The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	25261	182059	4569995	tRNA,transposase,protease,integrase	Stx2-converting_phage(13.51%)	122	99664:99723	164847:165184
WP_012421555.1|25261_26458_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000994987.1|26452_27814_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000177217.1|27810_29289_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000989403.1|29285_30320_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_039080550.1|30316_31537_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.2e-27
WP_000673918.1|31982_32789_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000977145.1|35139_35847_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000524080.1|35846_36395_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001215374.1|36404_37571_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001299561.1|39077_39731_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
WP_000832679.1|39797_41084_+	thiosulfate sulfurtransferase YnjE	NA	NA	NA	NA	NA
WP_000085238.1|43330_43603_-	YnjH family protein	NA	NA	NA	NA	NA
WP_000373055.1|43838_45182_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_001235817.1|47241_49203_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	5.4e-40
WP_012421473.1|49207_50251_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_000339281.1|50367_50919_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001259824.1|51079_52936_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_001170149.1|53102_54119_+	asparaginase	NA	NA	NA	NA	NA
WP_001120535.1|54129_54771_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_001046790.1|54931_55204_-	YeaC family protein	NA	NA	NA	NA	NA
WP_001284613.1|55245_55659_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000153502.1|56000_56996_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000483770.1|57103_58450_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_004983283.1|58517_59402_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_039059368.1|59452_60307_-	methylglyoxal reductase YeaE	NA	A0A2H4PQR8	Staphylococcus_phage	32.0	2.9e-22
WP_000163771.1|60396_61143_-	scaffolding protein MipA	NA	NA	NA	NA	NA
WP_000219706.1|63624_64908_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616430.1|65054_66530_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_094096769.1|67642_68798_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_094096770.1|69461_70616_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.7e-65
WP_000138054.1|70775_71279_+|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000999630.1|71279_71384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460714.1|71552_71999_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_012421563.1|72873_74070_+	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_004983281.1|74109_74457_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000691934.1|74478_74733_-	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_032324829.1|75633_75735_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|75737_75812_+	protein YoaJ	NA	NA	NA	NA	NA
WP_000512153.1|75870_76119_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000513737.1|76266_76449_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_165850231.1|76985_77405_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_072038802.1|78430_79777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000978513.1|80991_82077_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000067827.1|84745_85870_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287030.1|85925_86891_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_024258613.1|86944_88060_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|88141_89827_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290574.1|90031_90613_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220988.1|90652_91348_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128854.1|91405_93316_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|93447_93792_+	RidA family protein	NA	NA	NA	NA	NA
WP_114142302.1|94153_94228_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|95031_95211_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855021.1|95284_96646_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	5.8e-41
WP_000456725.1|96649_97228_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624286.1|97411_98776_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
99664:99723	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
WP_134796785.1|99727_100883_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.4e-66
WP_001063816.1|102041_103169_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000150543.1|105307_106279_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|106341_107142_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|107154_108006_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156249.1|108060_108519_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|108946_109513_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010115.1|109509_110319_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|110484_110694_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|110706_110850_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006860.1|112068_112356_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|112430_112574_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211009.1|112732_112972_+	membrane protein	NA	NA	NA	NA	NA
WP_001262182.1|113114_113906_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127216.1|114082_115456_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|115501_116383_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|116574_118623_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|118642_119341_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|119437_119935_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_012421330.1|120064_121348_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_024258614.1|121316_123950_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024258615.1|124029_125469_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_012421427.1|125586_125823_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457842.1|125927_126119_+	YebW family protein	NA	NA	NA	NA	NA
WP_001333468.1|127018_127399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|127395_127743_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_134796786.1|127791_129330_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	1.3e-294
WP_001039895.1|129451_129631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077128820.1|129631_131347_-	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_134797173.1|133101_134258_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.4e-66
WP_071821702.1|134380_134851_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.3	6.6e-37
WP_000976477.1|135243_135585_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879299.1|135597_136470_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|136473_136848_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916761.1|136986_137217_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	2.9e-14
WP_000011658.1|137318_137975_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944259.1|137998_138661_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000073510.1|140933_141593_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|141906_142263_-	protein YebF	NA	NA	NA	NA	NA
WP_000173486.1|142679_143858_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|143913_144555_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_039080552.1|144591_146403_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|146637_148113_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_000091148.1|149445_150888_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_088895425.1|151023_152252_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_052270405.1|152327_153125_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_039059824.1|154065_154863_-	amidohydrolase	NA	NA	NA	NA	NA
WP_077897107.1|159089_160358_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000777724.1|160381_161614_-	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000490384.1|162941_163898_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_001307257.1|164012_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435428.1|165270_165690_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	4.2e-35
164847:165184	attR	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAAACCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCCCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTG	NA	NA	NA	NA
WP_000624671.1|165686_166037_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001063816.1|167951_169079_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000142784.1|170140_170275_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	93.2	3.1e-16
WP_000935508.1|173173_174223_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.6	4.0e-183
WP_001204806.1|174786_175167_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_012421411.1|175184_176174_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.1e-193
WP_001061420.1|176181_176991_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.3e-149
WP_000767117.1|177010_177400_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000066914.1|177396_178050_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	1.2e-126
WP_000055009.1|178049_178538_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	98.1	1.2e-86
WP_039059392.1|178534_179359_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_039059393.1|179355_179580_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	2.2e-38
WP_094096507.1|179705_180874_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000019619.1|181315_182059_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 2
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	347542	427606	4569995	tRNA,transposase,protease	Stx2-converting_phage(35.71%)	59	NA	NA
WP_000003667.1|347542_348130_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186431.1|348126_348834_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107366.1|348852_350646_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|350642_351761_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375138.1|352481_353141_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000904442.1|353231_353561_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_039059410.1|353557_353836_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116324.1|353930_355121_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|355178_355496_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|355540_355954_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|356126_356789_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|356884_357343_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420537.1|357374_359429_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_001261235.1|359551_359998_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_073692788.1|360007_362170_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000288710.1|363757_364267_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|364623_365664_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877160.1|365739_366192_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156488.1|366377_368138_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|368206_368725_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001333468.1|368956_369337_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|369333_369681_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099170.1|369729_371268_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000759124.1|371403_371967_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445544.1|371963_373604_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333187.1|373608_374862_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053095.1|374991_376899_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	4.1e-53
WP_001086505.1|376910_379019_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224267.1|379262_380372_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|380368_380911_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|381084_382095_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_165850217.1|382205_382943_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|382908_383424_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|383431_383974_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165655.1|383985_385056_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000750284.1|388461_389004_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|389359_389935_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244336.1|389927_390887_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000193834.1|393621_396234_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001323688.1|396499_397702_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|397870_399271_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|399871_400960_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_001109490.1|402555_403203_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|403229_403778_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925987.1|403958_405806_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000624671.1|409534_409885_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_134797176.1|409881_410301_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	76.3	5.5e-35
WP_039059439.1|410792_415253_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|415252_415957_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288841.1|415937_417260_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|417256_418042_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899574.1|418177_418957_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|418933_419827_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011601.1|419980_420727_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|420723_420906_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056557.1|420957_422190_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570560.1|422226_423213_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|423209_424958_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000099170.1|426067_427606_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
>prophage 3
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	450650	512319	4569995	tRNA,tail,protease	Salmonella_phage(26.92%)	54	NA	NA
WP_000886694.1|450650_451943_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.9	1.9e-94
WP_000067758.1|452033_453377_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	9.6e-81
WP_001295343.1|453387_453999_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073692823.1|454153_458125_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|458259_458754_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537414.1|459298_460264_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_039059444.1|460386_462153_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	28.3	2.1e-14
WP_039059446.1|462153_463875_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.5	1.9e-20
WP_001241678.1|463916_464621_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|464905_465124_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_039059447.1|465808_468085_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.5e-166
WP_000520781.1|468115_468436_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|468758_468983_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188179.1|469055_471002_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|470998_472114_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_133298188.1|472264_473221_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_004982384.1|476077_476773_+	aquaporin Z	NA	NA	NA	NA	NA
WP_012421264.1|477265_478165_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458822.1|478308_479961_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|479972_480941_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|481073_482792_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566354.1|482828_483830_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|483840_485271_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005135189.1|485369_486383_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|486379_487210_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|487206_487530_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270744.1|487655_488171_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|488388_489117_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|489134_489866_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001705.1|489872_490589_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|490588_491257_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_012421270.1|491547_492279_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039059452.1|492453_493581_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	3.3e-26
WP_039080563.1|493621_494110_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|494169_495015_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093857.1|495011_495965_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995992.1|495974_497108_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126072.1|497202_498315_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|498665_499142_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684324.1|499229_500132_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189127.1|500192_500915_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|500898_501186_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195237.1|501345_501603_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	60.7	7.3e-22
WP_000681108.1|501632_502010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|502279_503965_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|504199_504418_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011770.1|504508_505609_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
WP_000980403.1|505605_506091_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.9	1.3e-67
WP_039059457.1|506087_509165_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.7	0.0e+00
WP_000763310.1|509157_509277_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.4e-12
WP_001281016.1|509291_509594_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001207660.1|509648_510164_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046139.1|510173_511346_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_071821609.1|512166_512319_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	3.2e-09
>prophage 4
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	557571	652254	4569995	tail,transposase	Stx2-converting_phage(26.67%)	77	NA	NA
WP_000140459.1|557571_558768_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001267226.1|558844_561007_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|561066_561993_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|562268_562529_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_039059461.1|562793_565076_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990184.1|565117_565795_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	9.0e-19
WP_000146357.1|565868_566135_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_039059463.1|566418_566649_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_039059465.1|568102_569065_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_012421244.1|569092_571243_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	5.3e-41
WP_001145132.1|571362_571845_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_000007125.1|572076_573441_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	9.5e-52
WP_001447036.1|573669_574341_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_005007432.1|574343_575339_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996087.1|575331_577068_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070142.1|577060_578194_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|578204_579311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|579272_579683_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113368.1|579815_580577_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650368.1|580573_581815_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045445.1|581814_582771_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446934.1|582806_583520_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|583725_584430_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852279.1|584566_585019_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|585020_585266_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|585258_585744_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|585746_586259_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_012421596.1|586280_587270_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|587666_588575_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|588766_590788_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044861.1|591366_592044_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246800.1|592036_592792_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118842.1|592778_593933_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951205.1|593929_594970_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_012421521.1|595056_596346_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767390.1|596404_596881_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001091569.1|597032_598316_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000444995.1|598456_600718_-	hydratase	NA	NA	NA	NA	NA
WP_000723642.1|603958_605011_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_000679972.1|605194_606148_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000815426.1|606188_607184_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_071821614.1|607463_607574_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	87.5	3.3e-08
WP_024258629.1|608063_609890_+	invasion protein	NA	NA	NA	NA	NA
WP_001039895.1|609890_610070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039059474.1|610643_612050_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	44.2	1.5e-39
WP_048815086.1|612036_612525_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	69.9	1.7e-59
WP_088895425.1|612671_613899_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_077897128.1|613920_614100_-	IS1 encoded protein	NA	A0A0C4UQV0	Shigella_phage	66.7	2.4e-16
WP_094096507.1|614154_615322_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_134796794.1|615606_616749_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.5	4.0e-213
WP_000099170.1|616745_618284_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|618332_618680_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|618676_619057_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000087844.1|619145_619238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094096507.1|619725_620894_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_001281242.1|621085_623713_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|623859_624582_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_171767843.1|624709_625003_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_171767844.1|624924_625221_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_158252635.1|625236_627228_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_158252634.1|627270_627642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075163.1|629231_631517_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|631663_632794_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|632793_633048_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000099170.1|633851_635390_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|635438_635786_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|635782_636163_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000779090.1|636663_637740_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000948732.1|637744_639103_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000857257.1|639375_641004_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_001209906.1|640993_642253_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_001000359.1|642249_643440_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_000140570.1|643632_644535_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000169731.1|647703_648594_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_000844032.1|648593_650246_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_000638031.1|650242_650578_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
WP_000099170.1|650715_652254_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
>prophage 5
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	726172	804185	4569995	tRNA,transposase	Stx2-converting_phage(30.77%)	60	NA	NA
WP_000099170.1|726172_727711_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|727759_728107_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_134796773.1|728103_728319_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBP6	Stx2-converting_phage	88.2	2.0e-25
WP_144039317.1|728261_728483_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.1	2.1e-33
WP_000714140.1|728824_729313_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|729309_729819_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482746.1|729834_730587_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_073714335.1|730606_733249_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000213920.1|733330_733627_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000033325.1|733633_733894_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|734568_735054_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000531950.1|737399_738710_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|738889_739174_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005007635.1|739545_740886_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_012421268.1|741350_742547_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000340709.1|744323_744536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|744717_745473_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368136.1|745766_746699_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	1.4e-166
WP_094096507.1|747255_748424_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_012421614.1|749846_751385_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_012421564.1|751384_752548_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|752963_753578_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_072037222.1|753582_757176_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	2.3e-36
WP_012421539.1|757231_758377_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|758450_759395_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283486.1|759464_761159_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.8e-23
WP_000106760.1|761212_762463_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_000825604.1|762975_763608_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867637.1|763903_764179_+	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000639883.1|764255_764498_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484403.1|764850_765771_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.4	1.8e-75
WP_010723117.1|766126_766198_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785913.1|766262_767501_-	alanine transaminase	NA	NA	NA	NA	NA
WP_000544369.1|767877_769575_+	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_001295458.1|769589_770324_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000646846.1|770336_771194_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000173247.1|774759_775845_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985336.1|775859_777107_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000038456.1|777128_777455_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000598932.1|777673_778639_-	glucokinase	NA	NA	NA	NA	NA
WP_000903152.1|778842_780099_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490072.1|780213_780540_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000186369.1|780680_781919_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000376337.1|782254_783457_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000483770.1|783503_784850_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_012421648.1|789012_789357_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001341599.1|789379_789751_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000695657.1|789801_791217_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000201413.1|791993_792335_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_001109794.1|792325_793252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000765617.1|793341_794340_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_000410201.1|794336_794555_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_039059483.1|794556_796572_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
WP_005030504.1|796641_797628_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|797857_798619_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|798803_799775_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|800158_800416_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623148.1|800460_802188_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522245.1|802228_802738_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000483770.1|802838_804185_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	926054	987123	4569995	tRNA,transposase	Stx2-converting_phage(33.33%)	56	NA	NA
WP_000940019.1|926054_926795_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553446.1|926913_927717_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_012421377.1|927861_928716_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983001.1|928906_930202_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244213.1|930193_931333_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_039059495.1|932710_933838_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|933901_935155_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883127.1|935482_936673_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|936717_937056_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|937116_938451_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|938440_939154_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298980.1|939318_940746_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970129.1|941303_945191_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_039059496.1|945447_947004_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001295367.1|947000_947537_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|947561_948197_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|948405_949254_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196283.1|949309_949570_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_000128776.1|949763_949844_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|950263_950644_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001364795.1|950643_951375_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399399.1|951386_952115_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|952126_953032_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|953028_953709_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_039059497.1|953981_954956_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|954971_956771_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|956968_957448_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812031.1|957444_958401_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|958400_959051_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_012421474.1|959083_959659_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|959655_959811_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_073714307.1|960066_960630_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088895425.1|960705_961933_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_094096479.1|961980_963137_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_005007860.1|964276_965014_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219197.1|965145_966480_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_088895425.1|967078_968306_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000099170.1|968536_970075_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|970123_970471_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|970467_970848_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001300818.1|971322_971646_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949271.1|971691_973047_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083004.1|973160_975821_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_012421387.1|975852_976551_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|976619_977039_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_039059498.1|977245_978283_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|978330_979020_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|979325_979709_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|979764_980352_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_167549350.1|980475_981703_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.5e-176
WP_001072392.1|982209_983802_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_000623347.1|983832_984183_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_000435414.1|984179_984599_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001333468.1|984811_985192_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|985188_985536_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099170.1|985584_987123_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
>prophage 7
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	1221659	1289356	4569995	holin,transposase,protease	Shigella_phage(33.33%)	51	NA	NA
WP_088895425.1|1221659_1222887_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_039059550.1|1224708_1226034_+	galactarate/glucarate/glycerate transporter GarP	NA	NA	NA	NA	NA
WP_000445064.1|1226823_1227597_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_001303675.1|1227626_1228517_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_039059552.1|1228613_1229759_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.1	2.2e-49
WP_158250041.1|1232351_1232510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145836.1|1234082_1234427_-	DNA-binding transcriptional activator TdcR	NA	NA	NA	NA	NA
WP_000104209.1|1234615_1235554_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_000548347.1|1235652_1236642_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_000107720.1|1236663_1237995_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_012421542.1|1238020_1239229_+	propionate kinase	NA	NA	NA	NA	NA
WP_000861733.1|1239262_1241557_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	7.4e-158
WP_000719990.1|1241570_1241960_+	enamine/imine deaminase	NA	NA	NA	NA	NA
WP_000622115.1|1242031_1243396_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000401562.1|1244446_1245778_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_039080584.1|1245805_1247116_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_001295544.1|1247249_1247414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633577.1|1247436_1248138_-	pirin family protein	NA	NA	NA	NA	NA
WP_001198781.1|1249952_1250321_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000099170.1|1251304_1252843_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_039058912.1|1252891_1253239_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_001333468.1|1253235_1253616_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000384145.1|1253788_1254154_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000531201.1|1254446_1255433_-	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
WP_000603617.1|1255502_1255985_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000096086.1|1256080_1256380_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_000785722.1|1256369_1256774_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031415.1|1256776_1257082_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001297156.1|1257119_1257488_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_001166768.1|1257634_1258018_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422149.1|1258021_1258684_-	DedA family protein	NA	NA	NA	NA	NA
WP_000406490.1|1259028_1259805_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_148722341.1|1260193_1260358_+	molecular chaperone	NA	NA	NA	NA	NA
WP_000755096.1|1261623_1262097_+	fimbrial protein	NA	NA	NA	NA	NA
WP_088895425.1|1262349_1263577_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000440317.1|1263630_1264560_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000174339.1|1264687_1266133_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253550.1|1266288_1270089_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|1270156_1271626_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203098.1|1271615_1272209_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|1272217_1272706_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802512.1|1272705_1273791_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|1273856_1274900_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001416321.1|1274856_1275060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241461.1|1275204_1277145_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148462.1|1277296_1278271_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|1279248_1279719_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|1279729_1281079_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000048612.1|1282214_1283177_-	sugar kinase	NA	NA	NA	NA	NA
WP_001570270.1|1286212_1286419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094096743.1|1288188_1289356_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
>prophage 8
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	1792876	1853272	4569995	transposase	Stx2-converting_phage(27.78%)	54	NA	NA
WP_000140459.1|1792876_1794073_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000285787.1|1794264_1794834_-	4'-phosphopantetheinyl transferase AcpT	NA	NA	NA	NA	NA
WP_000449758.1|1794888_1795938_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001245295.1|1797289_1797847_-	phage sensitivity protein DcrB	NA	NA	NA	NA	NA
WP_001100469.1|1797919_1798585_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|1798805_1799051_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106520.1|1799152_1801351_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	7.2e-118
WP_000964718.1|1801424_1802051_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000042893.1|1802191_1802551_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001295207.1|1802553_1802823_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000753479.1|1802812_1803409_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001040634.1|1803558_1805052_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617723.1|1805054_1805723_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001042006.1|1805715_1806774_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1807018_1807873_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001022008.1|1808143_1809247_+	branched chain amino acid ABC transporter substrate-binding protein LivJ	NA	NA	NA	NA	NA
WP_000176384.1|1809445_1809829_-	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
WP_000827696.1|1810252_1811362_+	high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK	NA	NA	NA	NA	NA
WP_001295111.1|1811409_1812336_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_000803797.1|1812332_1813610_+	branched chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_000082101.1|1813606_1814374_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416883.1|1814375_1815089_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_039059617.1|1815485_1816802_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_000099285.1|1816899_1817787_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_000572164.1|1817783_1818629_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_000907808.1|1818630_1819701_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.5	2.2e-19
WP_000073588.1|1819697_1820441_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.9e-10
WP_000825996.1|1820427_1820868_-	DUF2756 family protein	NA	NA	NA	NA	NA
WP_016243959.1|1820987_1822721_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_000634159.1|1822758_1823043_-	heat-shock protein	NA	NA	NA	NA	NA
WP_133298150.1|1823242_1823398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980638.1|1824296_1824728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000878026.1|1825662_1826682_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_000065895.1|1826786_1827986_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001295206.1|1828222_1828711_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_039059623.1|1829042_1829969_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000639811.1|1830091_1830787_+	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_000730260.1|1831010_1832006_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_000108320.1|1832144_1832672_+	gluconokinase	NA	NA	NA	NA	NA
WP_000210121.1|1832675_1834016_+	gluconate transporter	NA	NA	NA	NA	NA
WP_001002544.1|1834072_1834666_-	NAAT family transporter YhgN	NA	NA	NA	NA	NA
WP_000799970.1|1834857_1835961_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283736.1|1836233_1838420_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_000192517.1|1838416_1840390_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_000253979.1|1840407_1841703_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_039059625.1|1841702_1843136_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_000993449.1|1843154_1845602_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
WP_134797178.1|1846064_1846496_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	75.3	5.7e-35
WP_000099170.1|1846506_1848045_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|1848093_1848441_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|1848437_1848818_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000623347.1|1848929_1849280_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_134797179.1|1849310_1850903_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	2.4e-171
WP_088895425.1|1852044_1853272_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 9
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	2509603	2642336	4569995	tRNA,transposase,protease	Stx2-converting_phage(44.74%)	100	NA	NA
WP_088895425.1|2509603_2510832_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000196875.1|2512695_2514132_+	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_001296647.1|2514176_2514743_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_000220281.1|2514739_2515411_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_000195157.1|2515407_2516364_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_071821661.1|2516383_2518102_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001032546.1|2518094_2518478_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_000662608.1|2518474_2519071_+	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
WP_000789589.1|2519412_2520726_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_000542751.1|2522086_2522539_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_001301447.1|2522539_2523265_-	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_001193493.1|2523285_2524065_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_000992002.1|2524190_2525207_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039059716.1|2526151_2526595_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_001300891.1|2526754_2527090_-	phnA family protein	NA	NA	NA	NA	NA
WP_000093175.1|2528820_2530158_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_001217059.1|2530294_2531056_-	DNA-binding transcriptional activator AdiY	NA	NA	NA	NA	NA
WP_077897104.1|2531380_2533648_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_001090754.1|2533846_2534755_-	transcriptional regulator MelR	NA	NA	NA	NA	NA
WP_039059718.1|2535037_2536393_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_134796819.1|2536693_2537862_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	7.8e-180
WP_000272166.1|2537949_2538156_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000477615.1|2539022_2539349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435418.1|2540424_2540844_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	1.4e-35
WP_000624671.1|2540840_2541191_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_134795445.1|2541221_2542814_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.8	9.1e-171
WP_144039317.1|2543100_2543322_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.1	2.1e-33
WP_134796773.1|2543264_2543480_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBP6	Stx2-converting_phage	88.2	2.0e-25
WP_039058912.1|2543476_2543824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_134796820.1|2543872_2545411_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_134795405.1|2545326_2545638_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	1.8e-30
WP_001333468.1|2545634_2546015_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000624671.1|2546392_2546743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435428.1|2546739_2547159_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	4.2e-35
WP_001387241.1|2547555_2549751_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001287501.1|2552830_2553778_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_012421559.1|2553778_2555503_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074489.1|2555638_2556832_+	MFS transporter	NA	NA	NA	NA	NA
WP_071600834.1|2556781_2556979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134796820.1|2557610_2559149_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_039058912.1|2559197_2559545_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.2e-61
WP_094096764.1|2559689_2560858_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.4	2.3e-179
WP_001034105.1|2567429_2571287_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	6.3e-226
WP_144039321.1|2571333_2571897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099170.1|2571907_2573446_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|2573494_2573842_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|2573838_2574219_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_094193507.1|2577633_2578831_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_001223356.1|2579973_2582064_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_088895425.1|2582519_2583747_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_134795447.1|2584470_2585627_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.4e-66
WP_001333468.1|2585992_2586373_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|2586369_2586717_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099174.1|2586765_2588304_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	2.1e-294
WP_001188520.1|2590653_2591229_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068976.1|2591265_2592963_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|2592938_2593277_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|2593392_2594694_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000015872.1|2597074_2598331_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|2598606_2598900_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2598943_2600590_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2600727_2601081_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008051.1|2601283_2602153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940527.1|2602526_2603576_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|2603617_2604184_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2604235_2604361_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2604471_2604618_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2604799_2605117_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238381.1|2605113_2605647_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	54.4	1.4e-46
WP_012421501.1|2605735_2606869_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_012421212.1|2606931_2607291_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2607301_2607697_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|2607707_2608442_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192983.1|2608434_2610243_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|2610567_2611545_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001236784.1|2613145_2616469_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|2616490_2617459_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|2617555_2618608_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|2618702_2619248_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2619986_2620040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|2620022_2621162_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_012421570.1|2621160_2622708_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2622679_2623141_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990330.1|2623159_2624497_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122503.1|2624506_2626354_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280361.1|2626346_2627297_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051888.1|2627382_2627691_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460348.1|2627767_2629048_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2629133_2630393_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2630395_2631400_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2631481_2631679_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2631782_2633081_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177606.1|2633285_2633711_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076296.1|2633749_2636191_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	1.7e-67
WP_001293290.1|2636371_2637103_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000547762.1|2638127_2638526_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|2638535_2639174_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943997.1|2639176_2640235_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	39.5	5.2e-66
WP_000558725.1|2640318_2641944_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2642060_2642336_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 10
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3050968	3111069	4569995	tRNA,holin,transposase	Shigella_phage(22.73%)	53	NA	NA
WP_000176568.1|3050968_3052267_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3052315_3052576_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3052562_3052763_-	YaeP family protein	NA	NA	NA	NA	NA
WP_039058969.1|3052928_3053474_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3053470_3053893_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239180.1|3053906_3054617_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_012421638.1|3054816_3055641_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|3055693_3057412_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094014.1|3057522_3058230_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3058226_3058631_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3058748_3059564_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294604.1|3059603_3060257_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3060249_3061281_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140196.1|3061468_3062041_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997060.1|3067801_3068605_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.9e-39
WP_000648553.1|3068601_3069516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3069756_3070557_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644682.1|3071232_3072591_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|3072662_3073418_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|3073451_3074174_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3074170_3074638_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|3074702_3075434_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001118027.1|3076653_3077424_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|3077577_3078051_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973080.1|3078093_3080538_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3080777_3081356_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3081561_3082329_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_039058971.1|3082299_3083040_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012421460.1|3084116_3084866_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	36.1	1.9e-14
WP_114142541.1|3086180_3086936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000564146.1|3087099_3087870_+	hypothetical protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	69.8	1.6e-80
WP_000691315.1|3087928_3088981_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|3088977_3089430_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000528873.1|3089675_3090242_+	RNA ligase RtcB family protein	NA	U5PUG1	Bacillus_phage	30.3	7.8e-08
WP_039059955.1|3090220_3091417_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000602112.1|3092237_3092852_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|3092908_3094366_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291986.1|3094626_3095085_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189552.1|3095176_3096421_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|3096478_3096880_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_039058982.1|3096918_3097974_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	6.5e-117
WP_001285288.1|3098261_3099365_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893275.1|3099376_3100630_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	2.2e-95
WP_094096479.1|3101349_3102506_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_071821522.1|3102799_3102979_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515838.1|3103154_3103712_-	protein YmfL	NA	U5P4K1	Shigella_phage	95.1	1.5e-96
WP_000649481.1|3103755_3103956_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.1e-30
WP_039080454.1|3104046_3104721_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	98.7	1.3e-131
WP_094096742.1|3106089_3107311_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000016353.1|3107296_3107605_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	89.9	3.7e-36
WP_094096743.1|3107856_3109025_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_071821681.1|3109086_3109446_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.2	1.4e-39
WP_001072381.1|3109476_3111069_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.1e-171
>prophage 11
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3510872	3528833	4569995	tail,transposase,integrase	Stx2-converting_phage(37.5%)	17	3509451:3509466	3529781:3529796
3509451:3509466	attL	TCTTTCGCTGTTGCTG	NA	NA	NA	NA
WP_000891683.1|3510872_3511931_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_012421454.1|3511931_3512750_-	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_073692072.1|3512985_3513429_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	48.7	3.8e-34
WP_094096743.1|3513601_3514770_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_000702027.1|3515014_3515437_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	1.8e-70
WP_000787424.1|3515724_3516132_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000379550.1|3516334_3516487_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	3.5e-08
WP_000935605.1|3516908_3517748_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	48.2	3.2e-42
WP_167549338.1|3520615_3521843_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	5.0e-177
WP_000099170.1|3522828_3524367_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|3524415_3524763_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_024259670.1|3524759_3525140_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_077897081.1|3525248_3525770_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	56.0	3.6e-44
WP_039059100.1|3525772_3526318_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.2	4.6e-74
WP_001333468.1|3526521_3526902_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|3526898_3527246_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099170.1|3527294_3528833_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
3529781:3529796	attR	CAGCAACAGCGAAAGA	NA	NA	NA	NA
>prophage 12
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3625719	3665392	4569995	tRNA,tail,transposase,lysis	Enterobacteria_phage(54.55%)	31	NA	NA
WP_039059141.1|3625719_3626415_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|3626411_3626810_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000691708.1|3628402_3628486_-	protein YohP	NA	NA	NA	NA	NA
WP_001078128.1|3628709_3630146_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|3630198_3630960_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012421544.1|3631836_3632412_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_024258568.1|3632585_3633518_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097369.1|3633555_3635271_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871503.1|3635466_3637764_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000221788.1|3638938_3640096_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569318.1|3640088_3641015_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	7.4e-24
WP_000783120.1|3641019_3641751_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3641731_3641839_-	protein YohO	NA	NA	NA	NA	NA
WP_000435414.1|3641987_3642407_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000623347.1|3642403_3642754_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_001072381.1|3642784_3644377_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.1e-171
WP_001063816.1|3645237_3646365_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_133298166.1|3646466_3647075_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000153067.1|3647293_3647632_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000682832.1|3649111_3649654_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001403727.1|3649952_3650234_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3650496_3651606_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032229995.1|3651737_3653771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_088895425.1|3654970_3656198_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001295430.1|3658163_3658634_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598643.1|3658680_3659400_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_012421574.1|3659396_3661082_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	2.8e-303
WP_001261938.1|3662373_3662622_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	98.8	7.0e-38
WP_001026780.1|3662938_3663484_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_039059150.1|3663494_3664067_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	83.5	3.4e-88
WP_073692955.1|3664066_3665392_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.0	9.8e-86
>prophage 13
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3672647	3719759	4569995	terminase,tail,lysis,head,transposase	Enterobacteria_phage(34.21%)	48	NA	NA
WP_094096751.1|3672647_3673319_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.9	2.4e-104
WP_024260951.1|3673888_3674587_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.3	7.8e-127
WP_000847315.1|3674586_3674916_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	96.3	8.9e-57
WP_000533443.1|3677504_3677918_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	4.1e-43
WP_039059160.1|3678349_3679102_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	8.7e-132
WP_000683079.1|3679109_3679505_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|3679501_3680077_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204570.1|3680092_3680446_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	69.2	1.5e-41
WP_000201502.1|3680438_3680822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256820.1|3681958_3682306_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_073692874.1|3682342_3683848_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
WP_000140265.1|3685413_3685695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094096479.1|3685819_3686976_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_001289722.1|3687131_3687401_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000435414.1|3687604_3688024_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000623347.1|3688020_3688371_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_001072381.1|3688401_3689994_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.1e-171
WP_039059163.1|3690041_3690185_+|lysis	lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	88.1	4.0e-14
WP_001007759.1|3692042_3692693_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240105.1|3692949_3693585_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740100.1|3693585_3694590_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920122.1|3694698_3695112_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_134797182.1|3695244_3695916_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826763.1|3695915_3697274_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218214.1|3697381_3698233_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_153449117.1|3698379_3698748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020956.1|3699601_3700099_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.0	4.1e-37
WP_167549338.1|3700192_3701420_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	5.0e-177
WP_073692924.1|3702577_3702943_+	permease	NA	NA	NA	NA	NA
WP_000365568.1|3702982_3703678_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	7.3e-08
WP_001157236.1|3703744_3705163_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786008.1|3705143_3705614_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_005113720.1|3707397_3707754_-	hypothetical protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.8e-55
WP_039059167.1|3707819_3708164_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	1.6e-56
WP_000569978.1|3708160_3708607_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.0	9.9e-75
WP_001007905.1|3708603_3708954_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125994.1|3708963_3709290_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	1.0e-52
WP_001063101.1|3711552_3711774_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	3.8e-35
WP_073714345.1|3713818_3715480_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_001530008.1|3715476_3716040_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	84.9	4.0e-73
WP_039059168.1|3716330_3716696_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	92.6	1.8e-58
WP_000095744.1|3716737_3716938_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828072.1|3717069_3717396_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_001082565.1|3717734_3718202_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	1.1e-73
WP_000675931.1|3718203_3718317_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_039080477.1|3718537_3719071_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	91.5	5.1e-94
WP_000369850.1|3719176_3719449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|3719414_3719759_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
>prophage 14
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3744148	3785197	4569995	tail,transposase,integrase	Stx2-converting_phage(27.27%)	30	3737098:3737157	3763995:3764757
3737098:3737157	attL	GGGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGT	NA	NA	NA	NA
WP_039059174.1|3744148_3745411_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.5e-72
WP_000532912.1|3747925_3748642_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039059176.1|3748984_3750418_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_167710671.1|3750424_3751653_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_164997312.1|3752852_3754066_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	8.7e-166
WP_001302302.1|3761827_3762625_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_114142313.1|3762835_3763291_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	62.9	7.3e-41
WP_134796775.1|3764359_3765515_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	9.8e-66
3763995:3764757	attR	ACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCATTACCCACATCGGAAACCCTCGCTGCACACAGATAGGCAATTTCCATTGCGATAAAAACAGGAAGAGGTGCAACGCTTAATACTGCCTGGTATTCTTTGTCGGTTACATATCGTTCGCGGTTTTTGGCCTTGAATTTACTTACACCTGCACATGGGTTAGCCTTCACGTACCCTCGCTCATACCCCCAACTGTAAACGCGGGACATACTGCTTTTTTCATGGTTGGCTTGCGTTTTACTCTGTTCCCTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAAACCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCCCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCC	NA	NA	NA	NA
WP_134796840.1|3765898_3767437_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	6.3e-294
WP_000612626.1|3767485_3767833_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|3767829_3768210_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001063816.1|3768564_3769692_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000929754.1|3770285_3770564_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_000935258.1|3770731_3770944_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_071821547.1|3771538_3771892_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	70.7	2.8e-24
WP_001333468.1|3772024_3772405_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|3772401_3772749_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_134802545.1|3772797_3774336_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	6.3e-294
WP_073692993.1|3774332_3774692_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	61.8	1.1e-31
WP_000096344.1|3774750_3774954_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_094096479.1|3775353_3776510_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000377820.1|3776749_3777340_+	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.5	4.9e-114
WP_165850228.1|3778014_3778536_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	54.9	8.1e-44
WP_000902895.1|3778538_3779084_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	75.3	9.3e-75
WP_000930154.1|3780112_3780736_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.1e-78
WP_001039895.1|3780735_3780915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134797187.1|3780915_3782559_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000239869.1|3782874_3783543_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937487.1|3783599_3783869_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.6e-19
WP_094096743.1|3784028_3785197_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
>prophage 15
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3815189	3862484	4569995	tRNA,tail,transposase	Stx2-converting_phage(30.43%)	50	NA	NA
WP_000826462.1|3815189_3816398_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.2e-209
WP_001282098.1|3817952_3818366_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_004982751.1|3818368_3818734_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|3818733_3819471_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187365.1|3819480_3819750_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983993.1|3819758_3820544_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103990.1|3820833_3821445_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|3822286_3822475_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|3822637_3822865_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491512.1|3823162_3823978_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077897108.1|3823974_3825669_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	8.5e-18
WP_000009307.1|3825839_3826022_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|3826100_3827018_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_114142276.1|3827814_3828228_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.5e-64
WP_000710952.1|3828242_3828617_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_128566924.1|3828712_3828922_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	4.4e-33
WP_000224021.1|3828969_3829230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897106.1|3829364_3830966_-|transposase	IS66-like element ISEc49 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	2.6e-77
WP_000950647.1|3830972_3831365_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042910.1|3831351_3831681_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000807924.1|3834779_3835121_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_004983175.1|3835120_3835819_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	9.2e-128
WP_000194705.1|3835829_3836573_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
WP_012602254.1|3836470_3837151_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	2.4e-112
WP_039060121.1|3837391_3840865_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.9	0.0e+00
WP_000216459.1|3841586_3842822_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZGT8	Escherichia_phage	98.5	1.7e-68
WP_000539253.1|3842907_3843420_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	92.9	1.1e-85
WP_001114260.1|3843495_3843708_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	63.6	7.1e-15
WP_001217553.1|3844309_3844558_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000530012.1|3844654_3844831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140459.1|3846062_3847259_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000891627.1|3847449_3847704_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001258662.1|3848013_3849786_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|3849903_3850356_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907247.1|3850384_3851125_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|3851159_3851681_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000435414.1|3852025_3852445_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000623347.1|3852441_3852792_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_001072381.1|3852822_3854415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.1e-171
WP_001063816.1|3854707_3855835_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_088895425.1|3856276_3857505_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_039059216.1|3857578_3858409_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860059.1|3858490_3858970_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_012421636.1|3858985_3859462_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3859524_3859746_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285585.1|3859819_3860188_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000854814.1|3860276_3860651_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|3860647_3860842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|3860854_3860968_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001063816.1|3861356_3862484_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3931814	3939353	4569995		Enterobacteria_phage(42.86%)	7	NA	NA
WP_053895055.1|3931814_3933209_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	1.1e-18
WP_000999466.1|3933366_3934362_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183070.1|3934604_3935498_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.1e-45
WP_000699430.1|3935870_3936956_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
WP_073714274.1|3936955_3937855_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	4.4e-29
WP_073714275.1|3937912_3938791_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_032218868.1|3938795_3939353_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.1	1.3e-52
>prophage 17
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	3969737	4003317	4569995	holin,transposase,lysis	Enterobacteria_phage(56.25%)	42	NA	NA
WP_000399687.1|3969737_3970718_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000450409.1|3971502_3971832_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|3971932_3972115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063816.1|3972607_3973735_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_012421238.1|3973950_3974151_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.4	4.5e-27
WP_000828072.1|3974282_3974609_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000735655.1|3974953_3975178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032207510.1|3975201_3975669_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	1.3e-69
WP_001151821.1|3975817_3976000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092881.1|3976156_3976690_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	1.6e-100
WP_000731267.1|3976740_3977085_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_000284510.1|3977089_3977305_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_165850575.1|3977381_3977711_-	DUF826 domain-containing protein	NA	A0A0N7C077	Escherichia_phage	74.8	4.5e-16
WP_000142783.1|3977634_3977817_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874275.1|3977955_3979821_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	71.5	2.2e-264
WP_000871291.1|3980081_3980417_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000935526.1|3981006_3982056_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.8	9.4e-201
WP_000762934.1|3982630_3983452_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.1e-79
WP_000904114.1|3983448_3983823_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001065349.1|3984876_3985134_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	7.3e-22
WP_024258584.1|3986528_3987407_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	3.9e-139
WP_000092418.1|3987417_3988398_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.6	3.1e-60
WP_000995578.1|3988394_3988694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|3988690_3988915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626793.1|3988911_3989106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587264.1|3989102_3989951_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	65.4	3.8e-91
WP_001090260.1|3990059_3990767_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	85.1	5.0e-105
WP_000838344.1|3991102_3991759_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_000608404.1|3991861_3992365_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_000141093.1|3992652_3992859_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_167551163.1|3992986_3994215_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_039064784.1|3994389_3994590_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	2.7e-08
WP_001199104.1|3994595_3995177_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_000179800.1|3995425_3995743_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001300189.1|3995696_3996011_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_039059243.1|3995997_3996678_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	67.4	7.3e-37
WP_039059242.1|3996674_3997211_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	69.3	3.6e-63
WP_039080509.1|3997212_3997515_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	96.0	1.6e-52
WP_000628767.1|3998884_3999829_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	58.6	2.6e-80
WP_000457723.1|3999913_4000156_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_048815028.1|4001504_4002083_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	5.5e-102
WP_001063816.1|4002189_4003317_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	4193096	4231824	4569995	tRNA,transposase	Shigella_phage(20.0%)	27	NA	NA
WP_094096507.1|4193096_4194264_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_012421392.1|4195664_4196585_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_088895425.1|4196765_4197993_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000817680.1|4198058_4198958_+	DNA-binding transcriptional regulator PgrR	NA	NA	NA	NA	NA
WP_000559900.1|4200957_4201989_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000605090.1|4203009_4203267_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262112.1|4203328_4204267_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|4204418_4205171_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945013.1|4205365_4205881_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
WP_001156463.1|4208231_4209677_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000885456.1|4211005_4211914_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046827.1|4212243_4212807_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_039060229.1|4212827_4214060_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4214314_4215298_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123780.1|4215775_4217149_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.9e-52
WP_001157416.1|4217277_4218213_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	5.0e-145
WP_167549342.1|4219559_4220772_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	1.1e-165
WP_012421537.1|4221881_4222547_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882657.1|4222717_4222930_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_000687440.1|4223179_4223467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001134632.1|4223486_4224104_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	89.3	2.0e-102
WP_134802550.1|4224362_4225518_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000640137.1|4225574_4226129_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.7	1.3e-68
WP_094096507.1|4226687_4227855_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000612626.1|4229155_4229503_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|4229499_4229880_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_136952279.1|4230610_4231824_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
>prophage 19
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	4261071	4298370	4569995	transposase	Stx2-converting_phage(55.56%)	35	NA	NA
WP_094096507.1|4261071_4262239_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000048696.1|4262214_4262328_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000428998.1|4262516_4263047_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4263291_4263465_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|4263536_4263686_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000099170.1|4265583_4267122_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|4267170_4267518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|4267514_4267895_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_012421383.1|4267994_4268165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012421364.1|4268202_4269126_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013782.1|4269342_4270686_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375947.1|4270910_4272566_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_004983724.1|4272705_4272930_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|4272992_4273529_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_000099170.1|4273836_4275375_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|4275423_4275771_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|4275767_4276148_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_012421383.1|4276247_4276418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012421364.1|4276455_4277379_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013782.1|4277595_4278939_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375947.1|4279163_4280819_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_004983724.1|4280958_4281183_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|4281245_4281782_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_000099170.1|4282089_4283628_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|4283676_4284024_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|4284020_4284401_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_012421650.1|4285329_4286322_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586729.1|4286318_4286912_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_094096479.1|4287953_4289110_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000435414.1|4290430_4290850_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001072397.1|4291227_4292820_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.4e-171
WP_077897637.1|4293246_4294389_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_134796780.1|4294511_4295679_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	5.4e-181
WP_039080538.1|4295719_4297114_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.4	2.8e-27
WP_088895425.1|4297141_4298370_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 20
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	4309554	4387475	4569995	transposase	Shigella_phage(33.33%)	52	NA	NA
WP_094193507.1|4309554_4310753_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_024258603.1|4311953_4312868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024258604.1|4312871_4313630_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_012421233.1|4313692_4315321_+|transposase	IS4 family transposase	transposase	A0A0U2QQK4	Escherichia_phage	76.4	8.1e-74
WP_134797170.1|4315499_4317251_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_094096507.1|4317789_4318958_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000579667.1|4319616_4319742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214712.1|4321326_4321530_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215546.1|4321707_4322394_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|4322482_4323229_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210375.1|4323365_4325411_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024556.1|4325455_4325974_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|4326249_4326642_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_134795371.1|4330854_4332011_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.7e-65
WP_001303494.1|4332326_4332422_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000718913.1|4332656_4332791_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_000018633.1|4332876_4333110_+	YdcY family protein	NA	NA	NA	NA	NA
WP_001076536.1|4333110_4333560_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001353827.1|4333556_4334075_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_012421279.1|4334255_4335293_+	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_000689373.1|4336542_4338645_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	4.0e-134
WP_000550675.1|4338886_4339948_+	YncE family protein	NA	NA	NA	NA	NA
WP_001300590.1|4340060_4341560_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_012421433.1|4341826_4342324_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005006008.1|4343476_4343656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977355.1|4343660_4343864_+	RHS domain-containing protein	NA	NA	NA	NA	NA
WP_167549350.1|4343911_4345140_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.5e-176
WP_077897594.1|4347107_4350155_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240578.1|4350167_4351052_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045648.1|4351044_4351698_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_000781370.1|4351748_4352033_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000433446.1|4353314_4355012_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000841554.1|4355168_4355306_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495766.1|4355407_4355623_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152298.1|4355968_4356400_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285566.1|4356455_4357382_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	5.3e-14
WP_000193531.1|4357374_4358361_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.1e-17
WP_000887673.1|4361363_4361945_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_024258606.1|4362202_4364602_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
WP_000350400.1|4366379_4367699_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|4367829_4369365_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358931.1|4369519_4370920_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_012421276.1|4371281_4374065_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.2	1.1e-19
WP_000832424.1|4374121_4376494_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628530.1|4376531_4378217_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	2.9e-10
WP_120795387.1|4378419_4378542_+	protein YneP	NA	NA	NA	NA	NA
WP_000060493.1|4379156_4379918_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543389.1|4379992_4380190_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726687.1|4380437_4382717_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_039080541.1|4383585_4384116_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|4384618_4385846_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_094096507.1|4386307_4387475_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
>prophage 21
NZ_CP041513	Shigella boydii strain KCCM 41690 chromosome, complete genome	4569995	4484453	4560979	4569995	tail,terminase,plate,integrase,transposase	Enterobacteria_phage(50.0%)	67	4491884:4491943	4550900:4551667
WP_000099170.1|4484453_4485992_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|4486040_4486388_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_073714280.1|4486384_4486765_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.1e-65
WP_000587600.1|4487142_4487955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069986.1|4487958_4488744_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_048815031.1|4488740_4489409_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
WP_001549248.1|4489472_4490111_-	YdhW family putative oxidoreductase system protein	NA	NA	NA	NA	NA
4491884:4491943	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000528340.1|4492683_4492893_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_001295403.1|4493449_4494862_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_000648420.1|4495172_4495409_+	murein lipoprotein Lpp	NA	NA	NA	NA	NA
WP_001196526.1|4496624_4497041_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_000144558.1|4497053_4498274_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	6.4e-92
WP_000907994.1|4498270_4499542_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|4499516_4500263_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000367175.1|4501768_4502137_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001296104.1|4502683_4502872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637981.1|4502971_4503382_-	1,4-dihydroxy-2-naphthoyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_000613005.1|4503378_4506435_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000248636.1|4506823_4507936_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_000383469.1|4510199_4511066_+	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_012421640.1|4511097_4511856_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000347825.1|4513609_4514761_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284799.1|4514803_4515715_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000692130.1|4516030_4516795_+	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_000080718.1|4516814_4517753_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_001282575.1|4517808_4519098_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000081071.1|4519094_4519388_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_012421423.1|4519444_4521091_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	4.5e-32
WP_000069350.1|4521147_4523526_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_088895425.1|4523675_4524904_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000368051.1|4525194_4526028_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082223.1|4526184_4527231_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	2.7e-83
WP_012421553.1|4527362_4527554_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175717.1|4527557_4528994_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001209786.1|4530016_4530481_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	35.3	1.1e-12
WP_000029465.1|4530558_4531308_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_000956508.1|4531920_4532901_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000997174.1|4533109_4533439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000668483.1|4533546_4533909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336261.1|4533911_4534850_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	1.1e-80
WP_000904672.1|4534938_4535247_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|4535343_4535622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917812.1|4535636_4535975_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	1.1e-49
WP_000158971.1|4535985_4536273_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514280.1|4536284_4536521_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	3.7e-28
WP_012421549.1|4539291_4539909_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.5	5.0e-109
WP_000211290.1|4539913_4540225_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	3.6e-47
WP_001289966.1|4540288_4540879_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_072037216.1|4542414_4543539_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	96.8	6.1e-206
WP_000072327.1|4544811_4545204_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_001437610.1|4545200_4545608_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920592.1|4545745_4546213_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	2.2e-85
WP_000356323.1|4546205_4546841_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	2.6e-113
WP_001544208.1|4546852_4547419_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.5e-99
WP_001067548.1|4547436_4547766_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111959.1|4547769_4548666_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	3.5e-156
WP_000071721.1|4548658_4549189_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
WP_072037230.1|4551648_4551954_+|tail	phage tail protein	tail	A0A222YYI1	Escherichia_phage	93.8	4.9e-49
4550900:4551667	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATTATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACTGCACGCATTATGGGCGTTAGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCTTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCACTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
WP_000972139.1|4551956_4552490_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	8.4e-97
WP_039059819.1|4552518_4553046_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.1	3.6e-92
WP_039059818.1|4553049_4553886_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	92.8	4.6e-150
WP_000905061.1|4553990_4554590_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|4554618_4555107_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_039060544.1|4555119_4557927_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.8	0.0e+00
WP_039059815.1|4557913_4558069_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	1.1e-20
WP_000651580.1|4558077_4558452_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000005375.1|4559794_4560979_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	1.1e-224
>prophage 1
NZ_CP041512	Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence	108375	2677	82376	108375	transposase,tRNA,protease	Stx2-converting_phage(36.84%)	58	NA	NA
WP_088895425.1|2677_3905_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000850663.1|5232_5973_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_001046939.1|6301_7168_-	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_167549346.1|7646_8874_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_094106539.1|9215_10372_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_005005342.1|10703_11651_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_000625263.1|13238_13931_+	type III secretion system effector cysteine methyltransferase OspZ	NA	NA	NA	NA	NA
WP_000405248.1|15199_15682_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010921625.1|15672_15975_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000019158.1|16246_16519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136952279.1|16661_17875_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_000701110.1|19469_20924_-	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_094096542.1|21348_22192_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000957863.1|23135_23324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134796874.1|23333_24533_+|transposase	IS91-like element ISSbo1 family transposase	transposase	NA	NA	NA	NA
WP_000130973.1|26011_26869_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|26861_26936_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|27159_27420_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766818.1|27659_28250_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_012421743.1|29068_29275_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_011379083.1|30024_30237_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005056178.1|30367_30928_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205722.1|30982_31729_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_039058931.1|31748_36620_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_171548087.1|36606_36900_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_000450530.1|37103_37331_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911319.1|37330_37729_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_012421771.1|42729_43680_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_005027207.1|43684_44773_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_000931198.1|44775_45618_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004996477.1|45981_46098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039058926.1|47016_47502_-	protein kinase	NA	NA	NA	NA	NA
WP_000079956.1|47753_48023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012421769.1|48230_49868_-	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_001159860.1|50260_50566_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813626.1|50567_50786_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_012421738.1|51378_51651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099170.1|54066_55605_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
WP_000612626.1|55653_56001_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|55997_56378_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000124079.1|58208_58574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024258531.1|58573_59761_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000865087.1|60298_60586_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	88.4	1.7e-40
WP_000483533.1|60585_60897_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	95.1	5.0e-49
WP_134797190.1|61360_62557_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000957717.1|62926_63193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005116773.1|64561_65350_+	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_073692982.1|65291_65714_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	96.3	2.5e-51
WP_012421744.1|67661_69389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114782.1|70694_70847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089519923.1|72963_73146_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.2	2.5e-16
WP_004967149.1|73165_74767_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
WP_000607008.1|75422_76061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167549346.1|76532_77760_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_134802537.1|78144_79313_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	9.3e-181
WP_011114751.1|79985_80270_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000501969.1|80257_80743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001072392.1|80783_82376_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
