The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	1993097	2003173	4643312	holin,lysis,terminase,tail	Enterobacteria_phage(63.64%)	12	NA	NA
WP_048979547.1|1993097_1993322_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	62.3	3.1e-21
WP_048979550.1|1993710_1994322_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	83.0	1.2e-94
WP_075204790.1|1994312_1994519_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	78.5	2.3e-26
WP_048979564.1|1994521_1994884_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	80.5	2.6e-49
WP_048979551.1|1994880_1995714_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	77.6	5.3e-122
WP_048979552.1|1996494_1996713_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	98.6	1.7e-32
WP_048979553.1|1996696_1997191_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	89.6	1.2e-84
WP_048979554.1|1997187_1997649_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	66.7	1.7e-45
WP_065419808.1|1998592_1998766_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_143346011.1|1998844_1999846_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	47.6	2.9e-42
WP_096151461.1|2001204_2002602_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	58.9	8.0e-139
WP_048980395.1|2002753_2003173_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	8.5e-36
>prophage 2
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	2086208	2096282	4643312		Oenococcus_phage(16.67%)	9	NA	NA
WP_032657497.1|2086208_2087423_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.2	1.1e-46
WP_048980514.1|2087437_2088457_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.0	1.0e-18
WP_048980516.1|2088530_2089898_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_048980518.1|2090117_2091581_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.0	5.1e-43
WP_014883679.1|2091624_2091828_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_048980520.1|2092116_2092548_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.2	9.7e-19
WP_023311557.1|2092581_2093268_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143346014.1|2093359_2094106_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_048980524.1|2094248_2096282_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.5	2.1e-18
>prophage 3
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	2693696	2771076	4643312	protease,integrase,terminase,head,portal,holin,capsid,tRNA,tail	Enterobacteria_phage(17.78%)	89	2729923:2729953	2771204:2771234
WP_048979885.1|2693696_2694392_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_039263631.1|2694458_2696369_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.3	2.7e-89
WP_023312193.1|2696502_2696847_+	RidA family protein	NA	NA	NA	NA	NA
WP_048979887.1|2696853_2697039_-	YoaH family protein	NA	NA	NA	NA	NA
WP_048979889.1|2697100_2698426_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	44.7	2.4e-47
WP_023312196.1|2698432_2699011_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_023312197.1|2699195_2700560_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_048979890.1|2700690_2702289_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_033145827.1|2702295_2703855_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	2.3e-41
WP_032658500.1|2704318_2705284_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_008500490.1|2705330_2706131_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_006810994.1|2706143_2706995_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_045887985.1|2707049_2707508_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_029741998.1|2707906_2708473_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_048979894.1|2708469_2709285_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_075204799.1|2709350_2711057_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2711288_2711498_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_048979897.1|2712181_2713171_-	MBL fold hydrolase	NA	NA	NA	NA	NA
WP_048979899.1|2713192_2713483_-	YebO family protein	NA	NA	NA	NA	NA
WP_006175995.1|2713557_2713701_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_033145832.1|2713863_2714103_+	membrane protein	NA	NA	NA	NA	NA
WP_023312208.1|2714171_2714963_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_048979900.1|2715142_2716516_+	MFS transporter	NA	NA	NA	NA	NA
WP_014884290.1|2716566_2717448_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_029741991.1|2717641_2719690_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.7	5.4e-83
WP_023336085.1|2719709_2720396_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013096117.1|2720492_2720990_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023312213.1|2721122_2722406_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_048979903.1|2722374_2725008_+	PqiB family protein	NA	NA	NA	NA	NA
WP_048979905.1|2725085_2726528_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_008500472.1|2726634_2726874_+	YebV family protein	NA	NA	NA	NA	NA
WP_048979907.1|2726908_2727553_-	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	48.6	2.5e-55
WP_048979909.1|2727718_2728660_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_048979915.1|2728833_2729730_+	benzoate transporter	NA	M1HZA4	Paramecium_bursaria_Chlorella_virus	33.7	9.1e-27
2729923:2729953	attL	CAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_143346037.1|2730370_2731681_-|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	60.5	9.5e-142
WP_143346038.1|2731812_2732181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346039.1|2732145_2732787_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	87.8	8.0e-110
WP_143346040.1|2732783_2733092_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	72.5	3.9e-38
WP_143346041.1|2733085_2736259_-	host specificity protein J	NA	O64335	Escherichia_phage	86.7	0.0e+00
WP_143346042.1|2736309_2736900_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	88.8	1.5e-94
WP_143346043.1|2736933_2737164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346044.1|2737181_2737544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346045.1|2737574_2738285_-	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	93.2	5.7e-141
WP_143346046.1|2738286_2739042_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	90.4	4.2e-134
WP_073000708.1|2739038_2739377_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	72.3	9.5e-46
WP_143346047.1|2739379_2742694_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	60.8	0.0e+00
WP_073000714.1|2742926_2743289_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	50.9	6.4e-24
WP_143346048.1|2743348_2743801_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	77.7	9.1e-60
WP_073000719.1|2743831_2744236_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	71.8	1.8e-43
WP_073000721.1|2744232_2744622_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	62.0	3.0e-43
WP_073000723.1|2744602_2744947_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	52.7	7.2e-25
WP_143346049.1|2744943_2745270_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	86.1	2.1e-50
WP_143346050.1|2745312_2746524_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	83.5	4.7e-188
WP_143346051.1|2746533_2747382_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	6.4e-139
WP_143346052.1|2747395_2748700_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.8	3.0e-220
WP_143346053.1|2748699_2750442_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	4.1e-140
WP_047174718.1|2750395_2750860_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_143346055.1|2751333_2751924_-	hypothetical protein	NA	S4TR53	Salmonella_phage	73.8	6.3e-85
WP_143346056.1|2751905_2753363_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	86.0	7.3e-260
WP_139295520.1|2753383_2753626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346057.1|2753672_2754089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346058.1|2754123_2754804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346059.1|2754851_2756372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073001937.1|2756391_2756592_-	hypothetical protein	NA	A0A2P0PAP7	Pectobacterium_phage	34.8	1.4e-09
WP_143346060.1|2756662_2757019_-	serine/threonine protein kinase	NA	A0A088FWP5	Lelliottia_phage	56.5	9.7e-33
WP_073001941.1|2757018_2757342_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	54.4	6.8e-25
WP_143346061.1|2757338_2757665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346062.1|2757845_2758409_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	59.0	7.1e-54
WP_143346063.1|2758405_2758711_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	54.3	6.6e-22
WP_143346064.1|2759488_2759641_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_172620283.1|2760351_2760525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346065.1|2760527_2760863_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	61.8	1.1e-12
WP_172620301.1|2760859_2761069_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	79.7	1.0e-26
WP_143346067.1|2761086_2761449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346068.1|2761445_2761736_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	57.5	9.1e-21
WP_172620284.1|2761931_2762627_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_143346070.1|2762638_2763379_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	67.9	2.6e-96
WP_143346071.1|2763381_2764284_-	conserved phage C-terminal domain-containing protein	NA	Q8HA96	Salmonella_phage	67.3	4.5e-34
WP_143346072.1|2764294_2764720_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	50.7	5.8e-24
WP_143346073.1|2764719_2764971_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	50.7	1.7e-15
WP_143346074.1|2765080_2765461_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143346075.1|2765779_2765974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346076.1|2765924_2766116_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_143346077.1|2766181_2766448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346078.1|2766910_2768857_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	31.8	2.3e-35
WP_073001979.1|2769070_2769373_+	hypothetical protein	NA	A0A248XD88	Klebsiella_phage	49.4	5.4e-16
WP_073001981.1|2769350_2769590_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_143346207.1|2769758_2770019_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	3.3e-14
WP_143346079.1|2769996_2771076_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.6	2.5e-108
2771204:2771234	attR	CAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 4
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	2822488	2896136	4643312	coat,integrase,plate,terminase,head,portal,capsid,tail	Enterobacteria_phage(33.33%)	81	2830139:2830155	2897351:2897367
WP_033145871.1|2822488_2823451_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_048979942.1|2823447_2825832_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_048979944.1|2825807_2826563_-	molecular chaperone	NA	NA	NA	NA	NA
WP_039263671.1|2826579_2827128_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023312260.1|2827140_2827713_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_143346080.1|2828142_2829408_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023312262.1|2829512_2830016_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_048979946.1|2830035_2832072_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
2830139:2830155	attL	GAAATACCCGGCACTTT	NA	NA	NA	NA
WP_032658606.1|2832076_2833006_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_008500417.1|2833002_2833890_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_013096051.1|2834013_2834592_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_028015873.1|2834594_2834954_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_033145878.1|2835739_2836168_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_048979948.1|2836183_2837608_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_033145880.1|2837582_2838386_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_029742191.1|2838562_2839549_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_029742192.1|2839563_2841078_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.4e-11
WP_003859687.1|2841149_2842139_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_023312270.1|2842926_2843430_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_023312271.1|2843585_2844929_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_008500405.1|2844971_2845223_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_014884364.1|2845331_2845415_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_023336145.1|2845649_2845988_+	lipoprotein	NA	NA	NA	NA	NA
WP_023336146.1|2846192_2846690_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_033145882.1|2846726_2847068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048979950.1|2847297_2848509_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_053085579.1|2848629_2850003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023333978.1|2850002_2850260_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_048979952.1|2850365_2850929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048979953.1|2850931_2851639_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.2	1.5e-05
WP_101744597.1|2851642_2852338_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	27.8	6.2e-07
WP_101744598.1|2852341_2853037_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.7	3.1e-06
WP_143346081.1|2853033_2853666_-	DUF3274 domain-containing protein	NA	NA	NA	NA	NA
WP_143346082.1|2853611_2854961_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_048980138.1|2855341_2856010_-	YecA family protein	NA	NA	NA	NA	NA
WP_033145885.1|2856433_2857555_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033145886.1|2857654_2858569_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_048980136.1|2858580_2859855_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_048980134.1|2859851_2860727_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_033145889.1|2860723_2861440_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.0e-12
WP_139153138.1|2861608_2861956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346208.1|2863059_2863524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346083.1|2863790_2864039_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_143346084.1|2864087_2865239_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	78.1	5.0e-171
WP_008500387.1|2865390_2866572_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.6	7.2e-157
WP_010835090.1|2866572_2867088_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.6	1.5e-63
WP_063618078.1|2867142_2867442_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	73.7	4.5e-31
WP_050546702.1|2867489_2867615_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	61.8	2.1e-06
WP_143346085.1|2867604_2870544_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	81.3	1.3e-242
WP_143346086.1|2870553_2871042_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	64.8	6.6e-56
WP_143346087.1|2871091_2871691_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	54.3	3.5e-51
WP_143346088.1|2871690_2872953_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	79.4	7.8e-109
WP_143346089.1|2872942_2873557_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	59.1	5.9e-70
WP_143346090.1|2873549_2874446_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.1	2.7e-103
WP_143346091.1|2874432_2874801_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.5	1.9e-31
WP_143346092.1|2874797_2875382_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.3	1.3e-61
WP_143346093.1|2875381_2876023_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	47.3	3.8e-43
WP_032646275.1|2876019_2876469_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.3	3.4e-30
WP_143346094.1|2876610_2877006_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_143346095.1|2877002_2877554_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.2	7.0e-30
WP_000420349.1|2877550_2877832_-	hypothetical protein	NA	B9A7B8	Serratia_phage	50.6	1.0e-16
WP_023305073.1|2877822_2878023_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.9e-15
WP_023305074.1|2878022_2878520_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.3	4.2e-58
WP_143346209.1|2878623_2879487_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	72.3	1.5e-90
WP_143346096.1|2879533_2880583_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.6	3.0e-106
WP_126533643.1|2880606_2881440_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.4	2.3e-93
WP_143346097.1|2881600_2883322_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.5	8.2e-226
WP_143346098.1|2883324_2884377_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.5	7.9e-139
WP_143346099.1|2885098_2885533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172620286.1|2885534_2888222_+	ParA family protein	NA	NA	NA	NA	NA
WP_143346210.1|2888352_2890773_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	36.8	1.8e-133
WP_171860840.1|2890809_2890983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346101.1|2890982_2891945_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	44.7	3.5e-61
WP_155574703.1|2891937_2892105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346102.1|2892185_2892467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268409.1|2892466_2892649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126533636.1|2892678_2892882_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_071530941.1|2893193_2893586_+	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	43.8	1.5e-10
WP_143346104.1|2893595_2894225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346105.1|2894253_2895132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346106.1|2895128_2896136_+|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	57.9	8.4e-106
2897351:2897367	attR	GAAATACCCGGCACTTT	NA	NA	NA	NA
>prophage 5
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	3016291	3024238	4643312		Escherichia_phage(33.33%)	7	NA	NA
WP_048980183.1|3016291_3017395_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.1	3.0e-40
WP_048980181.1|3017850_3018246_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_048980180.1|3018249_3019113_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.8	1.0e-112
WP_048980178.1|3019112_3020198_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.8	5.7e-100
WP_032641615.1|3020550_3021447_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
WP_048980177.1|3021662_3022658_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	30.7	2.1e-08
WP_048980176.1|3022840_3024238_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
>prophage 6
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	3527420	3604252	4643312	lysis,integrase,plate,terminase,head,portal,capsid,tRNA,tail	Salmonella_phage(73.33%)	77	3541350:3541365	3606574:3606589
WP_014832949.1|3527420_3528188_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_029741020.1|3528219_3528759_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3528774_3529023_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014884878.1|3529139_3530501_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014884879.1|3530667_3531459_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025759264.1|3531478_3532765_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023333122.1|3532816_3533410_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3533532_3534411_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_039263457.1|3534496_3536158_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_008502502.1|3536296_3536635_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_048979774.1|3536738_3537026_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023308885.1|3537015_3537492_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3537609_3538092_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_143346130.1|3539054_3540176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346132.1|3540168_3541932_-	AAA family ATPase	NA	NA	NA	NA	NA
3541350:3541365	attL	GGCGTTCGTCACTTTT	NA	NA	NA	NA
WP_143346133.1|3541931_3543869_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_143346135.1|3543865_3546325_-	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	29.8	2.0e-20
WP_143346136.1|3546345_3549075_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	25.2	1.5e-11
WP_143346137.1|3549071_3549275_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	46.8	9.8e-14
WP_143346138.1|3550207_3551446_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.1	8.2e-103
WP_143346139.1|3551517_3556488_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_143346140.1|3556585_3557392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032708920.1|3557496_3559446_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_143346141.1|3559438_3561751_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_143346142.1|3562261_3563503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021539885.1|3563663_3563876_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	41.7	7.9e-06
WP_143346143.1|3564007_3565570_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_109948934.1|3565948_3566536_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_109948925.1|3567190_3567625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346144.1|3567684_3568524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041412185.1|3568582_3568774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346145.1|3569187_3570009_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	7.5e-44
WP_134871855.1|3570039_3570483_+	antirestriction protein	NA	NA	NA	NA	NA
WP_143346146.1|3570495_3571038_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_109948919.1|3571034_3571256_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_143346147.1|3571281_3571647_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_143346148.1|3571685_3572015_+	toxin	NA	NA	NA	NA	NA
WP_045334934.1|3572333_3572552_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
WP_007848866.1|3573211_3574384_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
WP_143346149.1|3574581_3575628_+	acyltransferase	NA	G9L6E5	Escherichia_phage	26.3	6.7e-13
WP_143346150.1|3575619_3576222_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	66.5	8.1e-72
WP_143346151.1|3576221_3577613_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	40.2	8.1e-91
WP_143346152.1|3577609_3578215_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	91.0	8.3e-109
WP_039263450.1|3578207_3579116_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_039025354.1|3579102_3579462_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.3	9.5e-52
WP_143346153.1|3579458_3580037_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	5.3e-105
WP_143346154.1|3580122_3581328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346155.1|3581383_3581830_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	8.1e-61
WP_143346156.1|3581822_3582254_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.3e-68
WP_143346158.1|3582349_3582778_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	83.6	3.4e-56
WP_143346159.1|3582774_3583296_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	2.4e-72
WP_014884902.1|3583276_3583492_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_094464777.1|3583495_3583699_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_143346160.1|3583698_3584166_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_017441509.1|3584264_3584918_-|terminase	terminase	terminase	E5G6M7	Salmonella_phage	55.7	6.8e-56
WP_016150809.1|3584921_3586070_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_143346161.1|3586086_3586914_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.4	4.1e-74
WP_143346162.1|3587063_3588827_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.4	2.9e-311
WP_143346163.1|3588826_3589882_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	78.4	5.5e-156
WP_142431654.1|3589929_3592122_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_142431653.1|3592114_3593197_-	AAA family ATPase	NA	M4QMW8	Micromonas_pusilla_virus	32.9	1.9e-15
WP_143346164.1|3593674_3594415_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	72.8	2.4e-102
WP_143346165.1|3594486_3594747_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	61.5	8.1e-21
WP_017382383.1|3594820_3595054_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
WP_014884914.1|3595064_3595253_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
WP_143346167.1|3595412_3596108_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	75.0	1.3e-94
WP_143346168.1|3596259_3598563_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	63.0	8.5e-271
WP_143346169.1|3598605_3599463_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.9	1.1e-117
WP_045334062.1|3599459_3599687_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	78.7	1.2e-28
WP_014884920.1|3599686_3599920_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	67.5	8.1e-20
WP_014884921.1|3599989_3600190_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	73.8	3.0e-23
WP_143346170.1|3600176_3600404_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	70.7	2.0e-23
WP_143346171.1|3600411_3600921_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	88.2	7.6e-79
WP_014884924.1|3600953_3601196_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_143346172.1|3601315_3601948_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	60.0	6.3e-67
WP_143346173.1|3601950_3602970_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.6	2.3e-188
WP_143346174.1|3602971_3604252_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	37.4	8.6e-71
3606574:3606589	attR	GGCGTTCGTCACTTTT	NA	NA	NA	NA
>prophage 7
NZ_AP019630	Enterobacter asburiae strain 17Nkhm-UP2	4643312	3991243	4051197	4643312	lysis,plate,holin,tRNA,tail	Erwinia_phage(38.89%)	65	NA	NA
WP_029741753.1|3991243_3992257_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.8e-109
WP_001144069.1|3992493_3992709_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023333458.1|3992824_3994570_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_023309228.1|3994723_3996571_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_023309229.1|3996672_3997179_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_029741756.1|3997461_3997662_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
WP_048979131.1|3997729_3998884_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.0	1.5e-130
WP_023309232.1|3998880_3999345_-|tail	phage tail protein	tail	O80317	Escherichia_phage	66.7	6.9e-55
WP_023616176.1|4001628_4001748_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_047060341.1|4001780_4002089_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	4.5e-26
WP_023309235.1|4002145_4002664_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
WP_047060339.1|4002675_4003863_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	6.1e-188
WP_033146684.1|4003921_4004515_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	75.0	1.4e-79
WP_065419813.1|4004586_4005057_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	63.6	1.2e-49
WP_048980215.1|4005056_4005653_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	58.9	4.7e-64
WP_029742197.1|4005636_4006032_-|tail	tail fiber assembly protein	tail	A0A2P1JUG3	Erwinia_phage	35.4	3.6e-12
WP_143346186.1|4006040_4007015_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	56.7	3.8e-87
WP_039260511.1|4007011_4007620_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	88.6	9.9e-102
WP_048981247.1|4007612_4008521_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	85.8	1.4e-139
WP_033146688.1|4008526_4008877_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	69.8	5.2e-39
WP_048981246.1|4008873_4009515_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	2.3e-88
WP_048981245.1|4009627_4010095_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.9	4.0e-50
WP_071994440.1|4010057_4010231_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	74.5	8.1e-17
WP_080973640.1|4010190_4010718_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	57.5	7.2e-32
WP_048981243.1|4010612_4011122_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.1	3.3e-74
WP_029741404.1|4011105_4011327_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
WP_023309248.1|4011317_4011521_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
WP_048981242.1|4011700_4012141_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.2	5.2e-52
WP_143346187.1|4012250_4014440_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.2	0.0e+00
WP_045404086.1|4014441_4014663_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.2e-25
WP_029741400.1|4014662_4014890_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	9.9e-15
WP_033146696.1|4014958_4015297_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	73.9	5.1e-39
WP_047060318.1|4015524_4016100_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	1.7e-66
WP_033146698.1|4016382_4017552_+	DNA repair protein	NA	NA	NA	NA	NA
WP_048981239.1|4017552_4018317_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_029741394.1|4018463_4018958_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101744686.1|4018954_4020514_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.4e-11
WP_048981235.1|4020850_4022371_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	1.9e-32
WP_048981233.1|4022806_4024186_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.6e-33
WP_039260488.1|4024269_4024872_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033146704.1|4024914_4025601_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_048981231.1|4025613_4026462_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_033146706.1|4026517_4026811_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_048981229.1|4026807_4027695_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_143346188.1|4027706_4028708_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_048981228.1|4028709_4029687_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_048981226.1|4029687_4030719_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_048981224.1|4030715_4032203_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	25.9	5.9e-07
WP_039260477.1|4032418_4033390_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_069303331.1|4033422_4035021_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_048981220.1|4035227_4037249_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_048981218.1|4037369_4038506_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_023333531.1|4038589_4039093_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_048981216.1|4039163_4040162_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_029739669.1|4040413_4041382_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.8	1.5e-35
WP_029739668.1|4041601_4042843_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_048981215.1|4042978_4044466_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_048981213.1|4044483_4045896_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023309287.1|4046371_4047670_+	MFS transporter	NA	NA	NA	NA	NA
WP_023309288.1|4047785_4048562_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_024906405.1|4048906_4049569_+	DedA family protein	NA	NA	NA	NA	NA
WP_048981211.1|4049571_4049955_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_023309291.1|4050097_4050466_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_008503141.1|4050497_4050803_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_023333540.1|4050804_4051197_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NZ_AP019631	Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence	125013	60377	106277	125013	coat,transposase,integrase	Virus_Rctr85(33.33%)	36	43240:43255	69865:69880
43240:43255	attL	TCTCGATGCAGCTGCC	NA	NA	NA	NA
WP_143346254.1|60377_61367_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	1.3e-47
WP_143346255.1|61791_62262_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143346256.1|63099_64146_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_172620306.1|64177_65128_+	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_143346258.1|65339_65783_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_143346259.1|65789_67286_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_143346260.1|67484_68345_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	22.1	1.4e-08
WP_143346261.1|70157_70778_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
69865:69880	attR	TCTCGATGCAGCTGCC	NA	NA	NA	NA
WP_143346262.1|70840_72943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346263.1|73068_75723_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_143346264.1|76196_77060_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088245210.1|77434_78319_+	carbapenem-hydrolyzing class A beta-lactamase FRI-4	NA	A0A1B0VBP7	Salmonella_phage	43.5	2.0e-58
WP_143346265.1|78556_79495_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_172620307.1|79517_81770_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_143346267.1|81877_82621_-	molecular chaperone	NA	NA	NA	NA	NA
WP_143346268.1|82623_83112_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_143346269.1|84376_85141_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_143346270.1|85179_87696_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_164850603.1|87738_88167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346271.1|88270_88777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346272.1|88840_89326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346273.1|89500_90082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172620305.1|91160_91679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346274.1|92756_93254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346275.1|93652_94729_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143346276.1|96055_97024_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143346277.1|97628_98960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620308.1|99525_100005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620309.1|100010_100772_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143346280.1|100861_101374_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143346281.1|101675_102185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346282.1|102218_102791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164850603.1|102894_103323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620312.1|103460_103760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346269.1|103759_104524_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_143346268.1|105788_106277_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
