The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	69993	134170	12022941	integrase,transposase	Mycobacterium_phage(50.0%)	55	58986:59002	132821:132837
58986:59002	attL	CCCCGGGCCTTCAGGCC	NA	NA	NA	NA
WP_143612542.1|69993_71259_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144079288.1|71265_71889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599496.1|72164_73877_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_143599497.1|73857_74331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599498.1|74548_75460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599499.1|75982_76654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599500.1|76900_77155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605092.1|78170_78449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599502.1|78639_79359_-	cation transporter	NA	NA	NA	NA	NA
WP_143599503.1|79358_79694_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_143599504.1|79792_80467_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143599505.1|81702_81939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331366.1|81939_82164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599506.1|82816_83206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611815.1|86937_87582_-	deaminase	NA	NA	NA	NA	NA
WP_143651893.1|87833_88985_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	29.8	1.6e-23
WP_143599512.1|90819_91392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651894.1|91391_93896_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_143626759.1|94173_94392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611817.1|94388_94661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144079289.1|94986_95631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611819.1|96627_96996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611820.1|97001_98774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611821.1|98742_99324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611822.1|99565_100840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611823.1|101685_102102_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_143611824.1|102184_102616_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_144079290.1|103745_104378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144079291.1|104463_104751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331437.1|106032_106182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144079292.1|106332_107133_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_143610922.1|109320_110343_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144079293.1|110597_112037_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_143605097.1|113479_113896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144079294.1|114019_114274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651895.1|114270_114576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611831.1|114695_115037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144079295.1|115168_115693_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_143606439.1|115900_116794_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_144079296.1|116810_117419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143606440.1|117920_118316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143606441.1|118344_119202_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143610923.1|119396_119921_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_143599531.1|120367_120517_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_144316375.1|121890_123141_+	cytochrome P450	NA	NA	NA	NA	NA
WP_164657581.1|123273_123450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599532.1|124027_124615_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143606442.1|124686_125481_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.5	3.0e-13
WP_144314441.1|125567_126419_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144314442.1|126584_126851_-	DUF5131 family protein	NA	A0A088F6A9	Mycobacterium_phage	41.7	6.6e-10
WP_143606445.1|127461_128217_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_144314444.1|130386_130656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599537.1|131274_131655_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143599538.1|131730_132660_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_143599539.1|133006_134170_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	45.1	8.3e-73
132821:132837	attR	CCCCGGGCCTTCAGGCC	NA	NA	NA	NA
>prophage 2
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	149125	186795	12022941	transposase,protease	Microcystis_virus(33.33%)	37	NA	NA
WP_143611846.1|149125_150439_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	35.3	5.2e-47
WP_054228650.1|150682_151033_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097288518.1|151248_151428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599548.1|151461_152256_+	2-phosphosulfolactate phosphatase	NA	NA	NA	NA	NA
WP_143611847.1|152267_152681_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_054237178.1|152716_153142_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_143599550.1|153141_153549_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_143599551.1|153545_155279_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.9	1.0e-18
WP_054237181.1|155275_155617_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143605100.1|155776_156130_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_143599552.1|157453_158053_+	MepB domain containing protein	NA	NA	NA	NA	NA
WP_143601573.1|158545_159400_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_143611848.1|159596_159779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611849.1|160886_161432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611850.1|161614_162139_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143611851.1|162135_162828_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.8	1.7e-28
WP_143611852.1|162824_165170_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_143611853.1|166642_167860_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164331444.1|168119_168266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651703.1|168410_168908_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_143611855.1|168915_169521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097288503.1|169730_170228_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143611856.1|170309_170783_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_097289553.1|171143_171485_-	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_143611857.1|171530_172100_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143611858.1|172648_173245_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143651898.1|173333_174197_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_144314448.1|174422_175811_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_164657582.1|175952_176378_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_143651899.1|177571_178451_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143611860.1|178463_179012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611861.1|179002_179344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314450.1|179918_181508_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_143611863.1|181987_182566_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_097288494.1|182699_182918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611864.1|183376_184120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651900.1|185670_186795_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	210926	271503	12022941	transposase,protease,tRNA	Mollivirus(20.0%)	47	NA	NA
WP_143605245.1|210926_212144_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144314455.1|212437_212770_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_144316376.1|212980_214219_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143605245.1|214421_215639_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143651903.1|216660_217410_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.7	9.0e-12
WP_143651904.1|217990_218449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143606484.1|220733_221834_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_143651897.1|222139_223654_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.3	4.2e-08
WP_144314456.1|223708_224332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599591.1|224777_225425_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_097227939.1|225641_226025_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_164331464.1|226029_226950_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_144316377.1|227045_228194_+	MFS transporter	NA	NA	NA	NA	NA
WP_060898423.1|228351_228729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060898422.1|228728_228968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097288478.1|230013_230217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651906.1|230735_231521_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_143611885.1|232752_233082_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143611886.1|233603_233945_-	hypothetical protein	NA	A0A218M9C0	Mycobacterium_phage	42.7	4.7e-16
WP_060898417.1|234294_235128_+	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
WP_143599596.1|236683_237202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599597.1|237595_238180_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143611887.1|238844_241595_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_097288471.1|243186_244053_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_143599599.1|244527_245409_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_143599600.1|245405_246044_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_143599601.1|246056_246500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599602.1|246517_247348_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	1.4e-50
WP_164657583.1|247501_248359_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144314458.1|248388_249594_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_060895359.1|249706_249919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143599605.1|250240_251233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164657584.1|251303_252125_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144314460.1|252334_253072_-	lipase	NA	NA	NA	NA	NA
WP_144314461.1|255994_256387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314462.1|256507_257728_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_144314463.1|257724_258390_+	response regulator	NA	NA	NA	NA	NA
WP_143611892.1|258736_259909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054229342.1|260624_260828_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	59.4	3.7e-13
WP_143611893.1|261164_261389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331470.1|261438_261609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314464.1|263766_264993_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144314465.1|265282_266524_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_164657585.1|266985_267657_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_164657586.1|267646_268834_+	cytochrome P450	NA	NA	NA	NA	NA
WP_164657587.1|268853_269693_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144316378.1|270387_271503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	278596	314990	12022941	transposase	Mycobacterium_phage(100.0%)	26	NA	NA
WP_143611897.1|278596_279439_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	57.8	3.4e-84
WP_164331471.1|279696_280008_-	DUF5134 domain-containing protein	NA	NA	NA	NA	NA
WP_164331369.1|279943_280126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611899.1|280149_280734_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143611900.1|281020_281803_+	TIGR03084 family protein	NA	NA	NA	NA	NA
WP_143611901.1|282057_282387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605245.1|282672_283890_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143651907.1|285513_286014_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_143611902.1|287915_288413_+	DUF1877 family protein	NA	NA	NA	NA	NA
WP_143654066.1|290797_291205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331473.1|291468_291843_+	DUF3293 domain-containing protein	NA	NA	NA	NA	NA
WP_143611905.1|291894_292233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143611906.1|292261_292816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143611907.1|292850_297425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316379.1|297324_297708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611908.1|298269_299466_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143611909.1|302127_302499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331475.1|302495_303773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067362492.1|303800_304460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314471.1|306301_306910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082416501.1|307482_307773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657588.1|308223_311079_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144314473.1|311552_311954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143606514.1|312040_312883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314474.1|313010_313964_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_144314475.1|313983_314990_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	997130	1015716	12022941	transposase,plate,tail	Propionibacterium_phage(33.33%)	14	NA	NA
WP_143600024.1|997130_998351_+|transposase	transposase	transposase	A0A1D8ETH9	Propionibacterium_phage	49.6	1.4e-94
WP_143600025.1|998411_999851_-	hydrolase	NA	NA	NA	NA	NA
WP_143600026.1|999943_1001368_-	hydrogenase expression protein	NA	NA	NA	NA	NA
WP_143600027.1|1001721_1003155_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_143600028.1|1003360_1004941_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.8	1.3e-65
WP_054230236.1|1005006_1005450_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_143600029.1|1005449_1005932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314709.1|1009244_1009592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054235291.1|1009640_1010066_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_143600030.1|1010081_1010807_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_097282744.1|1010806_1012723_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_143600031.1|1012763_1013204_+	GPW/gp25 family protein	NA	A0A1D8KR06	Synechococcus_phage	31.6	6.9e-12
WP_143600032.1|1013203_1015162_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_060901264.1|1015158_1015716_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 6
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	1157426	1230052	12022941	transposase	Saccharomonospora_phage(14.29%)	55	NA	NA
WP_144314757.1|1157426_1158620_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	33.4	1.3e-36
WP_164405923.1|1159262_1159418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314758.1|1159782_1162605_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_103550901.1|1162610_1163303_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	2.8e-36
WP_143600109.1|1163401_1164031_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097282842.1|1164233_1164683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164404832.1|1165354_1165528_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_143600111.1|1165535_1166144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657604.1|1167740_1168208_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_143656978.1|1168238_1168607_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144314760.1|1169512_1170706_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	72.7	1.4e-147
WP_144316416.1|1171136_1171982_-	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	26.3	8.3e-06
WP_144314761.1|1172116_1172572_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164657693.1|1172752_1173649_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_144314763.1|1173665_1175057_-	MFS transporter	NA	NA	NA	NA	NA
WP_144314764.1|1175094_1175706_-	LysE family transporter	NA	NA	NA	NA	NA
WP_143600116.1|1175772_1176681_+	ArgP/LysG family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_144314765.1|1176939_1179483_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_060900628.1|1179674_1180343_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_060900627.1|1180450_1180804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600119.1|1180895_1181108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314766.1|1183318_1184827_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_144314767.1|1184823_1185672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316417.1|1189557_1190154_+	DUF2461 family protein	NA	NA	NA	NA	NA
WP_144314768.1|1190676_1191675_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_144314769.1|1191816_1192767_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_144314770.1|1193342_1194236_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_144314771.1|1194489_1194873_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_144314772.1|1195022_1195886_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_144316418.1|1195974_1196751_+	DNA/RNA nuclease SfsA	NA	A0A127AYZ0	Bacillus_phage	39.8	1.1e-44
WP_144314773.1|1196922_1197792_+	DNA ligase	NA	NA	NA	NA	NA
WP_144314774.1|1201188_1201500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143605245.1|1201468_1202686_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144316419.1|1202862_1203495_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_164657605.1|1204083_1204296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314776.1|1204947_1206051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331582.1|1206115_1206571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314777.1|1206862_1207159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651962.1|1207535_1208954_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	1.5e-31
WP_164657606.1|1209768_1212099_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144314779.1|1212481_1212994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600189.1|1213353_1213965_+	DUF5317 family protein	NA	NA	NA	NA	NA
WP_164331587.1|1214626_1215208_+	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_144314780.1|1215337_1216351_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_143605178.1|1218058_1218253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164657607.1|1218818_1219226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314782.1|1219341_1219602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314783.1|1219705_1220425_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.5	6.2e-26
WP_144314784.1|1220491_1220881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314785.1|1222160_1222859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097283033.1|1223333_1224809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314786.1|1225562_1225946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316420.1|1226246_1227239_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164657604.1|1227918_1228386_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_164657608.1|1229497_1230052_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	1254026	1317178	12022941	transposase	Virus_Rctr71(20.0%)	53	NA	NA
WP_143605186.1|1254026_1255241_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	39.6	1.1e-62
WP_101913763.1|1255289_1255646_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.3	9.4e-36
WP_097283049.1|1255776_1256211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097283050.1|1256296_1256596_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143600215.1|1256915_1257716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600216.1|1257876_1259145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600217.1|1259955_1260489_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_143607117.1|1260685_1261615_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	37.8	4.8e-39
WP_143612536.1|1261726_1262605_+	DNA ligase	NA	NA	NA	NA	NA
WP_143600220.1|1262728_1263532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605188.1|1263913_1264657_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144316421.1|1268407_1269439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600221.1|1269690_1269930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600222.1|1270760_1271510_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.1	5.3e-12
WP_144314448.1|1271671_1273060_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_143600223.1|1273336_1275022_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143600224.1|1275143_1275779_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143600225.1|1275838_1276066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600226.1|1276191_1276635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143614202.1|1277173_1278007_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_164657609.1|1278332_1278884_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143607124.1|1279285_1279612_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_143614208.1|1279706_1280708_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_143614210.1|1280753_1281458_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_164331595.1|1281478_1282453_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_143600233.1|1282802_1283486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314793.1|1283513_1285079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600235.1|1285078_1285696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600236.1|1285692_1286571_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_143600237.1|1287072_1287759_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143600238.1|1288283_1288571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314794.1|1288866_1289778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314448.1|1289927_1291316_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_143600240.1|1292042_1292729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143607126.1|1292828_1293812_+	phosphotransferase	NA	NA	NA	NA	NA
WP_143600248.1|1294157_1294451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143614218.1|1294513_1297012_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_143614220.1|1297085_1297892_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143607128.1|1297888_1299136_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_143614222.1|1299132_1300278_-	glycine amidinotransferase	NA	H6SU86	Campylobacter_virus	24.6	5.6e-13
WP_143607130.1|1300298_1301276_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_143607131.1|1301272_1302664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657610.1|1302698_1303880_-	cytochrome P450	NA	NA	NA	NA	NA
WP_143607133.1|1304162_1305479_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_143600258.1|1305821_1306001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600259.1|1306313_1306916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600260.1|1307077_1307428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143611049.1|1310105_1311068_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143630318.1|1311401_1312877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143600262.1|1313100_1313352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314795.1|1314561_1314981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600153.1|1315038_1315566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600152.1|1315639_1317178_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	1331124	1384945	12022941	integrase,transposase	Streptococcus_phage(50.0%)	43	1330939:1330959	1373934:1373954
1330939:1330959	attL	GCCCTCGCCGGTCAGCTGCAG	NA	NA	NA	NA
WP_143612542.1|1331124_1332390_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144314797.1|1334191_1335619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314798.1|1336714_1337053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164657611.1|1337590_1338307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316422.1|1339084_1340404_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_144314800.1|1343537_1343981_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144314801.1|1344664_1344964_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	36.8	2.6e-07
WP_144314802.1|1344960_1345848_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.6	2.4e-32
WP_164657612.1|1346123_1346813_-	DUF4328 domain-containing protein	NA	NA	NA	NA	NA
WP_097282995.1|1347183_1347591_-	barstar family protein	NA	NA	NA	NA	NA
WP_144314804.1|1347597_1350321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314805.1|1350705_1350915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314448.1|1351082_1352471_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_144314806.1|1352612_1353545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314807.1|1353713_1354433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164657613.1|1354961_1357127_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060898071.1|1358209_1358416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316303.1|1358755_1359754_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_164657614.1|1360056_1360797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314810.1|1361031_1361673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314811.1|1361810_1362176_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164657615.1|1362178_1362913_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_144314813.1|1363144_1364119_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_144316424.1|1364518_1366144_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_143612493.1|1366552_1367272_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.0	1.5e-27
WP_075033438.1|1367823_1368912_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_164331566.1|1368968_1369109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314814.1|1369999_1371856_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_144316425.1|1371953_1372748_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_144314815.1|1372927_1373653_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144314816.1|1374716_1375115_-	hypothetical protein	NA	NA	NA	NA	NA
1373934:1373954	attR	CTGCAGCTGACCGGCGAGGGC	NA	NA	NA	NA
WP_164657569.1|1375670_1375847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331608.1|1376018_1376435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314818.1|1377405_1377954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657616.1|1377963_1378134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314819.1|1378432_1378864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314820.1|1379223_1380003_+	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_144314821.1|1380143_1381061_+	recombinase family protein	NA	NA	NA	NA	NA
WP_144314822.1|1381871_1382336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314823.1|1382328_1382916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314824.1|1382922_1383210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314825.1|1383350_1384208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314826.1|1384225_1384945_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	30.6	1.2e-26
>prophage 9
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	1464044	1511952	12022941	transposase	Burkholderia_phage(50.0%)	39	NA	NA
WP_143600338.1|1464044_1464545_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143600339.1|1464457_1464904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600340.1|1465480_1466071_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_143600341.1|1466418_1468644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651897.1|1468803_1470318_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.3	4.2e-08
WP_143605224.1|1470533_1471790_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.2	1.8e-36
WP_144314858.1|1472444_1473875_+	selenium-binding protein	NA	NA	NA	NA	NA
WP_144314859.1|1474068_1474836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331383.1|1474979_1475138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316430.1|1475184_1475442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143612555.1|1475546_1475735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143612556.1|1475740_1476316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600346.1|1476655_1477897_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_144314861.1|1478395_1478917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144316431.1|1479812_1480502_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	42.2	2.6e-26
WP_101408544.1|1482257_1482605_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_143600348.1|1484170_1484953_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_164331616.1|1484993_1485245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600350.1|1485509_1486367_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_143600351.1|1486363_1488409_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_143600352.1|1488524_1489199_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_143600353.1|1489229_1489925_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_143600354.1|1489921_1490776_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_143600355.1|1491868_1493911_-	recombinase family protein	NA	NA	NA	NA	NA
WP_164331618.1|1494050_1494305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651897.1|1494765_1496280_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.3	4.2e-08
WP_143600356.1|1496559_1496967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143615187.1|1497402_1498419_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_144314863.1|1498603_1500229_-	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_164657620.1|1500545_1502063_-	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_144314867.1|1502217_1503072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314869.1|1503182_1503575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314871.1|1503913_1504129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600363.1|1504612_1505245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600364.1|1506494_1507679_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_143600365.1|1507835_1507994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143600366.1|1508124_1508898_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_143605229.1|1508980_1510237_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_144314448.1|1510563_1511952_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	1591697	1648206	12022941	transposase,protease	Tupanvirus(22.22%)	43	NA	NA
WP_144314904.1|1591697_1592978_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	31.5	4.3e-38
WP_144314906.1|1593526_1594036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316433.1|1594283_1596314_-	PQQ-binding-like beta-propeller repeat protein	NA	M1PCM5	Moumouvirus	25.0	1.1e-08
WP_144314908.1|1596515_1597235_-	ribonuclease HI	NA	A0A2H5BH17	Vibrio_virus	42.6	5.2e-17
WP_143607193.1|1597215_1598271_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143600439.1|1598447_1599245_-	VOC family protein	NA	NA	NA	NA	NA
WP_144316434.1|1599399_1600416_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_143600442.1|1600480_1601707_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143607195.1|1601803_1602745_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_144314910.1|1602751_1603144_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144314912.1|1603204_1604734_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	36.2	3.2e-64
WP_097283191.1|1605103_1605499_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143607198.1|1605554_1606226_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144314914.1|1606192_1608199_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_143612561.1|1608195_1609923_-	dipeptide ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	21.9	2.5e-09
WP_143612562.1|1609922_1610816_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_144314915.1|1610812_1611769_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_144314917.1|1611772_1613356_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144314918.1|1613628_1613883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314919.1|1614733_1615432_+	MFS transporter	NA	NA	NA	NA	NA
WP_097288759.1|1616121_1617291_+	cytochrome P450	NA	NA	NA	NA	NA
WP_164404844.1|1617840_1619034_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143607205.1|1619453_1621787_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_097283223.1|1621797_1622274_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_143611064.1|1622882_1623302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097283224.1|1623175_1624438_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143600456.1|1624893_1625535_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_164657570.1|1625824_1626289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314921.1|1626653_1626929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314922.1|1627723_1627936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144314924.1|1627932_1628157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143599462.1|1628835_1629345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143605245.1|1630360_1631578_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144314925.1|1632768_1633209_-	VOC family protein	NA	NA	NA	NA	NA
WP_143606388.1|1634187_1635123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144314926.1|1636625_1637822_-	TIGR03118 family protein	NA	L7Y4N7	Megavirus	26.2	3.9e-25
WP_143614381.1|1638099_1639521_-	M1 family metallopeptidase	NA	A0A2K9L1R3	Tupanvirus	23.9	3.6e-17
WP_144314928.1|1639517_1643507_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.7	2.1e-35
WP_144314929.1|1644086_1644416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144314931.1|1644529_1645144_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144314933.1|1645475_1645958_-	VOC family protein	NA	NA	NA	NA	NA
WP_144314935.1|1646116_1647340_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_054233834.1|1647552_1648206_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.9	3.9e-35
>prophage 11
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	9508085	9563263	12022941	integrase,transposase,holin	Bacillus_virus(66.67%)	56	9510797:9510815	9558677:9558695
WP_164404949.1|9508085_9508469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143603631.1|9508630_9510586_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_143603633.1|9510582_9511074_-	hypothetical protein	NA	NA	NA	NA	NA
9510797:9510815	attL	ACCACGGCGGCCAGGGCGG	NA	NA	NA	NA
WP_143603634.1|9511070_9512282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657664.1|9512514_9513999_+	TniQ family protein	NA	NA	NA	NA	NA
WP_143603638.1|9513991_9514945_+	TniQ family protein	NA	NA	NA	NA	NA
WP_164404951.1|9514971_9516114_-	TniQ family protein	NA	NA	NA	NA	NA
WP_143603641.1|9516168_9517359_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_143603643.1|9517358_9519512_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_143605735.1|9519508_9520270_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_144316021.1|9520259_9521372_-	TniQ family protein	NA	NA	NA	NA	NA
WP_143603647.1|9521537_9522689_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060898511.1|9522685_9522985_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_144316022.1|9522974_9524450_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144316024.1|9524523_9525420_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_060897444.1|9525477_9526479_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_097287220.1|9526537_9527230_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097287221.1|9527314_9528292_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_054236067.1|9528450_9529800_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144316025.1|9529808_9530780_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054236069.1|9530776_9531658_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_054236070.1|9531688_9533281_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_144316026.1|9533339_9534146_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.2	1.6e-27
WP_144316027.1|9534166_9534946_-	ABC transporter permease subunit	NA	G3M9Y4	Bacillus_virus	21.6	3.9e-10
WP_144316028.1|9534942_9535716_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_144316029.1|9535712_9536684_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144316030.1|9536871_9537807_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_054236076.1|9537803_9537995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316031.1|9537991_9539056_-	Rieske 2Fe-2S domain-containing protein	NA	A0A076FFT9	Aureococcus_anophage	28.6	1.7e-08
WP_144316032.1|9539246_9540410_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060897459.1|9540360_9540687_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_143603669.1|9540769_9541177_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_143609991.1|9541660_9541933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143603673.1|9541995_9542436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143603676.1|9542432_9543434_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_097289356.1|9543430_9543727_-	amidase	NA	NA	NA	NA	NA
WP_143603678.1|9544553_9545156_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144316561.1|9545187_9545967_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_144316033.1|9547059_9547524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316034.1|9547599_9550452_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144316035.1|9550451_9550763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143603683.1|9550917_9551316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097287240.1|9551312_9552221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316036.1|9552426_9554478_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_054236090.1|9554530_9555388_+	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
WP_143603691.1|9555513_9556473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316037.1|9556469_9557369_-	inositol phosphorylceramide synthase	NA	NA	NA	NA	NA
WP_143629124.1|9557628_9558243_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143629126.1|9558591_9558789_+	hypothetical protein	NA	NA	NA	NA	NA
9558677:9558695	attR	CCGCCCTGGCCGCCGTGGT	NA	NA	NA	NA
WP_143629128.1|9558785_9559007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143629130.1|9559003_9559423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143629132.1|9559674_9559893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316038.1|9560241_9560517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314686.1|9560554_9561508_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_144316039.1|9561562_9561787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316040.1|9562078_9563263_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11293421	11352499	12022941	transposase,protease	Caulobacter_phage(33.33%)	51	NA	NA
WP_143606388.1|11293421_11294357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143630185.1|11294564_11295425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143652466.1|11295651_11296512_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143630187.1|11297363_11297828_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_143630189.1|11297826_11298483_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097282112.1|11298588_11299029_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143630191.1|11299347_11299665_-	DUF4387 family protein	NA	NA	NA	NA	NA
WP_143630193.1|11299667_11301029_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_143630194.1|11301059_11302376_-	MFS transporter	NA	NA	NA	NA	NA
WP_143630196.1|11302471_11303188_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143630198.1|11303304_11304732_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_143604708.1|11304728_11305430_-	response regulator	NA	W8CYM9	Bacillus_phage	34.1	1.8e-30
WP_144316268.1|11305426_11307652_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_143630202.1|11308893_11309175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054236208.1|11309675_11310140_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604719.1|11310448_11311900_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143604720.1|11312811_11313213_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_143630204.1|11313535_11314849_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	35.6	4.0e-47
WP_143652468.1|11315083_11316067_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143630206.1|11316137_11316728_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_143630208.1|11317607_11318264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630210.1|11318460_11318841_+	Tellurite resistance TerB	NA	NA	NA	NA	NA
WP_143604725.1|11318976_11319909_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_143604726.1|11319916_11320306_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_060894503.1|11321008_11321584_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	5.4e-33
WP_143604727.1|11321693_11322314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604728.1|11322355_11322937_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	28.6	4.0e-07
WP_097282100.1|11322972_11323239_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_143604729.1|11323508_11323871_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_164657678.1|11324012_11324201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630212.1|11324636_11325068_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_143604731.1|11325223_11325799_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	43.8	9.9e-35
WP_079089155.1|11326605_11326830_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
WP_143630214.1|11326991_11327921_+	ion transporter	NA	NA	NA	NA	NA
WP_143604732.1|11328745_11330173_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_143604733.1|11330295_11331201_+	heavy metal transporter	NA	A0A223FZV2	Streptomyces_phage	50.4	3.3e-24
WP_143611788.1|11332680_11334336_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_143630215.1|11336852_11337488_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_143630217.1|11337484_11338267_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_143630219.1|11338307_11339060_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_143630221.1|11339056_11340031_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_143630223.1|11340119_11341094_-	oxidoreductase	NA	NA	NA	NA	NA
WP_143630225.1|11341111_11342128_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_144316269.1|11342124_11343294_-	2-polyprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
WP_143630229.1|11343414_11344395_-	cyclase family protein	NA	NA	NA	NA	NA
WP_143604741.1|11344391_11345390_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_144316270.1|11345525_11346470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604743.1|11346582_11347866_+	MFS transporter	NA	NA	NA	NA	NA
WP_097282087.1|11348971_11349988_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_164331899.1|11350542_11351409_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_143652469.1|11351608_11352499_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11361987	11419809	12022941	transposase,holin	Klosneuvirus(33.33%)	44	NA	NA
WP_143630233.1|11361987_11363613_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	28.4	9.0e-49
WP_143630235.1|11364040_11364589_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_060894546.1|11365308_11365560_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_164331977.1|11365556_11365934_+	toxin Doc	NA	NA	NA	NA	NA
WP_143630239.1|11366294_11366747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331901.1|11366743_11366908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630241.1|11366853_11367477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060894525.1|11367677_11368634_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143630243.1|11368744_11369743_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_143604755.1|11370545_11372111_-	MFS transporter	NA	NA	NA	NA	NA
WP_143630245.1|11372168_11373521_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_143611713.1|11373685_11374546_-	PaaX family transcriptional regulator	NA	NA	NA	NA	NA
WP_060894529.1|11375892_11376552_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_164331418.1|11376656_11377499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630261.1|11379231_11380470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143614479.1|11380466_11381588_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143605245.1|11381800_11383018_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143630259.1|11383353_11383725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143610795.1|11383636_11384623_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_164331902.1|11387268_11387460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054236231.1|11387636_11387864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630255.1|11388847_11389207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630253.1|11389487_11389880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604765.1|11390050_11391196_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_097282063.1|11391535_11392093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604769.1|11395861_11396233_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143630252.1|11397468_11397807_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_143630250.1|11397832_11399440_-	carboxylesterase family protein	NA	S4VZJ7	Pandoravirus	32.0	9.2e-38
WP_143610806.1|11399455_11400091_-	GPP34 family phosphoprotein	NA	NA	NA	NA	NA
WP_143630248.1|11400204_11400864_-	response regulator	NA	NA	NA	NA	NA
WP_143652471.1|11400860_11401925_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_143612551.1|11402350_11403571_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143630266.1|11406534_11407170_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_144316272.1|11407169_11407676_-	ATPase	NA	NA	NA	NA	NA
WP_075033765.1|11407679_11408021_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143630270.1|11408280_11409960_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_143604779.1|11410140_11410530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604780.1|11410690_11411068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316273.1|11411784_11412654_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_143604782.1|11412837_11413323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630272.1|11413651_11414563_+	hydrolase	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	36.8	1.1e-06
WP_097282033.1|11416132_11416402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630274.1|11416481_11418542_+	mannosyltransferase	NA	NA	NA	NA	NA
WP_143630276.1|11418795_11419809_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11463308	11510182	12022941	transposase	Klosneuvirus(33.33%)	40	NA	NA
WP_143630315.1|11463308_11464148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143630318.1|11464473_11465949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143604809.1|11466185_11466632_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143630319.1|11466869_11467481_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143652485.1|11470291_11471797_+	NAD(P)-binding protein	NA	A0A1V0SI18	Klosneuvirus	33.6	2.7e-55
WP_143610846.1|11471998_11472679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143630322.1|11472711_11473224_+	DUF3291 domain-containing protein	NA	NA	NA	NA	NA
WP_143630324.1|11473257_11473731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630326.1|11474064_11474568_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164331906.1|11475605_11475881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630328.1|11476059_11476596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316274.1|11477671_11478400_-	DUF2625 family protein	NA	NA	NA	NA	NA
WP_143611722.1|11479020_11479530_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_143614779.1|11482849_11483491_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143604719.1|11484109_11485561_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143652487.1|11485839_11486826_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143630332.1|11487328_11487985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331907.1|11488164_11488338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143610854.1|11488311_11488620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630334.1|11488888_11489227_-	thioredoxin	NA	NA	NA	NA	NA
WP_143610855.1|11489442_11490027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630336.1|11490396_11492103_+	MFS transporter	NA	NA	NA	NA	NA
WP_143630339.1|11492450_11492771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630341.1|11492854_11494177_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	24.9	5.8e-30
WP_143630343.1|11494560_11494989_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_164331420.1|11495980_11496232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630345.1|11496733_11497330_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144316275.1|11497371_11498190_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_143630348.1|11498329_11499235_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143630350.1|11499506_11500235_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143630352.1|11500346_11501480_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_143630354.1|11502913_11503165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630356.1|11503358_11504567_+	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	2.0e-05
WP_143630358.1|11504639_11506148_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_143630360.1|11506219_11506762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316276.1|11506991_11507399_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_143630362.1|11507467_11508430_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_143604836.1|11508628_11509312_-	adenylate kinase	NA	NA	NA	NA	NA
WP_164331908.1|11509324_11509489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331909.1|11509627_11510182_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11519035	11585696	12022941	transposase	Corynebacterium_phage(11.11%)	52	NA	NA
WP_143652488.1|11519035_11519932_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143604719.1|11520108_11521560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143605855.1|11522536_11523463_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143630364.1|11523585_11524824_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.9	8.0e-82
WP_143630366.1|11524980_11525472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143652490.1|11526152_11526410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143630369.1|11526914_11528447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630371.1|11528786_11529242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604849.1|11531001_11532183_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_143604850.1|11532243_11532930_-	response regulator	NA	NA	NA	NA	NA
WP_143604851.1|11532926_11534117_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_144316277.1|11535566_11535800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604948.1|11535845_11537303_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	33.3	4.4e-39
WP_143604947.1|11537299_11537875_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	36.8	6.6e-23
WP_144316278.1|11537908_11538178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604852.1|11538380_11538914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657679.1|11539046_11540714_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	34.7	3.0e-47
WP_143604854.1|11540712_11541699_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_143630373.1|11541777_11542497_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	34.0	8.6e-28
WP_143630375.1|11542705_11542990_-	hypothetical protein	NA	A0A160DCQ1	Gordonia_phage	50.7	1.1e-10
WP_143604857.1|11543387_11544122_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_143630377.1|11544427_11545537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143604859.1|11545592_11545841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604860.1|11546231_11547206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604861.1|11547266_11547938_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164331979.1|11548065_11548401_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_164331422.1|11548303_11548630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143630379.1|11548677_11549511_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164331911.1|11549743_11550415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605857.1|11551596_11553192_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.6	3.1e-17
WP_143604865.1|11553188_11553962_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.4	2.0e-30
WP_143604866.1|11553996_11554533_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143630381.1|11554964_11556467_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_164331912.1|11557197_11557335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331913.1|11557331_11557487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164657680.1|11558150_11558702_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143651764.1|11558728_11559973_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_143651765.1|11560327_11560879_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143604871.1|11561579_11562347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331915.1|11564566_11565418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651769.1|11565738_11566458_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_144316281.1|11567236_11567926_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143653967.1|11571541_11572591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316282.1|11573195_11574725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054231735.1|11575120_11575933_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_144078806.1|11575948_11576311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316283.1|11576371_11578561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316284.1|11579761_11580583_-	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_144316285.1|11581129_11581324_+	acyl-CoA carboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_144316581.1|11581567_11583100_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_143604882.1|11583428_11584253_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604883.1|11584502_11585696_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.2	3.2e-144
>prophage 16
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11621284	11656853	12022941	transposase	Saccharomonospora_phage(28.57%)	30	NA	NA
WP_144316582.1|11621284_11622478_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	33.4	4.4e-37
WP_144316287.1|11622631_11623246_+	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	H9NC63	Sphingomonas_phage	38.4	6.0e-14
WP_143604900.1|11623278_11623725_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_143604901.1|11624113_11624536_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	64.7	8.5e-44
WP_143604902.1|11624587_11625787_+|transposase	transposase	transposase	A0A220NS37	Mycobacterium_phage	31.8	1.4e-30
WP_164657681.1|11625819_11626338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604903.1|11626518_11627850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604904.1|11628747_11629290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316288.1|11629387_11630572_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144316289.1|11632082_11632556_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060899423.1|11632685_11633678_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.9	6.0e-72
WP_054230033.1|11633912_11634980_-	glucose-1-phosphate thymidylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	40.0	2.5e-39
WP_067383410.1|11635146_11635569_+	ester cyclase	NA	NA	NA	NA	NA
WP_143604906.1|11635705_11636695_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_060900329.1|11637050_11638451_-	NDP-hexose 2,3-dehydratase	NA	NA	NA	NA	NA
WP_143604907.1|11638645_11639830_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_143614821.1|11640460_11640706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604909.1|11641356_11642019_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_097281925.1|11642710_11643331_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_144316290.1|11643427_11645317_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_075032155.1|11645370_11645865_+	DoxX family protein	NA	NA	NA	NA	NA
WP_143605862.1|11645991_11646438_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143604912.1|11646900_11647824_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_143605863.1|11647883_11648249_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604913.1|11649314_11650541_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143604914.1|11651524_11653138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604915.1|11653310_11653916_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604916.1|11653985_11654447_-	DUF2871 family protein	NA	NA	NA	NA	NA
WP_159055364.1|11654655_11654793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604917.1|11655695_11656853_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	45.3	1.4e-67
>prophage 17
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11670385	11715946	12022941	transposase	Saccharomonospora_phage(16.67%)	45	NA	NA
WP_143652497.1|11670385_11671633_+|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	52.3	7.8e-77
WP_143651803.1|11671524_11672046_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143651804.1|11672356_11674948_-	SpoIIE family protein phosphatase	NA	A0A1J0MCT1	Streptomyces_phage	44.4	1.0e-09
WP_143651805.1|11675256_11675487_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143652498.1|11675674_11676421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143606309.1|11676423_11676900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651806.1|11677432_11678689_+	serine hydrolase	NA	A0A0Y0A2S9	Mycobacterium_phage	30.9	1.7e-42
WP_143651807.1|11678824_11680705_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_143608937.1|11680953_11682156_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143651808.1|11682432_11683092_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.1	6.5e-06
WP_143651809.1|11683088_11684273_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_143651810.1|11684485_11685082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651811.1|11685474_11686011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143652500.1|11686020_11686833_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_143652502.1|11687218_11688601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651812.1|11688708_11689182_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_143651813.1|11689363_11690287_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_143651814.1|11690438_11691173_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_143651815.1|11691818_11692355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651816.1|11692893_11693469_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_054229772.1|11693614_11693785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651817.1|11694128_11694797_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_143651818.1|11694870_11695140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651819.1|11695136_11695736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143653922.1|11696095_11696278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604941.1|11696448_11697117_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_143651820.1|11697337_11699398_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143651821.1|11699687_11700077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604944.1|11700258_11701197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097287833.1|11701954_11702446_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_143604945.1|11702778_11703750_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_143604946.1|11703829_11704564_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_143652504.1|11704594_11705179_+	winged helix DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143604947.1|11705183_11705759_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	36.8	6.6e-23
WP_143604948.1|11705755_11707213_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	33.3	4.4e-39
WP_097281887.1|11707758_11708121_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144316292.1|11708117_11709551_+	MFS transporter	NA	NA	NA	NA	NA
WP_143604950.1|11709584_11709878_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_060895859.1|11710123_11711710_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_143672189.1|11711995_11712145_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144316293.1|11712132_11712429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316294.1|11713859_11714486_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_143604953.1|11714525_11714771_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143604954.1|11714819_11715422_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143604955.1|11715391_11715946_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11750821	11792604	12022941	transposase	Shigella_phage(25.0%)	41	NA	NA
WP_143604976.1|11750821_11751109_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164331921.1|11751111_11751843_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.2	1.6e-18
WP_143651962.1|11751793_11753212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	1.5e-31
WP_143651830.1|11753195_11753516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143604977.1|11753583_11754378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604978.1|11755055_11756045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605872.1|11756056_11756452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604979.1|11757367_11758135_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	2.7e-19
WP_143604980.1|11758953_11759229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316584.1|11759275_11759533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600344.1|11759636_11759825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600345.1|11759830_11760406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143600346.1|11760745_11761987_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_164331980.1|11762515_11762971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164331922.1|11762936_11763332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331923.1|11763740_11763905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604982.1|11764498_11764693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143605873.1|11764901_11766125_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_143604983.1|11767864_11768773_-	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	24.9	1.7e-12
WP_143651831.1|11769701_11770670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604984.1|11770635_11771094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604985.1|11771443_11771866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143604986.1|11772541_11773888_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604987.1|11774069_11774564_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_143604988.1|11774600_11775815_+	oxidoreductase	NA	NA	NA	NA	NA
WP_143604989.1|11776075_11777173_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_143604990.1|11777205_11778168_+	6-chlorohydroxyquinol-1,2-dioxygenase	NA	NA	NA	NA	NA
WP_143604991.1|11779204_11780086_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143604992.1|11780156_11781353_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_143604993.1|11781349_11782045_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_143604994.1|11782041_11782734_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_144316295.1|11782935_11783244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164657683.1|11783240_11783675_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	32.9	3.6e-13
WP_144316585.1|11783702_11783969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143651962.1|11783919_11785338_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	1.5e-31
WP_144316297.1|11785318_11785639_+|transposase	transposase	transposase	U5P429	Shigella_phage	38.5	8.5e-12
WP_143604995.1|11785936_11787412_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_143604996.1|11787862_11789122_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_143604997.1|11789256_11790204_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_164331924.1|11790664_11791153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143604998.1|11791356_11792604_+|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	53.5	5.2e-81
>prophage 19
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11812313	11845967	12022941	transposase	Bacillus_virus(20.0%)	37	NA	NA
WP_143605013.1|11812313_11813945_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_143605875.1|11814016_11814661_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_143605014.1|11814826_11815072_+	DUF1275 family protein	NA	NA	NA	NA	NA
WP_143605876.1|11815475_11815922_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143605015.1|11816509_11817802_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_143605016.1|11817992_11818670_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143605017.1|11818948_11819494_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_143605018.1|11820071_11821061_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143605019.1|11821068_11822001_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_164331927.1|11821997_11822858_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143605877.1|11822884_11823709_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	1.1e-29
WP_143605021.1|11823715_11824813_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143605022.1|11824861_11825428_+	YceI family protein	NA	NA	NA	NA	NA
WP_143605023.1|11825448_11826255_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_143605024.1|11826272_11826593_+	Dabb family protein	NA	NA	NA	NA	NA
WP_143605025.1|11826589_11827096_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_143605026.1|11827383_11827803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605027.1|11827846_11828467_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164331424.1|11828579_11828768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605028.1|11828887_11829592_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143605029.1|11829711_11830134_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_144316298.1|11830414_11830804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164331928.1|11830977_11831130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143652508.1|11831562_11832282_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_143605031.1|11832411_11832957_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143605032.1|11833298_11833751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143605033.1|11833869_11834286_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_143605034.1|11835278_11835707_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	62.1	1.4e-41
WP_143605035.1|11835730_11836888_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	43.9	3.1e-72
WP_143605036.1|11837092_11837245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143605037.1|11837254_11837773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143651897.1|11837907_11839422_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.3	4.2e-08
WP_143605038.1|11839832_11841377_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_143605039.1|11841384_11842176_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_164331929.1|11842463_11843165_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_143605041.1|11843257_11843797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164331426.1|11845175_11845967_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	55.6	2.8e-72
>prophage 20
NZ_CP041610	Streptomyces sp. RLB3-17 chromosome, complete genome	12022941	11922033	12000916	12022941	integrase,transposase	Streptomyces_phage(25.0%)	54	11918164:11918183	11991325:11991344
11918164:11918183	attL	CGCGCTGGCCGGGGCGGGCG	NA	NA	NA	NA
WP_164657685.1|11922033_11922300_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144316323.1|11923082_11924888_+	DUF4357 domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	31.6	6.1e-22
WP_144316324.1|11924884_11926096_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_144316589.1|11926245_11926968_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_144316325.1|11927215_11929252_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.1e-10
WP_144316326.1|11929708_11930785_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1J0MC50	Streptomyces_phage	36.3	3.8e-48
WP_144316327.1|11930823_11931771_-	ATP-grasp ribosomal peptide maturase	NA	S5VKI3	Leptospira_phage	27.3	2.9e-23
WP_144316328.1|11931767_11932061_-	putative ATP-grasp-modified RiPP	NA	NA	NA	NA	NA
WP_144316590.1|11932636_11933926_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_164657700.1|11934030_11935545_-	amino acid permease	NA	NA	NA	NA	NA
WP_144316330.1|11935622_11936609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316331.1|11937040_11937664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316332.1|11938626_11939856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144316333.1|11939836_11940499_-	HAD-IA family hydrolase	NA	Q6VY93	Streptomyces_phage	52.2	3.1e-48
WP_144316334.1|11942632_11946040_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144316335.1|11946048_11946501_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_095857370.1|11946500_11946929_-	lipase chaperone	NA	NA	NA	NA	NA
WP_144316336.1|11947114_11948200_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143612431.1|11948204_11948519_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143612429.1|11948515_11950264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316591.1|11950331_11950691_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_060898280.1|11950806_11950995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316337.1|11951022_11951916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316338.1|11951912_11952830_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_164657701.1|11952826_11954341_-	CpaF family protein	NA	NA	NA	NA	NA
WP_144316340.1|11954384_11955257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316341.1|11955259_11955952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316592.1|11955998_11956439_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_144316342.1|11956924_11957515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316343.1|11958262_11959177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316344.1|11959173_11961798_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_144316593.1|11961773_11962121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316594.1|11962417_11963521_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_144316346.1|11966385_11966742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316347.1|11966738_11969423_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_144316348.1|11969419_11969959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316349.1|11969979_11970321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316350.1|11970317_11971253_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_144316351.1|11971961_11973386_+	hypothetical protein	NA	Q8SDH3	Lactococcus_phage	40.7	4.5e-12
WP_144316595.1|11974324_11974870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316352.1|11975361_11976267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316353.1|11976376_11976730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144316354.1|11977610_11978189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316355.1|11979042_11980455_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_144316356.1|11980451_11982251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316357.1|11982247_11984416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316358.1|11985546_11985759_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	53.2	5.6e-12
WP_164657686.1|11986035_11986602_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	57.1	9.4e-22
WP_144316360.1|11986936_11989870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316596.1|11990704_11992165_+	hypothetical protein	NA	NA	NA	NA	NA
11991325:11991344	attR	CGCGCTGGCCGGGGCGGGCG	NA	NA	NA	NA
WP_144316597.1|11995411_11995654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316361.1|11995679_11996990_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_144314455.1|11999134_11999467_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_144316376.1|11999677_12000916_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
