The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019634	Enterobacter sp. 18A13	4652325	89920	99132	4652325	integrase,capsid	Enterobacteria_phage(100.0%)	11	87586:87608	99293:99315
87586:87608	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_143344473.1|89920_92254_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_143344474.1|92268_92589_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032983269.1|92585_92813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143344475.1|92809_93367_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	3.5e-29
WP_172621897.1|93363_93630_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	2.9e-29
WP_143344476.1|94171_94915_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_014830132.1|94917_95136_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	62.1	1.9e-15
WP_062676834.1|95164_95728_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.8	6.0e-61
WP_143344477.1|96576_96810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143344478.1|96954_97953_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_143344479.1|97962_99132_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.5	2.5e-210
99293:99315	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_AP019634	Enterobacter sp. 18A13	4652325	917497	971688	4652325	terminase,holin,coat,integrase,capsid	Salmonella_phage(30.3%)	75	921365:921410	970985:971030
WP_111965853.1|917497_918550_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	1.3e-117
WP_021242883.1|918854_919958_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.7	1.7e-59
WP_127729690.1|919969_921223_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
921365:921410	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_143344669.1|921424_922588_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.6	5.3e-221
WP_143344671.1|922818_923010_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	62.5	3.8e-07
WP_143344672.1|923045_923420_-	hypothetical protein	NA	R9TNF9	Aeromonas_phage	36.4	7.1e-10
WP_143344673.1|923598_923799_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	66.7	1.2e-19
WP_143344674.1|923945_924308_-	hypothetical protein	NA	A0A2K9VAS2	Klebsiella_virus	69.7	6.2e-43
WP_143344675.1|924309_924903_-	DUF551 domain-containing protein	NA	A0A2I6PID9	Escherichia_phage	43.9	7.4e-09
WP_143344676.1|924899_925322_-	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	55.8	2.3e-25
WP_143344677.1|925593_925941_-	DUF551 domain-containing protein	NA	K7PH61	Enterobacteria_phage	61.8	2.2e-21
WP_143344678.1|926419_926602_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	64.8	2.4e-11
WP_143344680.1|926910_927393_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	78.8	2.9e-64
WP_143344681.1|927376_928279_-	recombinase RecT	NA	K7P7A0	Enterobacteria_phage	81.5	6.3e-137
WP_143344682.1|928275_928584_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	52.9	5.0e-25
WP_143345704.1|928665_928890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172621903.1|929105_929276_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	78.6	2.1e-17
WP_172621904.1|929479_929656_-	hypothetical protein	NA	A0A1D7XFI0	Escherichia_phage	58.9	4.2e-13
WP_143344683.1|929655_930006_-	hypothetical protein	NA	A0A0H5AWA3	Pseudomonas_phage	53.1	1.4e-15
WP_143345705.1|930839_931532_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	92.2	4.7e-124
WP_143344685.1|931678_931909_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	92.1	5.7e-34
WP_063428028.1|932019_932310_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	84.4	1.8e-37
WP_045408365.1|932354_932513_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	88.2	1.9e-17
WP_172621929.1|932532_933666_+	replication protein	NA	E5AGE9	Erwinia_phage	54.1	2.6e-63
WP_143344686.1|933662_935030_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	68.0	2.7e-171
WP_143344687.1|935332_935524_+	hypothetical protein	NA	Q716C9	Shigella_phage	66.7	8.1e-18
WP_143345706.1|935754_936072_+	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	57.9	3.0e-25
WP_063957882.1|936092_936287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344688.1|936298_936592_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	36.1	5.4e-05
WP_143344689.1|936594_936795_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	85.7	3.0e-23
WP_143344690.1|936797_937220_+	recombination protein NinB	NA	A0A2H4FNF5	Salmonella_phage	90.0	1.7e-71
WP_143344692.1|937419_937647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344693.1|937648_938023_+	DUF2591 family protein	NA	A0A2D1GLI3	Escherichia_phage	39.7	1.6e-14
WP_143344694.1|938015_938204_+	NinF family protein	NA	NA	NA	NA	NA
WP_143344695.1|938196_938793_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	41.8	7.1e-36
WP_143344696.1|938789_939344_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.8	6.5e-60
WP_143344697.1|939340_939607_+	hypothetical protein	NA	G0ZNC5	Cronobacter_phage	70.2	7.8e-27
WP_143344698.1|939594_939780_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	51.9	9.6e-08
WP_143344699.1|939776_940388_+	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	96.6	1.8e-111
WP_143344700.1|940966_941293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344701.1|941274_941619_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	51.4	1.5e-25
WP_143344702.1|941611_942001_+	M15 family metallopeptidase	NA	A0A060DAL8	Salmonella_phage	79.8	1.4e-56
WP_143344703.1|942170_942668_+	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	96.4	1.3e-91
WP_143344704.1|942835_943477_+	hypothetical protein	NA	C4MZS1	Enterobacteria_phage	52.0	2.0e-07
WP_143344705.1|943478_943784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344706.1|943786_947869_+	SGNH/GDSL hydrolase family protein	NA	A0A223LJ40	Erwinia_phage	51.1	6.4e-120
WP_143344707.1|947909_948116_+	hypothetical protein	NA	M4Q0Z5	Dunaliella_viridis_virus	37.5	3.1e-07
WP_143344708.1|948293_948839_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	70.8	3.6e-63
WP_143344709.1|949017_949248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344710.1|949270_949477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344711.1|949480_949999_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	58.2	5.0e-46
WP_143344712.1|949998_951471_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.1	4.3e-252
WP_143344713.1|951483_952953_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	1.7e-147
WP_143344714.1|952879_953881_+|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	67.8	2.1e-112
WP_143344715.1|953898_955269_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.3	2.1e-123
WP_143344716.1|955268_955730_+	hypothetical protein	NA	B1GS72	Salmonella_phage	51.7	3.4e-30
WP_143344717.1|955726_956782_+|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.5	1.3e-101
WP_143344718.1|956814_957120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344719.1|957122_957503_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	4.8e-30
WP_014883997.1|957502_957676_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	5.1e-11
WP_006808949.1|957675_958026_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	8.9e-39
WP_014883994.1|958028_958397_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_016245419.1|958393_958777_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	58.3	1.3e-38
WP_143344720.1|958835_959591_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	48.2	2.6e-51
WP_143344721.1|959641_960385_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	2.2e-63
WP_143344722.1|960457_960832_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	52.4	1.3e-24
WP_143344723.1|960888_963228_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	49.8	1.7e-133
WP_143344724.1|963229_963724_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	64.6	2.1e-57
WP_143344725.1|963723_964194_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	56.5	1.3e-45
WP_143344726.1|964186_964624_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	62.6	3.6e-45
WP_143344727.1|964565_967049_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	59.6	4.3e-284
WP_143344728.1|967105_969079_+	SGNH/GDSL hydrolase family protein	NA	B1GS50	Salmonella_phage	77.9	2.1e-60
WP_143344729.1|969140_970358_+	SGNH/GDSL hydrolase family protein	NA	A0A1P8L663	Pectobacterium_phage	33.5	3.1e-54
WP_143344730.1|970475_970862_+	LexA family transcriptional regulator	NA	O64339	Escherichia_phage	82.8	6.8e-56
WP_172621905.1|971370_971688_+	hypothetical protein	NA	Q7M297	Enterobacteria_phage	39.6	1.3e-12
970985:971030	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 3
NZ_AP019634	Enterobacter sp. 18A13	4652325	1794994	1852415	4652325	terminase,holin,head,tail,integrase,tRNA,protease,portal,capsid	Enterobacterial_phage(42.31%)	76	1805102:1805116	1821633:1821647
WP_021241033.1|1794994_1796107_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_133295416.1|1796147_1796621_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_143344943.1|1796630_1797284_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_023292761.1|1797401_1798652_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_133294182.1|1798729_1799077_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_111965567.1|1799151_1799397_+	YmjA family protein	NA	NA	NA	NA	NA
WP_143344944.1|1799685_1801185_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_143344945.1|1801420_1802941_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_143345714.1|1803066_1804539_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.8	4.5e-15
WP_008500746.1|1804824_1805073_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
1805102:1805116	attL	AGATGGCGGCCTTTT	NA	NA	NA	NA
WP_029739841.1|1805204_1805303_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_143345715.1|1805348_1806377_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.6	9.1e-15
WP_143344946.1|1806686_1806941_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_045401563.1|1807021_1807327_+	periplasmic protein	NA	NA	NA	NA	NA
WP_133294186.1|1807327_1807672_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_133294187.1|1807773_1808481_+	CTP synthase	NA	NA	NA	NA	NA
WP_143344947.1|1808512_1809700_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_172621932.1|1809796_1810591_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024908579.1|1810574_1811021_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_010430055.1|1811165_1811270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133294189.1|1811290_1811791_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_143344949.1|1812053_1813196_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	48.1	5.4e-93
WP_008500733.1|1813170_1813434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046091666.1|1813725_1814031_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	69.0	1.7e-33
WP_143344951.1|1814023_1814368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172621911.1|1814824_1815847_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	91.6	1.9e-169
WP_172621912.1|1815846_1816206_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.7	3.7e-48
WP_143344954.1|1816970_1817690_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	62.9	3.1e-78
WP_023305900.1|1817788_1818007_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
WP_143344955.1|1818048_1818519_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	97.4	3.1e-79
WP_071993458.1|1818760_1818973_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.5	3.3e-12
WP_143344956.1|1818929_1819856_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.8	1.1e-70
WP_143344957.1|1819852_1820347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344958.1|1820346_1821006_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.5	7.7e-100
WP_143344959.1|1821002_1821251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143344960.1|1821247_1821568_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	74.5	8.2e-39
WP_143344961.1|1821564_1821954_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.9	7.8e-68
1821633:1821647	attR	AAAAGGCCGCCATCT	NA	NA	NA	NA
WP_143344962.1|1821950_1822940_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	94.2	1.1e-185
WP_143344963.1|1822954_1823317_+	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	94.2	2.3e-58
WP_172621895.1|1823340_1823766_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	70.7	4.1e-46
WP_143345716.1|1823787_1824501_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	89.9	1.9e-120
WP_022648767.1|1824978_1825374_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_028019551.1|1825360_1825642_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	97.8	8.7e-45
WP_143344965.1|1825641_1826268_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	92.8	3.9e-109
WP_143344966.1|1826275_1826545_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	83.1	8.5e-05
WP_143344968.1|1826883_1827147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143344969.1|1827286_1828744_+	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	90.5	1.4e-266
WP_143344970.1|1828725_1829316_+	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	94.9	1.9e-110
WP_143344971.1|1829312_1829654_+	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	97.3	2.3e-63
WP_047362834.1|1829653_1829857_+	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	85.1	3.6e-24
WP_143344972.1|1830036_1830522_+|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	95.0	3.6e-78
WP_143344973.1|1830528_1832043_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	95.2	8.3e-283
WP_137464218.1|1832042_1833317_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.3	9.6e-248
WP_016063561.1|1833334_1834012_+|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	100.0	2.4e-125
WP_143344974.1|1834014_1835172_+|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.7	6.1e-209
WP_143344975.1|1835204_1835531_+|head,tail	phage head-tail connector protein	head,tail	K7PGU9	Enterobacterial_phage	99.1	7.5e-56
WP_129694348.1|1835530_1835869_+|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	98.2	1.9e-57
WP_143344976.1|1835865_1836315_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	96.0	1.2e-72
WP_143344977.1|1836311_1836659_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	96.5	6.5e-58
WP_000202242.1|1836713_1837184_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.7	4.4e-81
WP_143344978.1|1837240_1837642_+|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	98.5	9.5e-69
WP_000050396.1|1837665_1837929_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	98.9	8.5e-42
WP_143344979.1|1837963_1841245_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	95.2	0.0e+00
WP_000963855.1|1841247_1841586_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
WP_143344980.1|1841582_1842341_+|tail	phage minor tail protein L	tail	K7P6W4	Enterobacteria_phage	99.2	1.5e-147
WP_143344981.1|1842342_1843053_+	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	96.2	2.7e-143
WP_143344982.1|1843046_1843493_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	95.3	3.1e-76
WP_143344983.1|1843550_1844141_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	96.9	4.3e-102
WP_143344984.1|1844193_1847367_+	host specificity protein J	NA	K7P7G9	Enterobacteria_phage	89.8	0.0e+00
WP_143345717.1|1847366_1847663_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	74.5	8.4e-38
WP_143344985.1|1847659_1848301_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	87.3	5.2e-109
WP_143344986.1|1848265_1848634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143344987.1|1848765_1849998_+|tail	tail fiber domain-containing protein	tail	K7P7B1	Enterobacteria_phage	68.5	1.4e-57
WP_023292714.1|1850092_1850359_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	96.6	2.1e-40
WP_143344988.1|1850683_1851004_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	86.8	3.0e-49
WP_143344989.1|1851131_1852415_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 4
NZ_AP019634	Enterobacter sp. 18A13	4652325	3239906	3304107	4652325	plate,integrase,tRNA,capsid	Enterobacteria_phage(25.0%)	54	3260627:3260641	3271897:3271911
WP_111965254.1|3239906_3240719_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_032646629.1|3240718_3241732_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_111965253.1|3241799_3242936_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	5.2e-19
WP_045402671.1|3243049_3244054_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_143345353.1|3244144_3245323_-	MFS transporter	NA	NA	NA	NA	NA
WP_014832795.1|3245529_3246747_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_143345354.1|3246905_3248903_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_048029667.1|3248961_3249240_-	YfcL family protein	NA	NA	NA	NA	NA
WP_111965248.1|3249253_3249799_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_136195504.1|3249798_3250608_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_133294868.1|3250607_3251432_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_143345355.1|3251434_3252520_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.7	1.5e-87
WP_008502612.1|3252580_3253513_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_008502613.1|3253658_3254210_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_045330962.1|3254256_3254742_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_143345356.1|3254951_3257099_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_133294870.1|3257098_3258409_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_023294142.1|3258655_3258940_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_115875916.1|3259312_3260596_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
3260627:3260641	attL	CTCACCTTTTTTATT	NA	NA	NA	NA
WP_115875917.1|3260640_3261393_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_133294871.1|3261706_3262636_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	86.1	3.0e-142
WP_143345732.1|3262946_3264113_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.1	1.3e-142
WP_143345357.1|3264113_3266249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345358.1|3266835_3267108_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	62.8	1.0e-26
WP_143345359.1|3267385_3270073_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	34.5	6.8e-110
WP_143345360.1|3270069_3270480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095753.1|3270469_3270709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172621919.1|3270705_3271296_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	58.1	8.9e-23
WP_044158865.1|3271386_3272391_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	45.5	1.1e-73
3271897:3271911	attR	CTCACCTTTTTTATT	NA	NA	NA	NA
WP_143345362.1|3272405_3273269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039263275.1|3273280_3273502_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	53.4	1.2e-12
WP_143345363.1|3274111_3275443_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_143345364.1|3275546_3276017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345365.1|3276031_3276487_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_143345366.1|3276486_3277032_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_143345367.1|3277009_3278095_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_143345368.1|3278058_3279813_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_143345369.1|3279900_3280326_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_136195513.1|3280353_3280776_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_101701094.1|3280775_3282044_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_136195515.1|3282074_3283676_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_143345370.1|3283675_3287143_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_143345371.1|3287139_3288348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136195518.1|3288463_3288931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345733.1|3288933_3291045_-	M23 family metallopeptidase	NA	Q5ZGC9	Flavobacterium_phage	50.0	1.8e-12
WP_143345372.1|3291166_3291394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345373.1|3291486_3291768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136195520.1|3291918_3292509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345374.1|3294723_3297075_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	3.7e-19
WP_136195522.1|3297071_3299726_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.7	4.5e-98
WP_023325816.1|3299881_3300373_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_136195523.1|3300377_3302084_-	OmpA family protein	NA	NA	NA	NA	NA
WP_136195524.1|3302080_3302770_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_136195525.1|3302766_3304107_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_AP019634	Enterobacter sp. 18A13	4652325	3854386	3897980	4652325	transposase,integrase,tRNA,protease	Bacillus_phage(50.0%)	41	3850522:3850536	3886375:3886389
3850522:3850536	attL	CATCTTGCTGGCTTC	NA	NA	NA	NA
WP_021242073.1|3854386_3854884_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_115876242.1|3854978_3855686_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_143345516.1|3855737_3856469_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_047173570.1|3856488_3857436_+	glutathione synthase	NA	NA	NA	NA	NA
WP_020883695.1|3857523_3858084_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_021242076.1|3858083_3858500_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_111963224.1|3858509_3859490_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_115876245.1|3859507_3860209_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_111963226.1|3860230_3860797_+	YggT family protein	NA	NA	NA	NA	NA
WP_023309131.1|3860793_3861090_+	YggU family protein	NA	NA	NA	NA	NA
WP_136195092.1|3861093_3861687_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_133295121.1|3861679_3862822_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_008499762.1|3862995_3863712_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003862421.1|3863768_3864095_-	YggL family protein	NA	NA	NA	NA	NA
WP_127732277.1|3864094_3864814_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_168708010.1|3864958_3866011_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_023309138.1|3866037_3866310_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_143345743.1|3866366_3867443_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_115876247.1|3867680_3868937_+	nucleoside permease	NA	NA	NA	NA	NA
WP_133295124.1|3869016_3869820_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_136195089.1|3869797_3870337_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_136195088.1|3870339_3871857_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_143345517.1|3871867_3872743_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_008499773.1|3872739_3873033_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_143345518.1|3873049_3874072_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_047173579.1|3874085_3874949_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_047173580.1|3874966_3876328_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_164850639.1|3876673_3878299_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_133295128.1|3878288_3878981_+	response regulator	NA	NA	NA	NA	NA
WP_143345520.1|3879035_3881171_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_047173584.1|3881352_3882066_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_123060776.1|3882430_3883684_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_123060777.1|3884544_3885660_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_123060778.1|3889180_3889528_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	3.8e-42
3886375:3886389	attR	GAAGCCAGCAAGATG	NA	NA	NA	NA
WP_164472293.1|3890244_3891108_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	1.6e-76
WP_164472294.1|3891083_3891590_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.5	2.1e-12
WP_123060994.1|3891787_3891922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123060995.1|3892082_3892307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345522.1|3893300_3893939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172621922.1|3896035_3896710_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_123060784.1|3897788_3897980_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP019635	Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence	150509	20024	32957	150509	transposase	Stx2-converting_phage(37.5%)	10	NA	NA
WP_172621944.1|20024_21252_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	1.7e-145
WP_172621907.1|22188_23529_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.7	1.8e-116
WP_143345840.1|25198_25477_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	43.3	3.9e-13
WP_143345773.1|25842_26337_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_143345774.1|26543_27173_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143345775.1|28985_30557_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.4	6.0e-175
WP_143345776.1|30576_30924_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	2.4e-44
WP_143345777.1|30920_31613_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	43.6	1.5e-16
WP_164472294.1|31611_32118_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.5	2.1e-12
WP_164472293.1|32093_32957_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	1.6e-76
>prophage 2
NZ_AP019635	Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence	150509	71357	138923	150509	integrase,transposase	Stx2-converting_phage(33.33%)	58	61801:61860	146625:147441
61801:61860	attL	TGATCTTACCCAGATAATGTGGACACCGCCCTAAGCGAGGTTCTGGTTTTCAAATTGTTC	NA	NA	NA	NA
WP_172621949.1|71357_71816_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	47.7	3.9e-26
WP_123061052.1|71815_72154_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0Z042	Pseudomonas_phage	58.6	9.0e-28
WP_123061053.1|72202_73105_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_123061085.1|73197_73356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345799.1|73593_74709_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143345844.1|75435_76872_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	23.2	4.7e-09
WP_172621950.1|76947_77175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345802.1|77937_78702_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	2.6e-14
WP_143345803.1|81606_83286_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_143345804.1|83296_83848_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_143345805.1|83900_84476_+	Ail/Lom family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_143345806.1|84605_93572_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.0	3.3e-52
WP_143345807.1|93568_93817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345808.1|93902_94397_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_172621957.1|94406_95072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172621958.1|95383_95998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345809.1|95994_96252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345810.1|96350_96935_+	adhesin	NA	NA	NA	NA	NA
WP_143345811.1|96931_97183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123061013.1|97619_98000_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_172621951.1|98052_98574_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.7	8.7e-06
WP_143345813.1|98728_99091_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143345814.1|99198_100110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143345815.1|100017_100887_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.8	8.2e-49
WP_143345847.1|100926_101289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172621952.1|101967_103186_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	84.1	2.9e-137
WP_123061055.1|103783_104356_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_123061056.1|104407_104989_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_143345818.1|105126_105366_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	66.1	5.4e-19
WP_123061058.1|105385_105649_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	45.5	2.2e-05
WP_123061086.1|105645_105843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345848.1|105847_106216_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	46.5	1.1e-23
WP_172621953.1|106938_107913_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	1.5e-83
WP_123061061.1|107912_109118_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	1.8e-163
WP_123061062.1|109357_109822_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_123060990.1|110527_110800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143345820.1|110826_113943_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_172621954.1|114037_114205_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_143345822.1|114201_115221_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_143345823.1|115908_116331_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	8.0e-26
WP_143345824.1|116469_117120_+	YceH family protein	NA	NA	NA	NA	NA
WP_123061088.1|117122_118046_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_123061066.1|118158_118449_-	Ail/Lom family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_143345825.1|119115_119448_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_143345826.1|119434_119815_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_143345827.1|120750_121239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143345828.1|123856_124843_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.0e-47
WP_123061072.1|126302_127133_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_143345829.1|127144_128569_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_143345774.1|130790_131420_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164472294.1|131720_132227_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.5	2.1e-12
WP_164472293.1|132202_133066_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	1.6e-76
WP_143345831.1|133113_133737_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	43.6	1.3e-16
WP_143345776.1|133733_134081_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	2.4e-44
WP_143345775.1|134100_135672_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.4	6.0e-175
WP_143345832.1|135882_136455_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143345833.1|137204_137843_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_143345834.1|138191_138923_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.2e-22
146625:147441	attR	GAACAATTTGAAAACCAGAACCTCGCTTAGGGCGGTGTCCACATTATCTGGGTAAGATCATCAACCCTAAAAACGAGTATTATACATCAAATTCAACTAATCAGAGGTATTACCCATTTTTGATAGAGTCCATTTTTAAAATTAAGTGGACTCTATCATCGTCGGATTAAAGGTTCGTCGACAGACGTCGCTGATGGGGCGCTTACACAGGTAATACCTCTATTTAATTACAACAAAATCATTTATAACTTCCATACACTGCATTTATAGCAATTTTTGCAGCATTTTTAATTATTGTTTCATCATGTTTATCGTTTTGATTAGTACGCGTTGTATACACAGCGATAACAGCAGGTGAATTGGAATCAGGCCATAAAATAGCAACATCATTAGCTGTACCATAGAAACCACAGGTGCCTGTTTTATCGCCAACAACCCATTTATCAGGAACTGCGGCTCTGACTCGCGCATTGCCAGTCGTGTTTCCTTGAAGCCAATCCTGCAGTAAGGCTTTATTTTTAGCATCAAGTACAGAACCAAATGCAATATTTTTTAGGCTCATTGCTACTGCTTTCGGAGTTGAAGTATCACGTTTATCGCCTGGAATAGCTGAGTTTAATTCTAACTCCCAGCGATCAAGCCTGAACTCCGTGTCTCCCGTTGATCGCATAAATGCAGTCAAACCTTCAGGACCTCCGACGTATCTTTCCATTAATAGATTAGACGCTCCATTATCACTGTACTGAATTGCTGCCATAGCCAAAGTCTGAACGCTTGCACCCGTTTCTAGGTATTTTTCTGATACAGGAGAATGCTT	NA	NA	NA	NA
