The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019798	Vibrio rotiferianus strain AM7 chromosome 1	3515444	681103	688170	3515444		Faustovirus(16.67%)	9	NA	NA
WP_045393646.1|681103_682318_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	30.2	7.4e-32
WP_005424883.1|682355_682739_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_005424893.1|682812_683136_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	1.0e-25
WP_005424897.1|683191_683707_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_088881285.1|683728_685582_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.4	7.2e-111
WP_005424889.1|685595_685934_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005424887.1|685979_686174_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_010446162.1|686345_687644_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.7	9.1e-36
WP_010446164.1|687744_688170_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	41.4	3.5e-21
>prophage 2
NZ_AP019798	Vibrio rotiferianus strain AM7 chromosome 1	3515444	761274	767964	3515444		Staphylococcus_phage(66.67%)	7	NA	NA
WP_010446316.1|761274_762414_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	3.8e-62
WP_143692085.1|762431_763682_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.4	2.3e-97
WP_010446320.1|763809_764259_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_088881255.1|764266_765391_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	5.4e-45
WP_143692087.1|765402_766056_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.5	1.1e-34
WP_010446326.1|766214_767324_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	2.0e-63
WP_005440184.1|767493_767964_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
>prophage 3
NZ_AP019798	Vibrio rotiferianus strain AM7 chromosome 1	3515444	984284	1053141	3515444	protease,integrase,plate	Vibrio_phage(22.22%)	58	984189:984240	988305:988356
984189:984240	attL	CCTTCTAAGGATGTGGTCATAGGTTCGAATCCTATAGGGCGTGCCATTTATT	NA	NA	NA	NA
WP_143692194.1|984284_985160_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	26.0	1.1e-13
WP_143692196.1|986253_987024_+	hypothetical protein	NA	A0A0S1WF56	Vibrio_phage	36.4	3.9e-10
WP_047513060.1|988462_989059_+	hypothetical protein	NA	NA	NA	NA	NA
988305:988356	attR	CCTTCTAAGGATGTGGTCATAGGTTCGAATCCTATAGGGCGTGCCATTTATT	NA	NA	NA	NA
WP_143692197.1|989113_990337_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_029788652.1|990333_991059_-	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	3.7e-10
WP_138942888.1|991055_991520_-	3-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_143692199.1|991512_992700_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_143692201.1|992721_993333_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_143692203.1|993329_995672_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_045490503.1|995643_996273_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_005446478.1|996272_996719_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005446480.1|996718_998272_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	31.8	5.4e-59
WP_138942884.1|998255_999998_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009700649.1|999999_1000359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172622526.1|1000370_1001741_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_138942882.1|1001746_1002307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005446488.1|1002306_1002564_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_009696047.1|1002579_1002852_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_171051998.1|1002868_1003633_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_138942881.1|1003629_1004355_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_138942880.1|1004430_1004826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171051997.1|1004856_1005924_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_143692205.1|1005932_1007177_+	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_143692207.1|1007366_1009058_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143692209.1|1009064_1009481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692211.1|1009712_1010459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692213.1|1010611_1011229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692215.1|1011273_1011618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010446907.1|1011641_1011938_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_010446908.1|1011947_1012511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172622527.1|1012510_1014502_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.0	3.6e-23
WP_143692219.1|1015188_1016580_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_008219014.1|1016606_1017137_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_008219012.1|1017206_1017716_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_143692221.1|1017715_1019194_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_143692222.1|1019240_1020596_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010446924.1|1020592_1021009_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_143692223.1|1021001_1022783_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_143692224.1|1022764_1023748_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_143692225.1|1023756_1026363_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.9	6.8e-83
WP_138942868.1|1026505_1027660_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_143692226.1|1027669_1029865_+	MFS transporter	NA	NA	NA	NA	NA
WP_071235612.1|1029861_1030995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692227.1|1030997_1031693_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143692228.1|1031726_1032674_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_143692229.1|1032673_1033141_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_029560942.1|1033143_1034460_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010446946.1|1034467_1035610_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_143692230.1|1035611_1039064_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_143692231.1|1039072_1039705_+	protein kinase	NA	NA	NA	NA	NA
WP_143692232.1|1039720_1041622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692233.1|1041688_1042654_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172622528.1|1043065_1044340_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_143692234.1|1044555_1045791_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.8	1.1e-54
WP_143692235.1|1045883_1047491_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	1.4e-22
WP_143692236.1|1047903_1048566_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_138942858.1|1048562_1049930_+	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_143692237.1|1050165_1053141_+|protease	M6 family metalloprotease domain-containing protein	protease	R9ZZU2	Cellulophaga_phage	37.0	3.8e-05
>prophage 4
NZ_AP019798	Vibrio rotiferianus strain AM7 chromosome 1	3515444	2495376	2558594	3515444	protease,transposase,integrase,tRNA	Prochlorococcus_phage(18.18%)	55	2503763:2503777	2551558:2551572
WP_138954544.1|2495376_2496780_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138954546.1|2499121_2501317_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138954547.1|2501316_2501814_+	bacterioferritin comigratory protein	NA	NA	NA	NA	NA
WP_138954548.1|2501928_2502393_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
2503763:2503777	attL	ACAAACTCTGCATCT	NA	NA	NA	NA
WP_143692811.1|2504233_2504521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171053637.1|2504902_2505418_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143692812.1|2505810_2506275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138954551.1|2506781_2507255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138954552.1|2507740_2507965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101905933.1|2508125_2508794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088881619.1|2509073_2509967_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088880772.1|2510060_2510990_+	DMT family transporter	NA	NA	NA	NA	NA
WP_143692813.1|2511314_2512340_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_031858044.1|2512669_2512969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116920618.1|2513484_2514861_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	3.4e-17
WP_143691916.1|2514930_2516124_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	49.0	2.2e-100
WP_143692814.1|2516470_2518300_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_143692815.1|2518296_2519562_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_017189246.1|2520046_2520184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143692816.1|2520248_2521319_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010449670.1|2521320_2521557_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_143692817.1|2521826_2523281_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_143692818.1|2523297_2523648_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.6e-19
WP_038886632.1|2523648_2524221_+	NAD(P)H:quinone oxidoreductase	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	32.4	3.5e-16
WP_010449678.1|2524241_2524682_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_143692819.1|2524795_2526073_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_038886630.1|2526308_2527562_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_005445324.1|2527715_2528342_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_143692820.1|2528521_2529562_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.5	7.2e-76
WP_143692821.1|2529704_2530343_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.3	2.9e-27
WP_143692822.1|2530432_2531278_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005436835.1|2531339_2531915_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_143692823.1|2532273_2534718_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010449700.1|2534823_2535087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138942675.1|2535370_2536618_-	TIGR03503 family protein	NA	NA	NA	NA	NA
WP_038882880.1|2536630_2537350_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.1	2.4e-38
WP_005436823.1|2537408_2537873_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.1	6.3e-48
WP_010449707.1|2537869_2538625_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010449709.1|2538664_2539423_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010449711.1|2539660_2541232_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	35.4	1.0e-12
WP_010449712.1|2541228_2541915_+	DUF1282 family protein	NA	NA	NA	NA	NA
WP_143692824.1|2541923_2542769_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_005380372.1|2542854_2543193_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_010449720.1|2543421_2543736_-	cytochrome c	NA	NA	NA	NA	NA
WP_143692825.1|2543864_2545196_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010449724.1|2545299_2546259_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_143692826.1|2546307_2549787_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.2e-204
WP_143692827.1|2549879_2550518_-	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	39.1	1.3e-24
WP_143692828.1|2550527_2551667_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
2551558:2551572	attR	ACAAACTCTGCATCT	NA	NA	NA	NA
WP_143692829.1|2551818_2552607_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_005430234.1|2552608_2553061_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_143692830.1|2553211_2554243_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_010449736.1|2554249_2554759_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_038882872.1|2554775_2557190_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_045394151.1|2557235_2558594_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_AP019798	Vibrio rotiferianus strain AM7 chromosome 1	3515444	2906757	2924060	3515444	tRNA	uncultured_Mediterranean_phage(18.18%)	15	NA	NA
WP_045392066.1|2906757_2909340_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	6.6e-78
WP_010450236.1|2909479_2909950_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_010450238.1|2910155_2911199_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.4	3.1e-111
WP_143692967.1|2911399_2911882_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.1	2.4e-26
WP_143692968.1|2911967_2914529_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.7	9.8e-34
WP_010450244.1|2914617_2915604_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	5.3e-36
WP_143692969.1|2915684_2916596_-	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	34.4	1.1e-14
WP_010450248.1|2916610_2917237_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	1.8e-37
WP_071235295.1|2917236_2918013_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	5.4e-68
WP_143692970.1|2918012_2919056_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005425365.1|2919101_2919578_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_138942816.1|2919592_2920303_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.0	1.4e-06
WP_005452106.1|2920304_2920586_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005425372.1|2921039_2922341_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	3.5e-136
WP_005449808.1|2922419_2924060_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.9	9.4e-155
>prophage 1
NZ_AP019799	Vibrio rotiferianus strain AM7 chromosome 2	2016094	1508568	1589827	2016094	capsid,portal,integrase,tail,terminase,protease,head,plate,transposase	Vibrio_phage(76.09%)	91	1538894:1538912	1592944:1592962
WP_143693988.1|1508568_1509618_-|protease	trypsin-like serine protease	protease	G9E3T9	Emiliania_huxleyi_virus	28.6	2.4e-18
WP_143693989.1|1509704_1510601_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010450931.1|1510746_1511670_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038882910.1|1511778_1512219_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_038882909.1|1512306_1513059_+	phosphatase	NA	NA	NA	NA	NA
WP_010450937.1|1513159_1513549_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_143693990.1|1513647_1514553_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143693991.1|1514673_1516692_+	MBL fold metallo-hydrolase	NA	A7J657	Paramecium_bursaria_Chlorella_virus	35.7	8.7e-102
WP_082038776.1|1516862_1517228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143693992.1|1517207_1517591_-	VOC family protein	NA	NA	NA	NA	NA
WP_143693993.1|1517583_1518513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010450948.1|1518590_1519064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143693994.1|1519342_1520026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143693995.1|1520035_1520731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172622600.1|1520876_1521608_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_143693996.1|1521648_1523028_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_071234163.1|1523321_1524515_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.9	1.5e-40
WP_143693997.1|1524655_1525687_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	88.5	6.5e-21
WP_010450959.1|1526027_1526546_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_138955275.1|1526682_1526955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138955274.1|1527176_1527893_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_138955273.1|1527982_1528822_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_138955272.1|1528818_1530621_-	DUF3744 domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.9	8.5e-16
WP_005432209.1|1530627_1531176_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143693998.1|1531486_1532617_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_010451026.1|1532616_1532988_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_138955260.1|1533134_1534025_+	EamA family transporter	NA	NA	NA	NA	NA
WP_138955259.1|1534121_1535705_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-16
WP_143693999.1|1535705_1537172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010451034.1|1537324_1538794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005375140.1|1538862_1539573_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
1538894:1538912	attL	TTCATCATGTCGTTGAACG	NA	NA	NA	NA
WP_071234183.1|1539970_1540921_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_038887438.1|1540910_1541714_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	33.8	1.8e-21
WP_143694000.1|1541737_1543153_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.0	1.4e-61
WP_081641259.1|1543159_1544086_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_143694001.1|1544274_1545321_-|integrase	tyrosine-type recombinase/integrase	integrase	R9TMQ4	Vibrio_phage	47.0	1.4e-90
WP_143694002.1|1545323_1545806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143694003.1|1545830_1546439_-	helix-turn-helix domain-containing protein	NA	A0A2I7RNF9	Vibrio_phage	62.4	1.0e-69
WP_143694004.1|1546641_1546842_+	hypothetical protein	NA	A0A2I7RNG9	Vibrio_phage	80.3	1.1e-22
WP_172622601.1|1546838_1546985_+	hypothetical protein	NA	A0A2I7RNG0	Vibrio_phage	73.5	6.0e-13
WP_143694005.1|1546994_1547534_+	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	65.7	4.6e-58
WP_143694006.1|1547543_1547879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694007.1|1547942_1548449_+	hypothetical protein	NA	R9TNP8	Vibrio_phage	52.1	6.5e-14
WP_172622602.1|1548445_1549051_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	48.9	2.6e-38
WP_143694008.1|1549047_1549449_+	hypothetical protein	NA	R9TRR4	Vibrio_phage	72.2	3.6e-52
WP_143694009.1|1549449_1549677_+	hypothetical protein	NA	R9TPY7	Vibrio_phage	76.9	2.1e-28
WP_143694010.1|1549673_1550225_+	hypothetical protein	NA	U3PB60	Vibrio_phage	67.0	4.0e-25
WP_143694219.1|1550332_1552870_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	68.1	0.0e+00
WP_143694011.1|1552882_1553092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694012.1|1553093_1553567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063344686.1|1553576_1553939_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063345119.1|1554174_1554399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084413342.1|1554340_1554781_-	ogr/Delta-like zinc finger family protein	NA	A0A2I7RNG8	Vibrio_phage	67.1	8.6e-55
WP_160161901.1|1555002_1555152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063345118.1|1555195_1556221_-|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	74.3	1.4e-148
WP_143694013.1|1556217_1557999_-|terminase	terminase	terminase	A0A2I7RNI3	Vibrio_phage	92.7	0.0e+00
WP_143694014.1|1558174_1559065_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2I7RNH1	Vibrio_phage	57.6	9.5e-69
WP_143694015.1|1559078_1560092_+|capsid	phage major capsid protein, P2 family	capsid	A0A2I7RNH6	Vibrio_phage	77.7	8.1e-149
WP_143694016.1|1560103_1560820_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	83.6	2.2e-116
WP_143694017.1|1560930_1561392_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	72.5	6.9e-55
WP_143694018.1|1561388_1561877_+|tail	phage tail protein	tail	U3PIL4	Vibrio_phage	74.1	1.7e-64
WP_010645241.1|1561863_1562523_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	81.7	1.3e-94
WP_063345111.1|1562524_1563634_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	83.4	4.0e-173
WP_086011830.1|1563627_1564086_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	84.2	4.0e-71
WP_063345110.1|1564094_1564304_+	TraR/DksA C4-type zinc finger protein	NA	U3PFL5	Vibrio_phage	73.9	1.3e-21
WP_063345109.1|1564300_1564513_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	81.2	7.3e-28
WP_143694019.1|1564499_1565090_+	glycoside hydrolase family protein	NA	U3PDH1	Vibrio_phage	76.0	1.2e-83
WP_143694020.1|1565064_1565406_+	hypothetical protein	NA	U3PB75	Vibrio_phage	61.9	9.7e-30
WP_138941791.1|1565422_1565617_+	hypothetical protein	NA	U3PCH1	Vibrio_phage	68.3	1.1e-17
WP_063345106.1|1565609_1565894_+	hypothetical protein	NA	A0A160DHS7	Vibrio_phage	69.1	9.8e-28
WP_143694021.1|1566094_1568383_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	61.8	4.8e-242
WP_138955144.1|1568372_1568705_+	DUF2590 family protein	NA	R9TMS7	Vibrio_phage	70.6	6.5e-39
WP_143694022.1|1568701_1569907_+|plate	baseplate J/gp47 family protein	plate	R9TRT3	Vibrio_phage	66.1	1.6e-151
WP_143694023.1|1569899_1570574_+|tail	phage tail protein	tail	U3PB79	Vibrio_phage	55.4	1.2e-52
WP_143694024.1|1570574_1571486_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	44.9	9.8e-29
WP_138941798.1|1571482_1571875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694025.1|1571871_1572342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694026.1|1572349_1573243_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	53.9	7.5e-82
WP_143694027.1|1573230_1573704_+	DNA-binding protein	NA	R9TPX7	Vibrio_phage	70.1	7.8e-54
WP_143694028.1|1573700_1575335_+	hypothetical protein	NA	R9TNN7	Vibrio_phage	66.4	1.2e-213
WP_143694029.1|1575336_1575534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694030.1|1576137_1576377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010451046.1|1576525_1576780_-	membrane protein	NA	NA	NA	NA	NA
WP_010451048.1|1577205_1578549_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	31.4	6.1e-43
WP_143694031.1|1578718_1578910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143694032.1|1579292_1581305_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_143694033.1|1581305_1583447_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_143694034.1|1583456_1585709_+	proprotein convertase P-domain-containing protein	NA	NA	NA	NA	NA
WP_143694035.1|1585734_1587168_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_143694036.1|1587169_1587739_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_001352368.1|1588618_1589827_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
1592944:1592962	attR	TTCATCATGTCGTTGAACG	NA	NA	NA	NA
>prophage 2
NZ_AP019799	Vibrio rotiferianus strain AM7 chromosome 2	2016094	1978606	2013747	2016094	plate,transposase	uncultured_marine_virus(25.0%)	23	NA	NA
WP_001352368.1|1978606_1979815_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_010452457.1|1980246_1980684_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_143694175.1|1980689_1982459_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_143694176.1|1982422_1983439_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_143694177.1|1983441_1984911_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_029561125.1|1984913_1985393_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_143694178.1|1985399_1986734_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010452444.1|1986736_1987510_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_143694179.1|1987535_1990145_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.3	3.7e-89
WP_143694180.1|1990147_1991728_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_143694181.1|1991724_1992381_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_143694182.1|1992389_1993811_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_143694183.1|1993826_1997372_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_143694184.1|1997426_1998692_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_143694185.1|1999124_1999643_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_143694186.1|1999744_2001808_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.7e-31
WP_143694187.1|2001810_2003328_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_143694188.1|2003406_2004255_+	ankyrin repeat domain-containing protein	NA	A0A2P1EHQ5	Megavirus	25.0	2.9e-06
WP_143694227.1|2004352_2005201_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_143694189.1|2005225_2006188_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_143694190.1|2006184_2007096_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_143694191.1|2011999_2012530_+	DUF4303 domain-containing protein	NA	NA	NA	NA	NA
WP_172622608.1|2012784_2013747_-|transposase	transposase	transposase	NA	NA	NA	NA
