The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019632	Enterobacter asburiae strain 1808-013	4639748	533260	600956	4639748	plate,tail,holin,integrase,tRNA	Erwinia_phage(41.03%)	72	542996:543017	600970:600991
WP_023333540.1|533260_533653_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_008503141.1|533654_533960_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_023309291.1|533991_534360_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_039260467.1|534502_534886_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_024906405.1|534888_535551_-	DedA family protein	NA	NA	NA	NA	NA
WP_023309288.1|535895_536672_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_023309287.1|536787_538086_-	MFS transporter	NA	NA	NA	NA	NA
WP_143346442.1|538561_539974_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_143346443.1|539991_541479_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_087823155.1|541571_542813_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
542996:543017	attL	ACCCTCTCCCTGTGGGAGAGGG	NA	NA	NA	NA
WP_143346444.1|543032_544001_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	33.9	2.0e-35
WP_143346445.1|544252_545251_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023333531.1|545321_545825_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023333530.1|545908_547045_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_064673351.1|547165_549187_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_143346446.1|549326_550925_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_039260477.1|550957_551929_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_143347748.1|552144_553632_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	25.4	2.3e-06
WP_143346447.1|553628_554660_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_143346448.1|554660_555638_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_033146708.1|555639_556641_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_143346449.1|556652_557540_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_008503162.1|557536_557830_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_033146705.1|557885_558734_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_094934448.1|558746_559433_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_143346450.1|559475_560078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172620500.1|560161_561541_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.0e-33
WP_143346452.1|561976_563497_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	3.2e-32
WP_143346453.1|563834_565394_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.4e-12
WP_143346454.1|565390_565885_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143346455.1|566032_566797_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_143346456.1|566797_567967_-	DNA repair protein	NA	NA	NA	NA	NA
WP_047060318.1|568249_568825_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	1.7e-66
WP_033146696.1|569052_569391_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	73.9	5.1e-39
WP_143346457.1|569459_569687_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	1.3e-14
WP_087823171.1|569686_569908_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.2e-25
WP_143346458.1|569909_572099_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.5	0.0e+00
WP_048981242.1|572208_572649_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.2	5.2e-52
WP_047174529.1|572828_573032_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	70.1	2.6e-22
WP_029741404.1|573022_573244_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
WP_047060325.1|573227_573737_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.7	2.5e-74
WP_080958264.1|573631_574159_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	57.5	7.2e-32
WP_143346459.1|574254_574722_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	60.6	7.5e-49
WP_094934442.1|574834_575476_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	1.9e-87
WP_033146688.1|575472_575823_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	69.8	5.2e-39
WP_033146687.1|575828_576737_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	86.4	4.3e-141
WP_047060334.1|576729_577338_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	89.1	1.5e-102
WP_143346460.1|577334_578420_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	65.8	1.7e-120
WP_033146685.1|578419_579019_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	54.3	2.4e-55
WP_033146686.1|579105_579300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033146684.1|579699_580293_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	75.0	1.4e-79
WP_047060339.1|580351_581539_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	6.1e-188
WP_023309235.1|581550_582069_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
WP_143346461.1|582125_582434_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	65.3	9.0e-27
WP_023616176.1|582466_582586_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_143346462.1|582578_584858_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.6	4.7e-128
WP_029741758.1|584869_585334_+|tail	phage tail protein	tail	O80317	Escherichia_phage	67.9	1.8e-55
WP_047646373.1|585330_586485_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.0	1.9e-130
WP_143346463.1|586552_586753_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.2	1.8e-20
WP_143346464.1|586971_588771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346465.1|588767_589805_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.0	1.4e-116
WP_143346466.1|589808_590375_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.1e-17
WP_143346467.1|590391_590973_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	37.2	8.2e-29
WP_143346468.1|591116_591338_+	regulator	NA	NA	NA	NA	NA
WP_143346469.1|591368_591872_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	68.9	1.8e-56
WP_143346470.1|591881_592070_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	52.6	2.8e-07
WP_143346471.1|594305_594677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023309229.1|595021_595528_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023309228.1|595628_597476_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_023333458.1|597629_599375_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|599490_599706_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_029741753.1|599942_600956_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.8e-109
600970:600991	attR	CCCTCTCCCACAGGGAGAGGGT	NA	NA	NA	NA
>prophage 2
NZ_AP019632	Enterobacter asburiae strain 1808-013	4639748	1377669	1418832	4639748	tail,portal,head,protease,holin,capsid,terminase,integrase	Enterobacterial_phage(29.55%)	55	1374879:1374894	1397060:1397075
1374879:1374894	attL	CAGCTCATCCACCAGC	NA	NA	NA	NA
WP_033146052.1|1377669_1378173_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_008500962.1|1378382_1378643_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_039263195.1|1378781_1379969_+	MFS transporter	NA	NA	NA	NA	NA
WP_143346679.1|1380184_1381363_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	29.8	6.8e-30
WP_032659100.1|1381364_1381574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346680.1|1381605_1381875_-	YeaH/YhbH family protein	NA	K7PKM4	Enterobacterial_phage	85.4	4.9e-37
WP_143346681.1|1381941_1382223_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	70.7	5.0e-32
WP_143346682.1|1382222_1382864_-	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	46.4	2.3e-24
WP_143346683.1|1382856_1383423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346684.1|1383739_1383958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143346685.1|1383954_1384785_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.5	2.7e-126
WP_143346687.1|1385957_1386275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172620534.1|1386538_1387249_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	34.7	5.1e-25
WP_073961581.1|1387327_1387597_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	42.5	1.3e-08
WP_059290948.1|1387616_1388087_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	98.1	1.8e-79
WP_074134593.1|1388328_1388541_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	1.3e-13
WP_143346689.1|1388497_1389424_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	58.1	7.3e-72
WP_143346690.1|1389420_1389915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346691.1|1389914_1390574_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.0	9.1e-101
WP_143346692.1|1390570_1390819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346693.1|1390815_1391136_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	74.5	5.7e-40
WP_143344961.1|1391132_1391522_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.9	7.8e-68
WP_143346694.1|1391518_1392508_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	94.2	1.2e-186
WP_143346695.1|1392522_1392885_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	86.7	2.9e-56
WP_143346696.1|1392926_1393742_-	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	61.0	1.7e-88
WP_135346114.1|1393986_1394382_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_143346697.1|1394368_1394674_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	94.6	6.2e-44
WP_143346698.1|1394651_1395194_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	72.6	1.2e-77
WP_143346699.1|1395190_1395460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143346700.1|1395416_1395617_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.4	4.6e-16
WP_143346701.1|1395971_1396154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143347757.1|1396166_1397624_+	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	88.5	1.4e-263
1397060:1397075	attR	GCTGGTGGATGAGCTG	NA	NA	NA	NA
WP_071925305.1|1397630_1398140_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.8	2.5e-45
WP_143346702.1|1398120_1398711_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	86.7	2.4e-100
WP_143346703.1|1398710_1399061_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.5e-51
WP_086538230.1|1399218_1399692_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	96.2	3.3e-84
WP_143346704.1|1399691_1401428_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_071283826.1|1401427_1402732_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.2	1.5e-235
WP_143346705.1|1402745_1403594_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	8.3e-139
WP_143346706.1|1403603_1404815_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.9	1.1e-195
WP_143346707.1|1404858_1405185_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	89.8	3.9e-52
WP_143346708.1|1405248_1405461_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	61.1	4.0e-10
WP_143346709.1|1405462_1405795_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	81.8	5.0e-47
WP_143346710.1|1405787_1406273_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	56.2	2.6e-44
WP_143346711.1|1406269_1406638_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	68.0	6.3e-43
WP_143346712.1|1406691_1407174_+|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	58.3	3.1e-50
WP_143347758.1|1407222_1407603_+|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	72.6	3.8e-43
WP_143346713.1|1407614_1407869_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	65.1	5.7e-27
WP_143346714.1|1407872_1410431_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	48.2	3.5e-180
WP_143346715.1|1410430_1410904_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.7	2.8e-51
WP_143346716.1|1410900_1411383_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	75.0	6.1e-62
WP_143346717.1|1411392_1411773_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	75.4	4.8e-54
WP_143346718.1|1411769_1414847_+	kinase	NA	A0A286S259	Klebsiella_phage	50.0	4.6e-288
WP_143346719.1|1414901_1416869_+	SGNH/GDSL hydrolase family protein	NA	A0A2I7S6N3	Vibrio_phage	29.8	3.0e-59
WP_143346720.1|1416912_1418832_+	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	37.1	8.2e-118
>prophage 3
NZ_AP019632	Enterobacter asburiae strain 1808-013	4639748	2415769	2425843	4639748		Klosneuvirus(16.67%)	9	NA	NA
WP_143347081.1|2415769_2417803_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.3	5.1e-17
WP_023292548.1|2417945_2418692_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_023311557.1|2418783_2419470_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033145406.1|2419503_2419935_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.9	4.4e-19
WP_014883679.1|2420223_2420427_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_143347082.1|2420470_2421934_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	2.1e-44
WP_143347083.1|2422153_2423521_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_143347084.1|2423594_2424614_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.2	1.3e-18
WP_032657497.1|2424628_2425843_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.2	1.1e-46
>prophage 4
NZ_AP019632	Enterobacter asburiae strain 1808-013	4639748	2466091	2545614	4639748	terminase,protease,tail	Enterobacteria_phage(20.0%)	83	NA	NA
WP_045888859.1|2466091_2466913_+|protease	serine protease	protease	NA	NA	NA	NA
WP_143347105.1|2466914_2469077_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	28.1	2.8e-13
WP_024909144.1|2469160_2469490_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_029739354.1|2469476_2469839_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_033145372.1|2470261_2471296_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_143347106.1|2471394_2472420_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094935347.1|2472615_2473509_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003857471.1|2473586_2473934_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_143347107.1|2473962_2474748_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_029739347.1|2474872_2475568_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	1.4e-27
WP_143347108.1|2475564_2476761_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_143347109.1|2476839_2477988_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_143347110.1|2477984_2481062_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_143347111.1|2481084_2481852_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_143347112.1|2481948_2483388_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_064672935.1|2483359_2484244_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143347113.1|2484379_2485360_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_143347115.1|2485399_2486455_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_143347116.1|2486552_2487440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033145359.1|2487523_2487793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143347117.1|2487805_2489068_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	69.2	1.1e-168
WP_029740280.1|2489051_2489486_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	5.2e-36
WP_023311485.1|2489773_2489974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094935358.1|2490019_2490886_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_069302722.1|2491030_2492692_+	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_094935359.1|2492719_2493283_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_069302720.1|2493638_2494550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094935360.1|2494725_2496036_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_048980415.1|2497522_2499049_+	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_045888966.1|2499059_2499575_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	44.7	1.1e-24
WP_006174991.1|2499758_2500511_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_008500541.1|2500644_2500839_+	hypothetical protein	NA	K7PGY7	Enterobacteria_phage	58.1	1.5e-11
WP_023335478.1|2500948_2501899_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_024909329.1|2502019_2503408_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_023311474.1|2503418_2504948_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_033145347.1|2505483_2506428_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_029740292.1|2506613_2507996_+	amino acid permease	NA	NA	NA	NA	NA
WP_033145346.1|2508035_2508758_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_028017326.1|2508754_2509090_-	GlpM family protein	NA	NA	NA	NA	NA
WP_021241154.1|2509218_2509935_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_033145345.1|2510188_2510449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039262729.1|2510871_2511546_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.7	5.3e-80
WP_172620538.1|2511597_2511798_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_143347118.1|2512097_2512316_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	64.2	2.4e-18
WP_039262731.1|2512871_2513099_+	phage protein	NA	NA	NA	NA	NA
WP_127353291.1|2513271_2513610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039262732.1|2513986_2515255_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.5e-229
WP_039262733.1|2515257_2515677_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	2.2e-36
WP_143347120.1|2515849_2517091_-|tail	tail fiber domain-containing protein	tail	K7P7B1	Enterobacteria_phage	82.0	3.3e-75
WP_039262735.1|2517490_2518168_-	hypothetical protein	NA	O64337	Escherichia_phage	95.6	1.2e-116
WP_039262736.1|2518167_2518470_-	hypothetical protein	NA	O64336	Escherichia_phage	93.0	5.3e-48
WP_143347121.1|2518469_2521655_-	host specificity protein J	NA	O64335	Escherichia_phage	86.8	0.0e+00
WP_143347774.1|2521708_2522425_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_172620539.1|2522478_2523057_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	63.5	3.7e-58
WP_126327719.1|2523175_2523787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136431267.1|2523823_2524537_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	85.9	1.9e-128
WP_143347123.1|2524538_2525294_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	78.8	3.2e-118
WP_126327716.1|2525290_2525638_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	2.6e-38
WP_047652153.1|2525702_2526059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143347124.1|2526178_2529091_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	35.9	8.9e-132
WP_101744537.1|2529090_2529402_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	63.3	1.1e-16
WP_143347125.1|2529398_2529710_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.9	4.8e-36
WP_143347127.1|2529774_2530446_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.3	4.7e-52
WP_143347128.1|2530512_2530923_-	DUF4128 domain-containing protein	NA	I6PDJ8	Cronobacter_phage	52.2	2.0e-34
WP_143347129.1|2530919_2531504_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	6.5e-50
WP_143347131.1|2531505_2531856_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	50.9	1.7e-29
WP_143347132.1|2531855_2532338_-	hypothetical protein	NA	A0A2I7RGM5	Vibrio_phage	30.6	1.1e-07
WP_162791116.1|2532374_2532674_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_046092056.1|2532655_2533609_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.3	6.9e-134
WP_143347133.1|2533620_2534391_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_143347134.1|2534471_2535569_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.1	6.1e-118
WP_143347135.1|2535570_2536959_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	1.2e-123
WP_073001200.1|2536960_2538268_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	5.0e-143
WP_073001198.1|2538245_2539232_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	40.7	1.5e-35
WP_045371016.1|2539683_2540097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028013328.1|2540485_2541004_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	86.0	8.5e-78
WP_045143003.1|2541000_2541537_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.6	2.6e-90
WP_048223534.1|2541536_2541839_-	hypothetical protein	NA	O64361	Escherichia_phage	66.3	1.6e-31
WP_143347136.1|2542997_2543831_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	80.1	2.7e-126
WP_143347137.1|2543827_2544190_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.2	4.0e-50
WP_143347138.1|2544192_2544399_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	77.3	4.6e-27
WP_143347139.1|2544398_2545001_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	83.0	4.0e-95
WP_143347141.1|2545389_2545614_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	68.8	4.0e-24
>prophage 5
NZ_AP019632	Enterobacter asburiae strain 1808-013	4639748	2553607	2565726	4639748		Enterobacteria_phage(45.45%)	12	NA	NA
WP_143347147.1|2553607_2554294_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	9.8e-82
WP_172620516.1|2554290_2555208_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	71.4	6.1e-111
WP_143347149.1|2555292_2555835_-	regulator	NA	M9NZI6	Enterobacteria_phage	86.1	4.6e-82
WP_087822704.1|2555864_2556116_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	52.7	6.9e-17
WP_143347150.1|2556243_2556936_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	1.4e-59
WP_087822706.1|2556962_2557499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143347152.1|2558324_2561462_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	63.7	0.0e+00
WP_143347153.1|2561471_2562557_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	1.4e-122
WP_020882485.1|2562595_2562838_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_047647992.1|2562902_2563118_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	50.7	8.5e-16
WP_143347155.1|2563117_2564398_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	53.1	4.3e-123
WP_143347156.1|2564427_2565726_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	2.7e-16
