_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769318.1|394652_395597_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298661.1|396120_397653_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|397663_399052_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_032153848.1|400158_401388_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
WP_000953272.1|401753_401942_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_032145563.1|401999_403022_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
402424:402440	attR	ACCACGGCGCTGATGGT	NA	NA	NA	NA
WP_000076671.1|403018_403249_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336139.1|403238_403463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|403455_403821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|403813_404047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|404039_404273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|404278_404578_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|404574_406329_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|406617_406896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|406892_407303_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|407315_407588_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|407875_409033_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|409072_409645_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|409646_410858_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|410854_411193_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|411189_411486_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|411485_411926_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|411909_412092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|412214_412571_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|412554_414216_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
>prophage 31
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	424167	439605	4948013		Escherichia_phage(44.44%)	15	NA	NA
WP_000148695.1|424167_424782_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_000526500.1|424824_425679_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001538777.1|425680_426298_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074159585.1|426308_428732_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	6.3e-208
WP_001538775.1|428792_431219_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.3e-213
WP_000778146.1|431417_431723_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001350228.1|431830_432541_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|432543_433104_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|433138_433480_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|433614_433941_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001298659.1|434146_435361_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_000836075.1|435372_436392_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_000151242.1|436449_437817_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001538772.1|437905_439366_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.1e-42
WP_000214712.1|439401_439605_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 32
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	443991	445626	4948013	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000592831.1|443991_444882_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
WP_000526115.1|445167_445626_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 33
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	452985	455115	4948013		Pandoravirus(50.0%)	3	NA	NA
WP_001538766.1|452985_454425_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
WP_000803536.1|454481_454700_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091198.1|454731_455115_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 34
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	461858	463277	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_001773920.1|461858_463277_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 35
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	487795	490195	4948013		Klosneuvirus(100.0%)	1	NA	NA
WP_001538754.1|487795_490195_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	20.9	4.6e-09
>prophage 36
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	493602	495361	4948013		Escherichia_phage(66.67%)	3	NA	NA
WP_000642412.1|493602_494613_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
WP_000605675.1|494798_495077_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000781370.1|495076_495361_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 37
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	506785	508330	4948013		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|506785_508330_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 38
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	514816	517222	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_001556956.1|514816_517222_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.1e-23
>prophage 39
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	522389	524354	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_021522089.1|522389_524354_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
>prophage 40
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	528979	531082	4948013		Salmonella_phage(100.0%)	1	NA	NA
WP_001538743.1|528979_531082_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	1.8e-134
>prophage 41
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	536578	537592	4948013		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220417.1|536578_537592_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 42
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	541221	543183	4948013		Phage_TP(100.0%)	1	NA	NA
WP_001350247.1|541221_543183_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 43
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	556356	557305	4948013		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|556356_556530_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001350640.1|556774_557305_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 44
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	561245	565148	4948013		Klosneuvirus(100.0%)	1	NA	NA
WP_000139619.1|561245_565148_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 45
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	582775	583765	4948013		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|582775_583765_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 46
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	588724	598145	4948013	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_001773902.1|588724_589858_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	53.8	4.4e-103
WP_001295593.1|589998_590433_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|592759_593695_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123774.1|593823_595197_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	3.3e-52
WP_000387388.1|595674_596658_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|596912_598145_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 47
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	602683	603199	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945019.1|602683_603199_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 48
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	620424	621507	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|620424_621507_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 49
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	640849	642867	4948013		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|640849_641656_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135019.1|641703_642867_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.8e-28
>prophage 50
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	651806	653741	4948013		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|651806_653741_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 51
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	661554	662145	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|661554_662145_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 52
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	667055	737396	4948013	protease,lysis,holin,head,tail,capsid,integrase,terminase	Escherichia_phage(39.06%)	87	684429:684454	737535:737560
WP_001304419.1|667055_669653_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|670032_670284_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422063.1|670319_671369_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559258.1|671588_672347_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_001278898.1|672343_672934_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|672973_673849_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_024186832.1|674061_675951_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|675978_676599_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001538692.1|676595_677477_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|677614_677659_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001538691.1|677750_679313_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763537.1|679312_680908_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538690.1|680911_682270_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209513.1|682281_683475_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001357405.1|683474_684281_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
684429:684454	attL	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
WP_001304589.1|684908_685361_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001304590.1|685546_685879_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000355614.1|685996_686293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|686302_686581_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_016238843.1|686577_688641_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_016238842.1|688792_689392_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_001773905.1|689459_693152_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_000246319.1|693495_694176_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
WP_001351101.1|694073_694817_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_021524657.1|694827_695526_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000807940.1|695525_695867_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212987.1|695859_699102_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_001538679.1|699149_699359_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000710952.1|699454_699829_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275433.1|699846_700560_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000133388.1|700625_700970_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|700966_701413_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007909.1|701409_701760_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000125984.1|701771_702098_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063027.1|704624_704846_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000173054.1|704890_706828_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001304597.1|706892_708554_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000958372.1|708550_709114_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829186.1|709404_709770_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_001304598.1|709811_710012_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000736383.1|710210_710435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082534.1|710431_710926_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000459345.1|710927_711065_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_000992075.1|711224_711758_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000731249.1|711821_712172_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000284510.1|712176_712392_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_171742343.1|712468_712828_-	DUF826 domain-containing protein	NA	A0A0N7C077	Escherichia_phage	82.4	8.9e-26
WP_001304601.1|712751_712934_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_000874510.1|713069_715031_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_000216690.1|715996_716161_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_001304604.1|716157_716589_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000935524.1|717052_718111_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_000762880.1|718685_719507_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|719503_719878_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265091.1|719890_720937_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001403449.1|720938_721211_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_000687431.1|721270_721444_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_000401168.1|721601_722705_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|722685_723336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|723501_723714_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000206826.1|723948_724293_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|724289_724457_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|724467_724731_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|724732_724951_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510387.1|724952_725168_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001289989.1|725168_725528_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|725524_725701_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|725693_725876_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403780.1|726028_726328_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001209475.1|726305_726767_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|726763_727060_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|727056_727449_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450708.1|727464_728235_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001309414.1|728268_728811_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001262415.1|728722_729763_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_000702041.1|729834_730260_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053425.1|730243_730519_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000753626.1|730626_731088_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000379612.1|731341_731497_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001304608.1|731656_731896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238838.1|731898_732219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|732196_732634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449191.1|733034_733223_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|733219_733411_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048416.1|733503_735975_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|736039_736288_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|736265_737396_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
737535:737560	attR	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
>prophage 53
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	745328	747343	4948013		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|745328_746333_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110950.1|746329_747343_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 54
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	756909	768239	4948013	transposase	Citrobacter_phage(20.0%)	11	NA	NA
WP_000068076.1|756909_757527_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|758130_758544_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718993.1|758687_759596_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.1e-59
WP_001538656.1|759797_760811_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_024186830.1|760902_761808_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001538653.1|761920_762379_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|762428_763271_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001111618.1|764064_765264_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
WP_001160110.1|765316_765994_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|765993_766704_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001773898.1|766700_768239_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 55
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	779358	785627	4948013		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|779358_779589_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|779858_780959_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170954.1|781364_781472_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|781619_782474_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257054.1|782509_783319_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|783322_783715_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456474.1|783711_784545_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|784544_785627_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 56
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	788763	789711	4948013		Tupanvirus(100.0%)	1	NA	NA
WP_001298109.1|788763_789711_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 57
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	803960	804719	4948013		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001538640.1|803960_804719_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.6e-14
>prophage 58
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	820747	822435	4948013		Salmonella_phage(50.0%)	2	NA	NA
WP_000457596.1|820747_822016_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
WP_001773894.1|822015_822435_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	3.1e-38
>prophage 59
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	835468	927506	4948013	tRNA,lysis,holin,head,tail,capsid,portal,transposase,integrase,terminase	Enterobacteria_phage(45.83%)	98	854997:855012	930458:930473
WP_000332315.1|835468_836200_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
WP_000373104.1|836420_836825_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|836877_837003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|837086_837239_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_081570181.1|838222_839080_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983702.1|839079_839907_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_001101732.1|839903_840761_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|840757_841615_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000654168.1|842012_842291_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001538630.1|842287_844348_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_050575893.1|844406_847817_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000839596.1|847996_848212_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|848801_849884_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|850072_850456_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|850541_850682_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001538628.1|850678_851041_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000774478.1|851037_851328_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_001538627.1|851320_851491_-	protein ninE	NA	K7P7K0	Enterobacteria_phage	67.9	4.1e-13
WP_001053004.1|851490_851946_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|851942_852044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|852393_853437_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001773871.1|853473_857025_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
854997:855012	attL	CAGCCAATGCATTATT	NA	NA	NA	NA
WP_001538625.1|857274_857976_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_139371347.1|859479_860693_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001254932.1|862478_863630_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001556896.1|865542_866400_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001556895.1|866399_867917_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_001773892.1|868353_869604_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248679.1|869775_870429_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|870438_870900_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|870953_872060_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|872095_872737_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001538616.1|872740_874111_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|874280_874952_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|874951_876412_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|876487_877609_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|877657_878884_-	peptidase T	NA	NA	NA	NA	NA
WP_000531578.1|879133_880270_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001538615.1|880253_881117_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000937496.1|881348_881615_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_096950035.1|881712_882339_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|882393_882492_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|882531_882825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|882834_883113_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_032154014.1|883109_885176_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	2.8e-148
WP_001563808.1|885240_885840_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.0e-107
WP_001773905.1|885907_889600_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_000246319.1|889943_890624_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
WP_001351101.1|890521_891265_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_001327694.1|891275_891974_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|891973_892303_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001538602.1|892299_894861_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.7	0.0e+00
WP_001538601.1|894841_895255_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|895281_895713_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001538600.1|895731_896478_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.5e-123
WP_000683079.1|896485_896881_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001538599.1|896877_897411_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.1e-56
WP_001204533.1|897426_897780_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201498.1|897772_898156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|898207_899236_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256835.1|899293_899641_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001773874.1|899677_901183_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	6.1e-100
WP_001538596.1|901172_902765_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_000258993.1|902761_902968_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001538595.1|902951_904880_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.1e-262
WP_001538594.1|904851_905400_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	1.4e-57
WP_001322427.1|905868_906222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|906344_906671_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000947131.1|906981_907440_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.1	8.1e-64
WP_001446668.1|907597_907780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|907936_908470_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|908506_909397_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|909401_909617_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_162482903.1|909693_910053_-	DUF826 domain-containing protein	NA	E7DYV2	Enterobacteria_phage	84.0	1.9e-31
WP_023143432.1|909976_910159_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001550966.1|910295_912257_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	5.6e-239
WP_001336019.1|912517_912853_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|913133_913265_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|914160_914982_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|914996_915359_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_024235559.1|915359_916346_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	48.5	9.8e-83
WP_023141427.1|916419_916692_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|916859_917015_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|917936_918113_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001550964.1|918105_918288_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_000403785.1|918381_918738_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|918795_919218_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|919258_920329_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|920400_920826_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|920809_921052_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000043816.1|921143_921782_+	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	26.7	8.7e-16
WP_000379575.1|922074_922230_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|922389_922608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|923176_923365_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070259.1|923361_923553_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|923646_926088_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|926149_926419_+	excisionase	NA	NA	NA	NA	NA
WP_000074984.1|926387_927506_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
930458:930473	attR	AATAATGCATTGGCTG	NA	NA	NA	NA
>prophage 60
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	930951	934673	4948013		Vibrio_phage(50.0%)	4	NA	NA
WP_001538573.1|930951_931773_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	3.3e-23
WP_154832312.1|931796_932699_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251368.1|932727_933972_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001538569.1|933971_934673_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	2.4e-35
>prophage 61
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	941959	942217	4948013		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|941959_942217_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 62
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	954541	956184	4948013		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267913.1|954541_955546_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	40.0	6.4e-05
WP_001257002.1|955542_956184_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 63
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	959456	960638	4948013		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|959456_959693_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|959903_960638_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 64
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	972994	973936	4948013		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001305885.1|972994_973936_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 65
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	989815	990061	4948013		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|989815_990061_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 66
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	994722	995643	4948013		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|994722_995643_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 67
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1009619	1010453	4948013		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1009619_1010453_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 68
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1022029	1022818	4948013		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|1022029_1022818_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 69
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1037415	1039515	4948013		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028102.1|1037415_1037910_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	5.5e-50
WP_001298362.1|1037930_1039259_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001273658.1|1039341_1039515_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 70
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1042545	1043466	4948013		Klosneuvirus(100.0%)	1	NA	NA
WP_000420625.1|1042545_1043466_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 71
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1048570	1055063	4948013		Bacillus_phage(33.33%)	8	NA	NA
WP_001120112.1|1048570_1049263_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264953.1|1049235_1050264_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_100228301.1|1050346_1053079_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	5.4e-38
WP_000818456.1|1053161_1054235_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1054283_1054457_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012896763.1|1054446_1054677_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1054651_1054840_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1054850_1055063_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 72
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1066057	1066717	4948013	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538531.1|1066057_1066717_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 73
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1070950	1073005	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_001538528.1|1070950_1073005_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 74
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1085605	1087513	4948013		Tupanvirus(100.0%)	1	NA	NA
WP_001773885.1|1085605_1087513_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.6e-52
>prophage 75
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1096268	1107217	4948013	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090487.1|1096268_1097036_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_001538523.1|1097230_1099843_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.2e-18
WP_001538521.1|1100108_1101311_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1101479_1102880_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977927.1|1103481_1104570_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000462681.1|1104754_1105945_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|1105994_1106642_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1106668_1107217_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 76
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1121922	1126462	4948013		Bacillus_phage(100.0%)	3	NA	NA
WP_000551259.1|1121922_1123671_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_001538517.1|1123707_1125972_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1126177_1126462_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 77
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1131549	1132638	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057159.1|1131549_1132638_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 78
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1136736	1139951	4948013		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1136736_1139019_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1139210_1139951_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 79
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1143036	1166778	4948013	tRNA,protease	uncultured_Mediterranean_phage(18.18%)	15	NA	NA
WP_000213098.1|1143036_1143654_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000886683.1|1146346_1147639_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1147729_1149073_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1149083_1149695_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001675097.1|1149853_1153843_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1153977_1154472_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|1155015_1155981_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043558.1|1156103_1157870_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	4.1e-23
WP_001202199.1|1157870_1159592_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241673.1|1159633_1160338_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1160622_1160841_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001538509.1|1161584_1163861_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	3.3e-166
WP_001538508.1|1163891_1164212_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.6e-13
WP_000410785.1|1164534_1164759_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001538507.1|1164831_1166778_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 80
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1175900	1177619	4948013		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815372.1|1175900_1177619_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 81
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1181206	1183944	4948013		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255186.1|1181206_1182037_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1182033_1182357_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001538503.1|1182482_1182998_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1183215_1183944_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 82
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1187069	1196218	4948013		Streptococcus_phage(25.0%)	11	NA	NA
WP_001538502.1|1187069_1188197_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	6.7e-27
WP_000389260.1|1188237_1188726_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|1188785_1189631_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105434.1|1189627_1190581_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1190590_1191724_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001538501.1|1191818_1192931_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1193280_1193757_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001538500.1|1193844_1194747_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|1194807_1195530_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201570.1|1195513_1195801_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|1195960_1196218_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 83
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1204782	1205985	4948013		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1204782_1205985_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 84
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1217318	1219190	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_001538498.1|1217318_1219190_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 85
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1222405	1229289	4948013		Synechococcus_phage(33.33%)	5	NA	NA
WP_001298570.1|1222405_1223068_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	3.7e-25
WP_001298571.1|1223198_1224098_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209310.1|1224103_1226536_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114251.1|1226681_1227497_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000961458.1|1227696_1229289_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 86
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1234285	1239511	4948013		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1234285_1234801_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1234853_1234919_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1235153_1236041_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1236340_1236844_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1237247_1237994_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1238132_1238792_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1238788_1239511_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 87
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1246074	1257737	4948013		Synechococcus_phage(20.0%)	10	NA	NA
WP_000990159.1|1246074_1246752_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.5e-18
WP_000146352.1|1246825_1247092_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_001538491.1|1247356_1247617_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443514.1|1247845_1248931_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386549.1|1249071_1250034_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|1250061_1252212_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000007119.1|1252748_1254110_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001295890.1|1254338_1255010_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001334148.1|1255012_1256008_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001538488.1|1256000_1257737_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-18
>prophage 88
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1268333	1269242	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|1268333_1269242_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 89
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1275568	1278099	4948013	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_001350189.1|1275568_1276858_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000817269.1|1276968_1278099_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
>prophage 90
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1288411	1294986	4948013		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891664.1|1288411_1289470_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
WP_000604037.1|1289472_1290162_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|1290161_1290935_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1291101_1291251_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147437.1|1291379_1292168_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001538478.1|1292235_1293708_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.1e-13
WP_001265443.1|1293969_1294986_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 91
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1299349	1302869	4948013		Klebsiella_phage(33.33%)	4	NA	NA
WP_001538477.1|1299349_1300402_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	48.8	2.2e-80
WP_001538476.1|1300717_1301098_+	homeobox protein	NA	NA	NA	NA	NA
WP_001538475.1|1301211_1302153_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000345406.1|1302149_1302869_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 92
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1330352	1331144	4948013		Kaumoebavirus(100.0%)	1	NA	NA
WP_001538470.1|1330352_1331144_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.0e-09
>prophage 93
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1334522	1342423	4948013		Acinetobacter_phage(33.33%)	7	NA	NA
WP_001032722.1|1334522_1336004_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
WP_000207172.1|1336045_1337464_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	8.1e-62
WP_001075778.1|1337460_1337970_-	YbgA family protein	NA	NA	NA	NA	NA
WP_001538467.1|1338070_1338277_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1338589_1338679_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_001538466.1|1338678_1340352_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087998.1|1340374_1342423_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	3.5e-26
>prophage 94
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1345676	1346354	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_000186082.1|1345676_1346354_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 95
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1353009	1353774	4948013		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|1353009_1353774_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 96
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1357916	1360562	4948013	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_001287134.1|1357916_1359581_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_000679501.1|1359800_1360562_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 97
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1365055	1365814	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_000480546.1|1365055_1365814_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.8	1.1e-44
>prophage 98
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1368868	1370815	4948013		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|1368868_1370815_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 99
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1375440	1377105	4948013		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1375440_1377105_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 100
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1381243	1382284	4948013		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1381243_1382284_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 101
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1390228	1395351	4948013	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_000631389.1|1390228_1390954_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207539.1|1391071_1392007_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|1392051_1392534_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001538450.1|1392768_1395351_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 102
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1402361	1404801	4948013		Synechococcus_phage(50.0%)	2	NA	NA
WP_001538448.1|1402361_1403450_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1403589_1404801_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 103
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1409016	1409663	4948013		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939740.1|1409016_1409400_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1409453_1409663_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 104
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1423751	1425866	4948013		Morganella_phage(50.0%)	2	NA	NA
WP_001295855.1|1423751_1424180_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
WP_032141769.1|1424300_1425866_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 105
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1428971	1430794	4948013		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029771.1|1428971_1430192_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
WP_000502940.1|1430164_1430794_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 106
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1445085	1451128	4948013		Klosneuvirus(50.0%)	3	NA	NA
WP_000140646.1|1445085_1445901_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_001538440.1|1445897_1447031_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001556853.1|1447246_1451128_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.8e-61
>prophage 107
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1462516	1464061	4948013		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_001773876.1|1462516_1464061_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	5.2e-14
>prophage 108
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1473552	1476696	4948013		Leptospira_phage(100.0%)	1	NA	NA
WP_001538423.1|1473552_1476696_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 109
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1479841	1480525	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|1479841_1480525_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 110
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1490749	1495225	4948013	tRNA,tail	Enterobacteria_phage(33.33%)	5	NA	NA
WP_001111235.1|1490749_1491106_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.9	4.2e-52
WP_000729154.1|1492094_1492961_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001773868.1|1492962_1493175_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143516.1|1493282_1493804_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1493839_1495225_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 111
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1507259	1508405	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_001556850.1|1507259_1508405_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	4.8e-49
>prophage 112
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1514595	1516377	4948013		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001524200.1|1514595_1516377_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 113
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1522812	1523499	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110575.1|1522812_1523499_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 114
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1526635	1527313	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_001538400.1|1526635_1527313_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	8.9e-27
>prophage 115
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1534810	1538052	4948013		Escherichia_phage(66.67%)	3	NA	NA
WP_000083948.1|1534810_1537315_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
WP_000806442.1|1537372_1537714_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057523.1|1537749_1538052_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 116
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1546288	1554733	4948013		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801820.1|1546288_1547257_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
WP_001250114.1|1547231_1548194_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001313630.1|1548325_1548970_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678189.1|1549150_1551025_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001195025.1|1551134_1551740_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1551739_1552069_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122015.1|1552121_1554053_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1554181_1554733_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 117
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1561741	1564891	4948013		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|1561741_1564891_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 118
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1573728	1577275	4948013		Bacillus_phage(100.0%)	2	NA	NA
WP_001538391.1|1573728_1575510_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
WP_001235630.1|1575502_1577275_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 119
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1580598	1581294	4948013		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|1580598_1581294_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 120
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1584434	1589481	4948013	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1584434_1584707_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1584915_1587270_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1587457_1588732_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1588857_1589481_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 121
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1614941	1623784	4948013	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1614941_1615412_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150440.1|1615500_1616604_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_000543535.1|1616607_1617057_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001538377.1|1617207_1617747_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295827.1|1618045_1618930_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1618967_1619315_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1619444_1620416_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934823.1|1620426_1622274_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1622301_1622634_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1622656_1623784_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 122
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1630734	1640832	4948013		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|1630734_1632030_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1632087_1632777_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221287.1|1632966_1634169_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_001538373.1|1634165_1637309_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001331503.1|1637434_1638619_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|1638887_1639796_-	fructokinase	NA	NA	NA	NA	NA
WP_001366457.1|1639920_1640832_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 123
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1645118	1646234	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|1645118_1646234_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 124
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1653649	1654807	4948013		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001538363.1|1653649_1654807_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
>prophage 125
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1661715	1662483	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|1661715_1662483_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 126
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1667775	1675057	4948013		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_001773863.1|1667775_1668885_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
WP_000419066.1|1668977_1669811_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001538358.1|1670036_1670576_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_024186801.1|1670777_1671860_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	5.4e-191
WP_001538356.1|1671982_1675057_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
>prophage 127
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1680015	1681902	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538352.1|1680015_1681902_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 128
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1689549	1690599	4948013		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001538349.1|1689549_1690599_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.4e-71
>prophage 129
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1701027	1710626	4948013	transposase,holin,integrase	Shigella_phage(25.0%)	6	1689387:1689401	1711339:1711353
1689387:1689401	attL	CAGAAATCGCTCATA	NA	NA	NA	NA
WP_102384962.1|1701027_1702255_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_154832316.1|1703057_1705091_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	1.7e-20
WP_001375032.1|1705219_1705807_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001538343.1|1705820_1707293_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159135.1|1707306_1708995_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_001295805.1|1710062_1710626_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
1711339:1711353	attR	TATGAGCGATTTCTG	NA	NA	NA	NA
>prophage 130
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1720537	1723842	4948013		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046332.1|1720537_1721863_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|1721971_1722208_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|1722219_1722813_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001538339.1|1722972_1723842_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.4e-53
>prophage 131
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1729887	1730739	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001538337.1|1729887_1730739_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	8.8e-48
>prophage 132
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1749027	1758638	4948013		Enterobacteria_phage(40.0%)	6	NA	NA
WP_032153891.1|1749027_1753158_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.7	3.3e-281
WP_001298126.1|1753283_1753808_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|1754242_1754581_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001538333.1|1754925_1756179_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	6.4e-95
WP_001285288.1|1756190_1757294_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749900.1|1757582_1758638_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
>prophage 133
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1763315	1764455	4948013		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000521561.1|1763315_1764455_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.7e-31
>prophage 134
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1788972	1793497	4948013		Catovirus(50.0%)	4	NA	NA
WP_001773846.1|1788972_1791411_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.4	1.6e-33
WP_000220508.1|1791736_1792558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000623467.1|1792550_1793090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001538316.1|1793101_1793497_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	5.6e-29
>prophage 135
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1807672	1810995	4948013		Clostridioides_phage(50.0%)	4	NA	NA
WP_000093934.1|1807672_1808422_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|1808733_1809474_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001538302.1|1809444_1810212_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1810416_1810995_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 136
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1820575	1822558	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_021556267.1|1820575_1822558_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.4	3.8e-25
>prophage 137
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1826437	1828396	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_032153888.1|1826437_1828396_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.4e-24
>prophage 138
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1839086	1841849	4948013		Cronobacter_phage(100.0%)	1	NA	NA
WP_001538292.1|1839086_1841849_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	6.1e-82
>prophage 139
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1851111	1858963	4948013		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001308374.1|1851111_1851843_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|1851907_1852375_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|1852371_1853094_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052743.1|1853127_1853883_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1853954_1855313_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211705.1|1855359_1856130_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1856207_1857008_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648548.1|1857248_1858163_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997016.1|1858159_1858963_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
>prophage 140
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1865484	1866516	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1865484_1866516_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 141
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1879474	1883590	4948013		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294747.1|1879474_1882957_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000569423.1|1882993_1883590_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 142
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1892418	1893177	4948013		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1892418_1893177_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 143
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1905474	1906899	4948013	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753942.1|1905474_1906899_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 144
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1910828	1911173	4948013		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1910828_1911173_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 145
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1917084	1917882	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1917084_1917882_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 146
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1923032	1929838	4948013	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001540734.1|1923032_1925462_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
WP_001294708.1|1925535_1926066_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396047.1|1926080_1926785_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1926962_1927418_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937411.1|1927454_1928381_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|1928419_1929838_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 147
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1939734	1940619	4948013		Sodalis_phage(100.0%)	1	NA	NA
WP_000339934.1|1939734_1940619_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.8	4.7e-60
>prophage 148
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1943881	1950349	4948013		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150638.1|1943881_1944808_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1944916_1945579_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1945619_1946156_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001556761.1|1946361_1948752_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001540713.1|1948798_1950349_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
>prophage 149
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1958169	1959594	4948013		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1958169_1959594_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 150
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1972135	1972687	4948013		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|1972135_1972687_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 151
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	1976933	1977977	4948013		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1976933_1977977_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 152
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2003947	2005672	4948013		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001774153.1|2003947_2005672_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 153
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2017150	2017849	4948013		Planktothrix_phage(100.0%)	1	NA	NA
WP_001540674.1|2017150_2017849_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-22
>prophage 154
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2026124	2031547	4948013		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001556757.1|2026124_2028476_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
WP_001117001.1|2028640_2031547_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 155
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2039292	2041253	4948013		Microcystis_phage(50.0%)	4	NA	NA
WP_000257181.1|2039292_2040141_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160966.1|2040137_2040452_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125568.1|2040454_2040688_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2040773_2041253_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 156
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2049147	2054796	4948013		Vibrio_phage(50.0%)	4	NA	NA
WP_000787104.1|2049147_2050662_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2050692_2051835_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349942.1|2051952_2053170_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001298634.1|2053242_2054796_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.7e-34
>prophage 157
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2060296	2061445	4948013		Halovirus(100.0%)	1	NA	NA
WP_001540660.1|2060296_2061445_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	2.8e-49
>prophage 158
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2065871	2080395	4948013	tRNA	Tupanvirus(16.67%)	12	NA	NA
WP_001286825.1|2065871_2068688_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
WP_000767329.1|2068730_2069672_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001337277.1|2069679_2069898_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|2070000_2070264_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001317610.1|2070359_2071259_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681384.1|2071324_2072491_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
WP_000494929.1|2072725_2073985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774152.1|2074113_2075607_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
WP_001274832.1|2075626_2076388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181672.1|2076945_2077155_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|2077259_2078390_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2078478_2080395_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 159
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2083530	2084484	4948013		Cyanophage(100.0%)	1	NA	NA
WP_001540649.1|2083530_2084484_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 160
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2096251	2098365	4948013		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219585.1|2096251_2097676_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188687.1|2097675_2098365_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 161
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2101642	2107452	4948013		Bacillus_phage(33.33%)	5	NA	NA
WP_000409429.1|2101642_2103580_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|2103786_2105454_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|2105509_2105794_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001298496.1|2105795_2106128_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093832.1|2106219_2107452_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.7e-82
>prophage 162
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2114172	2115495	4948013		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2114172_2115495_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 163
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2121182	2124058	4948013		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2121182_2121344_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2121470_2122076_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2122468_2124058_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 164
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2131886	2133166	4948013		Salmonella_phage(50.0%)	2	NA	NA
WP_001535806.1|2131886_2132426_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000799911.1|2132428_2133166_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 165
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2143791	2145456	4948013		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001774148.1|2143791_2145456_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 166
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2150697	2154666	4948013		Synechococcus_phage(50.0%)	2	NA	NA
WP_001513536.1|2150697_2153130_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001387312.1|2153196_2154666_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
>prophage 167
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2159542	2160463	4948013	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001513532.1|2159542_2160463_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.4e-60
>prophage 168
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2166409	2167066	4948013		Clostridioides_phage(100.0%)	1	NA	NA
WP_164523153.1|2166409_2167066_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.5	3.2e-37
>prophage 169
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2173533	2174994	4948013		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|2173533_2174994_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 170
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2185260	2186937	4948013		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2185260_2185857_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2186334_2186937_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 171
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2190299	2191280	4948013		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|2190299_2191280_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 172
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2214217	2216627	4948013		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|2214217_2214439_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|2214501_2214978_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|2214993_2215467_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234655.1|2215808_2216627_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
>prophage 173
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2236796	2243576	4948013	transposase,holin	uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_000684856.1|2236796_2237753_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|2237753_2238521_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|2239077_2239335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|2240268_2241424_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001293436.1|2241578_2243576_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
>prophage 174
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2253785	2257937	4948013	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_102384962.1|2253785_2255013_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001350789.1|2256917_2257937_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
>prophage 175
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2263066	2272342	4948013	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001540570.1|2263066_2264569_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	5.1e-83
WP_001295681.1|2264729_2265812_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584107.1|2265811_2266912_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2267178_2268690_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2269043_2269487_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416379.1|2269486_2272342_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
>prophage 176
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2280806	2286903	4948013		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2280806_2281742_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2281754_2282216_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2282288_2282675_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471900.1|2282880_2285577_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2285717_2285771_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2285955_2286903_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 177
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2290541	2293302	4948013		Vibrio_phage(100.0%)	2	NA	NA
WP_000187778.1|2290541_2292680_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|2292837_2293302_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
>prophage 178
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2297490	2303978	4948013		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2297490_2298489_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|2298521_2299517_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|2299503_2300526_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|2300539_2302042_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|2302181_2303138_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2303447_2303978_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 179
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2338888	2340052	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_001774130.1|2338888_2340052_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	3.2e-80
>prophage 180
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2349106	2362131	4948013	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076332.1|2349106_2351548_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|2351586_2352012_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2352216_2353515_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2353618_2353816_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2353897_2354902_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|2354904_2356164_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|2356249_2357530_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2357605_2357914_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280357.1|2357999_2358950_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001298688.1|2358942_2360790_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001540520.1|2360799_2362131_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
>prophage 181
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2366046	2366592	4948013		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2366046_2366592_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 182
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2374312	2375290	4948013		Tupanvirus(100.0%)	1	NA	NA
WP_001540513.1|2374312_2375290_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.1	5.2e-28
>prophage 183
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2380210	2380744	4948013		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2380210_2380744_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 184
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2384948	2386932	4948013		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2384948_2386595_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2386638_2386932_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 185
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2395266	2396532	4948013	integrase	Enterobacteria_phage(100.0%)	1	2393603:2393616	2405071:2405084
2393603:2393616	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_001218869.1|2395266_2396532_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|2395266_2396532_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
2405071:2405084	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 186
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2427708	2428284	4948013		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|2427708_2428284_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 187
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2435109	2438691	4948013		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000792585.1|2435109_2436339_+	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
WP_000494233.1|2436355_2437411_+	response regulator	NA	NA	NA	NA	NA
WP_001001003.1|2437539_2438691_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 188
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2450189	2452360	4948013		Yersinia_phage(33.33%)	4	NA	NA
WP_001773857.1|2450189_2451008_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214398.1|2451098_2451584_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186786.1|2451599_2452076_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692311.1|2452138_2452360_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 189
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2460987	2464199	4948013	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|2460987_2462445_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003806.1|2462681_2464199_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 190
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2483763	2485266	4948013		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|2483763_2485266_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 191
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2490105	2490894	4948013		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|2490105_2490894_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 192
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2496504	2498054	4948013		Bacillus_virus(50.0%)	2	NA	NA
WP_001075532.1|2496504_2497263_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	6.1e-16
WP_000611411.1|2497373_2498054_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 193
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2504176	2510545	4948013		Bacillus_virus(50.0%)	5	NA	NA
WP_000235240.1|2504176_2505709_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
WP_000507111.1|2505687_2506668_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001314355.1|2506678_2507374_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171678.1|2507357_2508287_+	allose kinase	NA	NA	NA	NA	NA
WP_001540450.1|2508559_2510545_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
>prophage 194
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2515790	2517938	4948013		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|2515790_2517938_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 195
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2521855	2523383	4948013		Planktothrix_phage(50.0%)	2	NA	NA
WP_000132446.1|2521855_2522692_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|2522678_2523383_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	7.1e-19
>prophage 196
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2533319	2535278	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078222.1|2533319_2535278_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	4.8e-89
>prophage 197
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2541575	2542925	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2541575_2542925_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 198
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2546741	2550355	4948013		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2546741_2547278_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_001774120.1|2547532_2550355_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 199
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2560472	2561891	4948013		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103920.1|2560472_2561891_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	9.6e-39
>prophage 200
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2567461	2570009	4948013		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|2567461_2568541_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2568593_2570009_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 201
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2575047	2575656	4948013		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2575047_2575656_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 202
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2583189	2584305	4948013		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2583189_2584305_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 203
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2608644	2612328	4948013		Dickeya_phage(100.0%)	1	NA	NA
WP_001540407.1|2608644_2612328_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 204
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2632976	2634740	4948013		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2632976_2633249_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941119.1|2633435_2634026_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2634068_2634740_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 205
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2643035	2651364	4948013		Vibrio_phage(50.0%)	2	NA	NA
WP_000653952.1|2643035_2647259_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
WP_000263098.1|2647335_2651364_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 206
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2655359	2658412	4948013		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2655359_2656544_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2657461_2658412_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 207
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2666751	2672534	4948013	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_000591376.1|2666751_2668596_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
WP_000187001.1|2668964_2670065_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2670104_2670464_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_122083113.1|2670463_2671114_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000125464.1|2671217_2672534_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
>prophage 208
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2677974	2679189	4948013		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|2677974_2679189_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 209
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2691333	2698580	4948013		Serratia_phage(33.33%)	5	NA	NA
WP_000184862.1|2691333_2693631_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2693681_2694002_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004469.1|2694016_2695096_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001540357.1|2695404_2697906_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001540356.1|2697917_2698580_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	4.2e-29
>prophage 210
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2705393	2706947	4948013		Pandoravirus(100.0%)	1	NA	NA
WP_000694066.1|2705393_2706947_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
>prophage 211
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2722657	2803746	4948013	tRNA,plate,protease,lysis,holin,head,tail,capsid,portal,integrase,terminase	Escherichia_phage(42.55%)	88	2738590:2738636	2772392:2772438
WP_000208242.1|2722657_2723188_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|2723197_2724529_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000872908.1|2725613_2726099_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2726183_2726429_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2726853_2727699_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136804.1|2727721_2729230_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2729400_2730411_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796345.1|2730507_2731254_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|2731258_2731687_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2731713_2732013_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2732224_2732665_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802217.1|2732765_2733365_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2733472_2734240_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001774116.1|2734294_2735050_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758726.1|2735156_2736146_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001318165.1|2736465_2737428_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|2737608_2738511_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2738590:2738636	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2738746_2738965_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001774114.1|2739046_2740210_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	3.5e-204
WP_001774113.1|2740209_2740689_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	1.9e-84
WP_154832348.1|2740703_2742866_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_000785970.1|2743142_2743262_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001774111.1|2743294_2743570_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_001251408.1|2743626_2744145_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2744157_2745348_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001774110.1|2745829_2746876_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001774108.1|2748812_2749337_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.7	7.5e-90
WP_001774107.1|2749340_2752070_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	80.7	0.0e+00
WP_001774106.1|2752080_2752611_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	96.6	2.4e-99
WP_001121474.1|2752603_2753512_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001774105.1|2753516_2753864_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	7.2e-57
WP_001774104.1|2753860_2754502_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	89.8	5.4e-98
WP_001774103.1|2754568_2755021_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_001774102.1|2755013_2755481_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001300730.1|2755443_2755617_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001774101.1|2755588_2756014_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.0e-65
WP_000736609.1|2756001_2756427_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	3.8e-60
WP_001144101.1|2756441_2756939_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2756938_2757220_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|2757223_2757427_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2757426_2757936_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001774100.1|2758035_2758779_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.8	1.9e-123
WP_001774099.1|2758782_2759856_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
WP_001085948.1|2759914_2760769_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156861.1|2760942_2762715_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001774098.1|2762714_2763749_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.6e-200
WP_001774096.1|2765755_2766307_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	47.0	7.0e-38
WP_001774095.1|2766485_2768762_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_001774094.1|2768751_2769027_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.5e-44
WP_001113264.1|2769023_2769248_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277961.1|2769247_2769550_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_000557703.1|2769549_2769774_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2769837_2770338_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001333116.1|2770334_2770532_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.5	3.6e-29
WP_000453534.1|2770507_2770780_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|2770932_2771226_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023384.1|2771295_2772276_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001223800.1|2772461_2772962_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2772392:2772438	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033719.1|2773111_2773810_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2773806_2775180_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001540294.1|2775351_2776026_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_171768479.1|2776174_2777155_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001298417.1|2777414_2778035_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_000063507.1|2778320_2779355_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296618.1|2779351_2780290_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_001540290.1|2780273_2781110_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144110.1|2781397_2782867_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001540286.1|2782863_2784123_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001540285.1|2784583_2785408_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619492.1|2785417_2785732_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000749934.1|2785772_2787167_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001774093.1|2788162_2788996_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012602895.1|2789189_2792240_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2792252_2793155_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2793151_2793787_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027720.1|2793783_2794713_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001314326.1|2794928_2795147_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296612.1|2795542_2795821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|2796179_2796470_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897302.1|2796470_2796782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774092.1|2797010_2797919_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001297068.1|2797982_2798924_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560978.1|2798968_2799406_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000920762.1|2799402_2800275_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001314324.1|2800268_2800868_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000059678.1|2800966_2801752_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621622.1|2801785_2802682_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718898.1|2802849_2803746_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 212
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2823159	2825630	4948013		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001540261.1|2823159_2824209_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	9.3e-07
WP_001315107.1|2824220_2825630_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 213
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2829751	2832538	4948013		uncultured_virus(100.0%)	1	NA	NA
WP_000249991.1|2829751_2832538_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 214
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2846227	2846842	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_001335246.1|2846227_2846842_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.8	1.3e-19
>prophage 215
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2855712	2858999	4948013		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109949.1|2855712_2856489_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459600.1|2856491_2857007_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2857010_2857280_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187545.1|2857358_2858999_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 216
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2880993	2882502	4948013		Vibrio_phage(100.0%)	1	NA	NA
WP_000037970.1|2880993_2882502_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 217
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2892962	2894792	4948013		Catovirus(100.0%)	1	NA	NA
WP_001442069.1|2892962_2894792_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 218
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2902151	2910758	4948013		Bacillus_phage(50.0%)	8	NA	NA
WP_000383407.1|2902151_2904314_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001774088.1|2904397_2905114_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130676.1|2905113_2906010_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_000812795.1|2906006_2906714_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_001160645.1|2906710_2907535_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000799889.1|2907571_2907775_-	lipoprotein	NA	NA	NA	NA	NA
WP_001540206.1|2907963_2909433_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	55.4	1.3e-43
WP_001014271.1|2909429_2910758_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.8e-10
>prophage 219
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2918887	2920543	4948013		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395835.1|2918887_2920543_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 220
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2928549	2934693	4948013		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612054.1|2928549_2929680_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001540197.1|2929684_2930359_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2930336_2931218_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001540196.1|2931236_2932304_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.0e-101
WP_000006615.1|2932303_2933566_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-23
WP_000866670.1|2933562_2934693_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 221
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2938735	2944149	4948013		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2938735_2939065_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2939195_2940461_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001314257.1|2940596_2942081_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238868.1|2942127_2944149_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 222
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2951745	2953392	4948013		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001540188.1|2951745_2953392_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 223
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2966783	2970174	4948013		Enterobacteria_phage(50.0%)	3	NA	NA
WP_001056273.1|2966783_2967674_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2967698_2968664_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|2968668_2970174_-	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
>prophage 224
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2975803	2976796	4948013		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_001540168.1|2975803_2976796_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 225
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	2988750	2996265	4948013		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|2988750_2990121_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|2990281_2992111_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000867146.1|2992424_2993465_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2993551_2994511_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001540141.1|2994510_2995401_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2995491_2996265_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 226
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3006636	3007974	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3006636_3007974_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 227
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3018172	3025541	4948013		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3018172_3018430_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3018393_3018753_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3018769_3018910_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|3019139_3019220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|3019516_3020920_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3020924_3022025_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3022024_3023098_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072072.1|3023126_3025541_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 228
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3030246	3031395	4948013		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3030246_3031395_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 229
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3035822	3047700	4948013		Cyanophage(16.67%)	12	NA	NA
WP_001243437.1|3035822_3036236_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3036347_3036776_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001279773.1|3036972_3038634_+	putative transporter	NA	NA	NA	NA	NA
WP_001540119.1|3038723_3039590_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001540118.1|3039756_3041472_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_001540116.1|3041468_3042962_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	6.6e-30
WP_000703959.1|3043021_3043369_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3043358_3043721_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148045.1|3043717_3044215_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001332269.1|3044222_3045407_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_001312198.1|3045807_3045906_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168476.1|3046011_3047700_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 230
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3055004	3056339	4948013		Moraxella_phage(100.0%)	1	NA	NA
WP_001557145.1|3055004_3056339_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 231
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3061779	3073955	4948013	integrase	Enterobacteria_phage(88.89%)	12	3062868:3062890	3074116:3074138
WP_001280585.1|3061779_3062817_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	5.7e-73
3062868:3062890	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_154832327.1|3063366_3065700_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_000856729.1|3065714_3066035_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|3066170_3066626_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|3066618_3066906_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980221.1|3066898_3067489_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_001149160.1|3067485_3067752_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283007.1|3068304_3069039_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638635.1|3069035_3069536_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446136.1|3069609_3070182_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000611230.1|3070492_3070915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218984.1|3072791_3073955_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
3074116:3074138	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 232
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3087326	3088718	4948013		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3087326_3088718_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 233
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3093019	3099770	4948013		Bordetella_phage(25.0%)	6	NA	NA
WP_000280473.1|3093019_3095128_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3095146_3095422_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3095476_3096100_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001525900.1|3096357_3098040_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.2	2.5e-22
WP_000924289.1|3098036_3098654_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297973.1|3098945_3099770_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
>prophage 234
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3103144	3107707	4948013		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3103144_3103603_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050148.1|3103580_3104801_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	3.2e-43
WP_001540088.1|3104972_3105641_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3105857_3106094_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3106114_3106282_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114542.1|3106379_3107189_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001171873.1|3107227_3107707_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 235
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3115145	3117239	4948013		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364803.1|3115145_3116174_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
WP_001540080.1|3116255_3117239_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
>prophage 236
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3120647	3130153	4948013		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|3120647_3121580_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213845.1|3121793_3122990_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000646014.1|3122999_3124025_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982100.1|3124263_3125298_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483831.1|3125284_3126244_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214152.1|3126247_3127531_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|3127540_3129085_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3129329_3129761_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3129901_3130153_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 237
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3156754	3167296	4948013		Enterobacterial_phage(33.33%)	5	NA	NA
WP_001540057.1|3156754_3160435_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	46.0	4.3e-309
WP_000779792.1|3160591_3161200_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001540055.1|3162684_3164529_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000741493.1|3164719_3165871_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985736.1|3166000_3167296_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 238
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3186870	3188412	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146502.1|3186870_3188412_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 239
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3193729	3194725	4948013		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182634.1|3193729_3194725_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 240
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3198946	3199159	4948013		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3198946_3199159_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 241
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3202813	3205147	4948013		Escherichia_phage(100.0%)	1	NA	NA
WP_001540040.1|3202813_3205147_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 242
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3220933	3222918	4948013		Planktothrix_phage(50.0%)	2	NA	NA
WP_001540025.1|3220933_3221917_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000103577.1|3221913_3222918_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-17
>prophage 243
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3268856	3270326	4948013		Bacillus_virus(50.0%)	2	NA	NA
WP_000123131.1|3268856_3269504_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
WP_000622316.1|3269555_3270326_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 244
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3280996	3286405	4948013		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001539997.1|3280996_3281422_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	4.7e-50
WP_001295215.1|3281756_3281840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160795.1|3281893_3283246_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_000954225.1|3283317_3284160_-	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_001312164.1|3284362_3286405_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 245
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3296091	3301173	4948013		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000149094.1|3296091_3298827_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|3298826_3299951_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001190062.1|3299959_3300361_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173679.1|3300366_3301173_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 246
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3309066	3313365	4948013		Dickeya_phage(50.0%)	4	NA	NA
WP_001100463.1|3309066_3309732_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
WP_000130621.1|3309952_3310198_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106596.1|3310466_3312665_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	1.3e-119
WP_000964718.1|3312738_3313365_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 247
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3316371	3319190	4948013		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001539990.1|3316371_3317040_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	2.3e-14
WP_001042003.1|3317032_3318091_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3318335_3319190_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 248
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3324913	3326396	4948013		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3324913_3325681_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3325682_3326396_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 249
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3329937	3331748	4948013		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907827.1|3329937_3331008_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073603.1|3331004_3331748_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
>prophage 250
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3342623	3344720	4948013		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001539976.1|3342623_3344720_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 251
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3355049	3357497	4948013		Dickeya_phage(100.0%)	1	NA	NA
WP_001539973.1|3355049_3357497_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 252
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3372901	3374128	4948013		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|3372901_3374128_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 253
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3378518	3380912	4948013		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081882.1|3378518_3380912_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 254
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3387141	3388035	4948013		Sodalis_phage(100.0%)	1	NA	NA
WP_000039098.1|3387141_3388035_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 255
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3394616	3398384	4948013		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3394616_3395336_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253707.1|3395332_3396685_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001309803.1|3396761_3398384_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
>prophage 256
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3415289	3416126	4948013		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3415289_3416126_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 257
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3435037	3444589	4948013		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601853.1|3435037_3435601_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
WP_000963803.1|3435686_3436907_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001298205.1|3436984_3439075_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|3439125_3439758_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3440059_3440464_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274684.1|3440518_3441388_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3441441_3441660_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057389.1|3441653_3442676_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3442675_3444589_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 258
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3450159	3458726	4948013		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209693.1|3450159_3450546_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
WP_000820731.1|3450545_3450905_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903382.1|3450911_3451199_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3451324_3451699_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3451795_3452266_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3452362_3454477_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3454547_3455732_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773146.1|3456023_3458726_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
>prophage 259
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3467556	3469509	4948013		Vibrio_phage(100.0%)	1	NA	NA
WP_001774055.1|3467556_3469509_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 260
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3490733	3492205	4948013	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004421.1|3490733_3491681_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3491695_3492205_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 261
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3502542	3506696	4948013		Bacillus_virus(50.0%)	4	NA	NA
WP_000078342.1|3502542_3503301_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001539875.1|3503308_3504412_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001539874.1|3504421_3505603_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3505670_3506696_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 262
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3513200	3514085	4948013		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001539870.1|3513200_3514085_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 263
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3519422	3523935	4948013		Escherichia_phage(50.0%)	4	NA	NA
WP_048975857.1|3519422_3520253_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.4	2.7e-09
WP_000275540.1|3520594_3521449_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001298583.1|3521484_3522375_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001774052.1|3522435_3523935_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	3.1e-11
>prophage 264
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3533222	3534266	4948013		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3533222_3534266_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 265
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3551917	3553285	4948013	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|3551917_3553285_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 266
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3557251	3561262	4948013	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366127.1|3557251_3557749_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000074795.1|3557856_3558648_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|3558769_3559663_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108474.1|3559771_3561262_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 267
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3569965	3584760	4948013		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|3569965_3570895_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809780.1|3570990_3573327_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_000719791.1|3573556_3574210_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|3574206_3574935_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001539838.1|3574931_3575564_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3575777_3576050_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3576046_3576901_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3576946_3577438_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3577555_3577843_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3577865_3579299_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3579346_3580072_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3580078_3580636_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_001539833.1|3580604_3581180_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030015.1|3581176_3581743_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
WP_001295557.1|3581763_3582750_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922880.1|3582763_3583741_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001539830.1|3583950_3584760_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.8e-19
>prophage 268
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3588828	3590311	4948013		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3588828_3589107_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047338.1|3589339_3590311_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 269
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3596939	3599812	4948013	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3596939_3598874_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3598963_3599812_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 270
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3603892	3610530	4948013		Dickeya_phage(50.0%)	3	NA	NA
WP_000207680.1|3603892_3605236_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3605866_3606319_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000133044.1|3607857_3610530_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 271
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3616011	3617901	4948013		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3616011_3617901_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 272
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3623603	3631397	4948013		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189333.1|3623603_3623906_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
WP_000449030.1|3623956_3624400_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3624379_3624898_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|3625025_3625661_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|3625733_3626774_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3626887_3627463_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3627472_3628063_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246830.1|3628082_3628478_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249104.1|3628435_3630472_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|3630536_3631397_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 273
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3655183	3656329	4948013		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3655183_3656329_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 274
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3664534	3666829	4948013		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3664534_3666829_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 275
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3687407	3688373	4948013		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3687407_3688373_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 276
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3701227	3717423	4948013	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082856.1|3701227_3704320_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
WP_000212475.1|3704503_3705487_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450594.1|3705705_3706038_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001375279.1|3706079_3707459_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.5e-33
WP_000094721.1|3707876_3709397_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018003.1|3709550_3710174_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001066494.1|3710461_3711226_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3711479_3711986_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437375.1|3712064_3713906_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3714100_3715846_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3715956_3716172_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|3716409_3717423_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 277
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3723823	3725062	4948013	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3723823_3725062_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 278
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3730199	3731633	4948013		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3730199_3731633_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 279
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3741149	3752112	4948013		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3741149_3741803_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3742064_3742235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774048.1|3742292_3743066_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001320780.1|3743208_3743997_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3744034_3745195_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3745200_3745872_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3746019_3747501_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3747705_3748335_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3748335_3748758_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3748782_3749610_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3749609_3750191_+	esterase YqiA	NA	NA	NA	NA	NA
WP_001774047.1|3750219_3752112_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	9.0e-93
>prophage 280
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3755939	3756332	4948013		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3755939_3756332_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 281
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3759642	3761901	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_001281841.1|3759642_3761901_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
>prophage 282
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3769359	3776678	4948013		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_001539716.1|3769359_3770832_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.6e-47
WP_000438650.1|3771154_3771904_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_001539714.1|3772155_3774375_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	3.0e-103
WP_000848528.1|3774416_3774674_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001539712.1|3774724_3775651_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013152.1|3775850_3776678_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
>prophage 283
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3782521	3783406	4948013		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3782521_3783406_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 284
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3805581	3806754	4948013		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|3805581_3806754_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 285
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3821109	3886537	4948013	lysis,protease,transposase	Acinetobacter_phage(28.57%)	48	NA	NA
WP_001774042.1|3821109_3825666_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001335851.1|3825795_3826605_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001305092.1|3826670_3827081_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001305091.1|3827098_3828058_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498847.1|3828087_3830148_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249375.1|3830147_3831641_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173425.1|3831640_3832864_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|3832880_3833336_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115117.1|3833339_3833903_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820092.1|3833899_3834271_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001254776.1|3834267_3834873_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633240.1|3834869_3835847_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097240.1|3835843_3837022_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942826.1|3837023_3837560_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000124301.1|3838618_3839395_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590258.1|3839391_3840051_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
WP_000038461.1|3840100_3840724_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000066002.1|3840720_3841761_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_001259305.1|3841760_3843017_+	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000723250.1|3843013_3844189_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_024188362.1|3844181_3845330_+	NeuE protein	NA	NA	NA	NA	NA
WP_000575410.1|3845319_3846549_+	poly-alpha-2,8 sialosyl sialyltransferase	NA	NA	NA	NA	NA
WP_001161835.1|3846698_3847904_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_000579517.1|3847938_3849966_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000030745.1|3849962_3850703_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298258.1|3850712_3852389_-	polysialic acid transporter KpsD	NA	NA	NA	NA	NA
WP_000905924.1|3852412_3853561_-	capsule polysaccharide transporter	NA	NA	NA	NA	NA
WP_001296394.1|3853632_3854616_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_000729638.1|3855426_3855582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096974168.1|3855758_3856915_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_001223343.1|3857249_3859340_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_085949836.1|3859616_3860830_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001296383.1|3861462_3861705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521284.1|3861995_3862364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|3862367_3862583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|3864585_3865799_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_011076574.1|3871215_3871359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169254050.1|3871909_3874105_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|3874192_3875470_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|3875466_3877209_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|3877208_3878156_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|3878156_3879881_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074477.1|3880016_3881210_+	MFS transporter	NA	NA	NA	NA	NA
WP_103103190.1|3881322_3882551_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_001296373.1|3883259_3883688_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|3883727_3884288_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|3884329_3884590_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|3886423_3886537_+|lysis	lysis protein	lysis	NA	NA	NA	NA
>prophage 286
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3894672	3895938	4948013	integrase	Enterobacteria_phage(100.0%)	1	3893924:3893938	3902516:3902530
3893924:3893938	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|3894672_3895938_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|3894672_3895938_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3902516:3902530	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 287
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3918623	3919778	4948013		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3918623_3919778_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 288
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3927819	3928728	4948013		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|3927819_3928728_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 289
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3933779	3934457	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_000956878.1|3933779_3934457_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	9.9e-10
>prophage 290
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3947951	3949184	4948013		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3947951_3949184_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 291
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3957320	3961793	4948013		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195072.1|3957320_3960194_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
WP_001339296.1|3960359_3961793_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 292
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	3965598	3980990	4948013	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3965598_3966495_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715230.1|3966519_3967230_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813189.1|3967235_3968969_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_001701073.1|3969059_3970157_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|3970167_3971685_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001774038.1|3971727_3972276_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3972330_3972402_+	protein YqfH	NA	NA	NA	NA	NA
WP_001539548.1|3972398_3972524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539546.1|3972525_3973974_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	1.9e-26
WP_001363023.1|3974409_3976329_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001539543.1|3976328_3976817_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012167.1|3976852_3978220_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_001539542.1|3978255_3979572_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|3979589_3980990_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 293
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4005269	4006025	4948013		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4005269_4006025_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 294
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4010310	4012805	4948013		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|4010310_4011072_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_001539529.1|4011386_4012805_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	3.0e-24
>prophage 295
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4022436	4029208	4948013		Moraxella_phage(33.33%)	6	NA	NA
WP_001539524.1|4022436_4023150_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	1.5e-45
WP_000082183.1|4023218_4023908_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4024592_4025123_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032164524.1|4025135_4027406_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4027531_4028407_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4028413_4029208_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 296
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4034685	4051300	4948013		Bacillus_phage(28.57%)	10	NA	NA
WP_001138105.1|4034685_4037574_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.5e-67
WP_001539517.1|4037566_4041109_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	2.6e-08
WP_001539515.1|4041108_4042935_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.3	7.8e-25
WP_000237947.1|4042996_4044328_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4044559_4045813_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000582830.1|4046070_4046895_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810554.1|4046926_4048507_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_154832336.1|4048506_4049682_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066226.1|4049684_4050281_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_001350145.1|4050352_4051300_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
>prophage 297
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4067375	4069892	4948013		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_016238851.1|4067375_4069892_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-19
>prophage 298
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4074252	4076886	4948013		Cronobacter_phage(100.0%)	1	NA	NA
WP_001539489.1|4074252_4076886_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	6.4e-97
>prophage 299
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4085716	4088222	4948013	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117711.1|4085716_4086523_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.4e-15
WP_000184273.1|4086573_4087017_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001490456.1|4087016_4088222_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
>prophage 300
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4099797	4100553	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_024193509.1|4099797_4100553_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 301
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4105411	4106260	4948013		Vibrio_phage(100.0%)	1	NA	NA
WP_000100429.1|4105411_4106260_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 302
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4113792	4117907	4948013		Hokovirus(50.0%)	2	NA	NA
WP_000186448.1|4113792_4116549_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046817.1|4116605_4117907_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 303
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4121940	4124964	4948013		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_001774030.1|4121940_4123578_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	1.5e-152
WP_000036723.1|4123665_4124964_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 304
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4128761	4131960	4948013		Vibrio_phage(50.0%)	3	NA	NA
WP_001199974.1|4128761_4129433_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232702.1|4129517_4130525_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032143646.1|4130550_4131960_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	5.6e-15
>prophage 305
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4139260	4140046	4948013		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|4139260_4140046_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 306
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4154695	4156728	4948013		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4154695_4156123_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173653.1|4156122_4156728_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 307
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4159839	4163555	4948013		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|4159839_4160601_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254701.1|4160594_4161221_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|4161360_4162500_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4162562_4163555_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 308
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4167928	4175068	4948013		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|4167928_4168567_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_001539448.1|4168563_4169826_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|4169822_4170731_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001298167.1|4170926_4171694_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141302.1|4171744_4172401_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001539446.1|4172506_4175068_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
>prophage 309
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4194588	4195599	4948013		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|4194588_4195599_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 310
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4203074	4204040	4948013		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001774024.1|4203074_4204040_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 311
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4209506	4214893	4948013	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132236.1|4209506_4210004_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
WP_000963143.1|4210083_4211145_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4211213_4211714_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047170.1|4211842_4214473_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4214707_4214893_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 312
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4219504	4219963	4948013	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000526113.1|4219504_4219963_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 313
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4228285	4233583	4948013		Bacillus_virus(20.0%)	5	NA	NA
WP_000985490.1|4228285_4229488_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777941.1|4229844_4230804_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_001539410.1|4230813_4232958_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.6e-194
WP_000080947.1|4232930_4233341_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4233337_4233583_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 314
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4238800	4242851	4948013		Clostridium_phage(50.0%)	4	NA	NA
WP_001539402.1|4238800_4239250_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	2.6e-06
WP_001357560.1|4239250_4239913_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001298180.1|4239933_4241334_-	GABA permease	NA	NA	NA	NA	NA
WP_001774023.1|4241570_4242851_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	1.1e-33
>prophage 315
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4247787	4259234	4948013	integrase	Enterobacteria_phage(77.78%)	13	4247132:4247144	4258108:4258120
4247132:4247144	attL	AAAAAAGCCCGCA	NA	NA	NA	NA
WP_154832338.1|4247787_4250121_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856725.1|4250135_4250456_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|4250591_4251047_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244670.1|4251039_4251327_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_100210306.1|4251319_4251919_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	82.5	3.2e-52
WP_001149160.1|4251915_4252182_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001774585.1|4252733_4253468_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	3.0e-129
WP_001774584.1|4253464_4253965_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001774583.1|4254038_4254611_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.2	4.2e-94
WP_001774582.1|4255143_4256451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774581.1|4256464_4256683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124710.1|4256770_4257991_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	8.4e-108
WP_000162574.1|4258751_4259234_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4258108:4258120	attR	AAAAAAGCCCGCA	NA	NA	NA	NA
>prophage 316
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4272867	4273938	4948013		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4272867_4273938_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 317
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4279843	4282417	4948013		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539382.1|4279843_4282417_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
>prophage 318
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4297498	4303581	4948013	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4297498_4297918_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|4298124_4299162_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001539375.1|4299209_4299899_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	9.3e-56
WP_000627807.1|4300203_4300587_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189208.1|4300642_4301230_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001298616.1|4301332_4302214_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219206.1|4302246_4303581_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 319
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4309352	4313094	4948013		Tupanvirus(50.0%)	3	NA	NA
WP_000790169.1|4309352_4311152_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4311167_4312142_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4312413_4313094_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 320
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4316553	4316814	4948013		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|4316553_4316814_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 321
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4320933	4332242	4948013		Bacillus_phage(50.0%)	7	NA	NA
WP_001539368.1|4320933_4324821_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
WP_001297612.1|4325396_4326824_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215879.1|4326988_4327702_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001539367.1|4327691_4329026_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4329086_4329425_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|4329469_4330660_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4330988_4332242_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 322
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4338000	4339512	4948013		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493464.1|4338000_4339512_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 323
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4349630	4355968	4948013		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4349630_4350845_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4350872_4351259_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4351275_4351599_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4351694_4352210_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196608.1|4352226_4354077_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|4354078_4354414_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523612.1|4354425_4354626_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001539348.1|4354684_4355968_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 324
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4365854	4366286	4948013		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|4365854_4366286_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 325
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4386766	4393255	4948013		Escherichia_phage(66.67%)	7	NA	NA
WP_001539338.1|4386766_4388143_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.0e-41
WP_001296289.1|4388304_4389771_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|4389839_4391417_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001774017.1|4391509_4392049_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	5.1e-41
WP_001311989.1|4392064_4392583_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|4392893_4393085_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017558.1|4393102_4393255_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
>prophage 326
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4399502	4403503	4948013		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028626.1|4399502_4400141_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296287.1|4400140_4401178_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|4401502_4402129_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|4402213_4403503_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 327
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4410982	4411696	4948013		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4410982_4411696_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 328
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4428937	4429888	4948013		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4428937_4429888_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 329
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4448802	4470530	4948013		Streptococcus_phage(25.0%)	22	NA	NA
WP_000102910.1|4448802_4449672_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|4449885_4450311_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001539298.1|4450297_4450747_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838948.1|4450807_4451383_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4451478_4452378_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001040459.1|4452555_4453980_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001539296.1|4453983_4454880_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000517443.1|4455159_4455951_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290263.1|4456108_4457125_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458408.1|4457124_4457958_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4457957_4458833_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021034.1|4458822_4459920_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_001539293.1|4460054_4460966_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719965.1|4460968_4461337_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096640.1|4461441_4462293_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4462335_4462845_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4462885_4464613_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4464657_4464915_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4465298_4466270_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4466454_4467216_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001539289.1|4467445_4468444_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_001539287.1|4468514_4470530_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
>prophage 330
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4496306	4497041	4948013		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4496306_4497041_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 331
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4500857	4501778	4948013		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|4500857_4501778_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 332
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4505467	4513044	4948013		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001774011.1|4505467_4507162_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	2.3e-23
WP_000955028.1|4507231_4508176_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001774010.1|4508249_4509395_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001774009.1|4509450_4513044_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 333
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4519684	4521118	4948013		Bacillus_phage(100.0%)	1	NA	NA
WP_000194520.1|4519684_4521118_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.4	1.5e-28
>prophage 334
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4524155	4525088	4948013		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001539260.1|4524155_4525088_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	98.7	3.9e-166
>prophage 335
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4541545	4542631	4948013		Pandoravirus(100.0%)	1	NA	NA
WP_001374741.1|4541545_4542631_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	7.7e-89
>prophage 336
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4551167	4552304	4948013		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699143.1|4551167_4552304_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.3e-22
>prophage 337
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4559053	4560571	4948013		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4559053_4560571_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 338
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4564782	4566642	4948013		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4564782_4565556_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156131.1|4565751_4566642_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
>prophage 339
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4577201	4580429	4948013		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203415.1|4577201_4577852_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
WP_001012899.1|4577938_4579771_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813854.1|4579829_4580429_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 340
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4613744	4618748	4948013		Tupanvirus(50.0%)	4	NA	NA
WP_001539159.1|4613744_4615727_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461633.1|4615726_4616695_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_024193507.1|4616698_4617838_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	4.2e-29
WP_001774001.1|4618145_4618748_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	4.4e-09
>prophage 341
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4622355	4626914	4948013	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001297916.1|4622355_4623561_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	2.5e-27
WP_001297939.1|4623617_4624907_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992976.1|4624924_4625728_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150331.1|4625768_4625990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539153.1|4626002_4626914_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	2.2e-68
>prophage 342
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4632806	4638953	4948013		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001773999.1|4632806_4633883_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
WP_000301050.1|4634345_4634996_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4635049_4635304_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332037.1|4635303_4636434_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075164.1|4636667_4638953_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 343
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4644397	4647025	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_001773998.1|4644397_4647025_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 344
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4661948	4666791	4948013		Bacillus_phage(50.0%)	2	NA	NA
WP_001296244.1|4661948_4663775_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
WP_000876057.1|4663941_4666791_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.9e-41
>prophage 345
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4671068	4676870	4948013		Enterobacteria_phage(25.0%)	5	NA	NA
WP_001539019.1|4671068_4672196_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
WP_001539017.1|4672307_4673363_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_001539016.1|4673436_4674501_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_001539014.1|4674500_4675151_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	8.3e-06
WP_000422211.1|4675226_4676870_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 346
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4685628	4686246	4948013		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|4685628_4686246_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 347
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4696149	4703798	4948013		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4696149_4697157_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|4697295_4697580_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_001539001.1|4697704_4699465_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	2.2e-101
WP_001234850.1|4699614_4700310_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213379.1|4700337_4701528_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_000188242.1|4701860_4702205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194894.1|4702208_4703798_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
>prophage 348
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4709552	4713853	4948013		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4709552_4710119_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296239.1|4710530_4711244_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198798.1|4711282_4712269_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001538996.1|4712386_4713853_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 349
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4727241	4728099	4948013		Catovirus(100.0%)	1	NA	NA
WP_001538989.1|4727241_4728099_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	6.9e-24
>prophage 350
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4732167	4735953	4948013		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489277.1|4732167_4734159_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
WP_000425463.1|4734190_4735027_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4735284_4735953_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 351
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4739647	4741168	4948013		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|4739647_4741168_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 352
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4761518	4770963	4948013		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538980.1|4761518_4762445_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_001538978.1|4762449_4763181_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4763161_4763269_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|4763328_4764060_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001538977.1|4764281_4765967_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_000598641.1|4765963_4766683_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4766729_4767200_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4767240_4767702_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001538974.1|4767826_4769830_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001538973.1|4769826_4770963_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 353
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4782969	4785003	4948013	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001538964.1|4782969_4785003_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 354
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4795651	4799208	4948013		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001538956.1|4795651_4796470_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	7.2e-23
WP_000434049.1|4796521_4797268_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011944.1|4797241_4798207_-	sugar kinase	NA	NA	NA	NA	NA
WP_001538954.1|4798203_4799208_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.4e-14
>prophage 355
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4808346	4814448	4948013	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_001538947.1|4808346_4809246_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.7	7.5e-13
WP_001361579.1|4809659_4809977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476012.1|4810305_4811667_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_001300972.1|4811813_4812146_-	YegP family protein	NA	NA	NA	NA	NA
WP_001538945.1|4812325_4813048_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_000675178.1|4813044_4814448_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 356
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4827555	4828908	4948013		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001538937.1|4827555_4828908_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	9.2e-07
>prophage 357
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4833634	4843855	4948013		Catovirus(40.0%)	9	NA	NA
WP_001295424.1|4833634_4834276_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001773994.1|4834367_4834949_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
WP_001538933.1|4834970_4836824_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454700.1|4836891_4838475_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|4838675_4838825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978098.1|4839133_4840273_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|4840278_4840722_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_001538931.1|4840724_4842887_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_001538930.1|4843015_4843855_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
>prophage 358
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4848099	4854893	4948013		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|4848099_4849221_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043612.1|4849223_4850189_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	1.3e-87
WP_024186851.1|4850191_4850671_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001538926.1|4850667_4851891_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001538925.1|4851893_4853330_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.8e-46
WP_001314854.1|4853522_4854893_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 359
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4860895	4876934	4948013		Bacillus_phage(25.0%)	12	NA	NA
WP_001557079.1|4860895_4862290_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.8e-18
WP_001773992.1|4862464_4863358_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_001557078.1|4863730_4864816_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
WP_154832342.1|4864815_4866525_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	3.2e-28
WP_001557074.1|4866521_4867595_+	O75 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_001557073.1|4867880_4868690_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001557072.1|4868694_4869468_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016237295.1|4869494_4870919_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	28.5	3.3e-47
WP_016237294.1|4871001_4872372_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
WP_001538923.1|4872492_4874025_+	O75 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001538922.1|4874112_4875519_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000704862.1|4875767_4876934_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
>prophage 360
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4884376	4885276	4948013		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131779.1|4884376_4885276_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 361
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4891473	4892640	4948013		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|4891473_4892640_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 362
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4908583	4909393	4948013		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000049.1|4908583_4909393_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.0	5.9e-09
>prophage 363
NZ_CP041620	Shigella flexneri strain C32 chromosome, complete genome	4948013	4919156	4919912	4948013		Escherichia_phage(100.0%)	1	NA	NA
WP_000281586.1|4919156_4919912_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.9	1.3e-18
>prophage 1
NZ_CP041619	Shigella flexneri strain C32 plasmid pC32_1, complete sequence	90682	10982	67868	90682	protease,integrase,transposase	Escherichia_phage(42.86%)	51	3703:3717	11875:11889
3703:3717	attL	ATGTTTTGCAGCAGG	NA	NA	NA	NA
WP_001066952.1|10982_11723_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|11843_12032_-	hypothetical protein	NA	NA	NA	NA	NA
11875:11889	attR	ATGTTTTGCAGCAGG	NA	NA	NA	NA
WP_001072358.1|12398_13568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|14414_14687_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|15929_17900_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|17906_18698_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001300609.1|19436_20219_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_001310017.1|20215_21238_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|22317_22665_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|22661_23066_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|23567_25076_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000371882.1|26589_26850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|26846_27356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|27375_27723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966594.1|27907_28186_+	Colicin-Ia immunity protein	NA	NA	NA	NA	NA
WP_001224623.1|30636_31512_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_000981091.1|31519_32296_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|32464_34726_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|34794_35970_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001189106.1|38235_38724_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|39628_40114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|40138_40624_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|40610_41306_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|41310_42441_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|42430_43714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|43716_45096_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|45199_45727_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|45767_47654_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|48000_48816_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|48998_49505_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|49494_49653_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001067855.1|50776_51481_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|52065_52926_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|53075_53477_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|53523_54228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|54983_55835_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|56141_56957_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|57017_57821_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|57820_58657_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|58717_59422_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|60811_61480_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|61515_61752_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|61748_62111_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|62128_63823_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|63874_64297_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|64332_64608_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|64621_64972_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|65043_65478_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001398199.1|66530_66932_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|66864_67122_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|67214_67868_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
