The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	533285	543209	4341076		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179539.1|533285_534824_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
WP_003179538.1|534820_535408_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_011197613.1|535404_536445_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_142782120.1|536568_537999_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.7e-51
WP_009329142.1|537974_540203_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179533.1|540186_540870_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003179532.1|540866_541121_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	34.6	8.0e-05
WP_003179531.1|541122_541839_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_017474622.1|541913_543209_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	4.5e-19
>prophage 2
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	1072612	1125017	4341076	capsid,integrase,terminase,portal,tail,holin,tRNA	Bacillus_phage(37.5%)	70	1084242:1084301	1121588:1121655
WP_142782212.1|1072612_1073527_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I6UG75	Salinibacter_virus	23.5	6.0e-10
WP_003178409.1|1079103_1079868_+	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
WP_003178407.1|1079876_1080476_-	kinB signaling pathway activation protein KbaA	NA	NA	NA	NA	NA
WP_009330340.1|1080590_1081172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003178403.1|1081225_1082287_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_142782213.1|1082372_1083086_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N9SGH1	Paenibacillus_phage	31.4	5.9e-13
WP_003178399.1|1083178_1083622_-	YbaK family protein	NA	NA	NA	NA	NA
WP_061576644.1|1083733_1084192_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
1084242:1084301	attL	ATTAACGTTTTGAGAACTGAGGTGCACGGCGTGCGCCTTTAAGTCCGTATTTTTTACGCT	NA	NA	NA	NA
WP_075178164.1|1084430_1085315_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	48.6	3.4e-58
WP_021837361.1|1085332_1085749_-|holin	phage holin family protein	holin	A0A1U9WQR6	Geobacillus_phage	47.0	4.2e-27
WP_142782214.1|1085787_1086009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782215.1|1086022_1086193_-	XkdX family protein	NA	NA	NA	NA	NA
WP_142782216.1|1086364_1086724_-	hypothetical protein	NA	O48465	Bacillus_phage	40.8	2.9e-16
WP_142782217.1|1086737_1089371_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	42.4	1.1e-99
WP_142782218.1|1089385_1090120_-|tail	phage tail family protein	tail	A0A1B1P894	Bacillus_phage	40.0	4.5e-32
WP_142782219.1|1090119_1092666_-	hypothetical protein	NA	W8EBC4	Geobacillus_phage	57.0	1.0e-83
WP_142782220.1|1092671_1093325_-	hypothetical protein	NA	A8ASK5	Listeria_phage	35.5	3.1e-16
WP_142782221.1|1093334_1093721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782222.1|1093775_1094096_-	fibronectin type III domain-containing protein	NA	R4JF61	Bacillus_phage	70.6	1.6e-26
WP_142782223.1|1094028_1094481_-|capsid	capsid protein	capsid	I1TLE8	Bacillus_phage	41.8	1.2e-22
WP_142782224.1|1094482_1094893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782225.1|1094904_1095252_-|capsid	minor capsid protein	capsid	A0A1B1P872	Bacillus_phage	53.9	7.8e-27
WP_142782226.1|1095248_1095593_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_142782227.1|1095579_1095996_-	hypothetical protein	NA	A0A1B1P889	Bacillus_phage	41.2	9.7e-16
WP_094023879.1|1096199_1097087_-	hypothetical protein	NA	A0A1S5SA37	Streptococcus_phage	56.6	7.0e-88
WP_094023878.1|1097105_1097735_-	hypothetical protein	NA	B3GW02	Streptococcus_phage	46.8	2.2e-27
WP_094023956.1|1097826_1098144_-	hypothetical protein	NA	A0A142F184	Bacillus_phage	78.1	1.4e-43
WP_094023877.1|1098590_1099706_-	hypothetical protein	NA	A0A1B1P858	Bacillus_phage	47.0	2.1e-89
WP_094023876.1|1099705_1101217_-|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	46.3	4.0e-128
WP_094023875.1|1101229_1101670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094023874.1|1101672_1102965_-|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	69.4	6.2e-178
WP_094023955.1|1102954_1103497_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	47.0	2.0e-21
WP_142782228.1|1103534_1103978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837352.1|1104163_1104394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782229.1|1105189_1105645_-	DNA-binding response regulator	NA	A0A290FZR5	Caldibacillus_phage	61.2	6.6e-42
WP_021837347.1|1105840_1106278_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	74.3	3.8e-55
WP_075178156.1|1106310_1106628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328652.1|1106793_1107021_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	66.7	4.0e-16
WP_021837344.1|1106956_1107475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094023872.1|1107807_1108269_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	63.8	4.0e-47
WP_142782230.1|1108258_1108501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025807748.1|1108555_1108762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328659.1|1108740_1109163_-	RusA family crossover junction endodeoxyribonuclease	NA	M4ZS69	Bacillus_phage	56.5	2.5e-35
WP_142782231.1|1109159_1109498_-	hypothetical protein	NA	A6M997	Geobacillus_virus	43.5	9.6e-22
WP_011197856.1|1109593_1109803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328662.1|1109888_1110071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782865.1|1110067_1110157_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_009328666.1|1110590_1110794_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.6	1.3e-13
WP_061576062.1|1110874_1111657_-	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	74.2	9.1e-108
WP_075178150.1|1111646_1112642_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	63.5	3.3e-38
WP_061576064.1|1112881_1113115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837322.1|1113294_1113927_-	ERF family protein	NA	A0A1J0MF78	Staphylococcus_phage	35.6	3.1e-29
WP_021837321.1|1113926_1114511_-	hypothetical protein	NA	A0A0S2SXP9	Bacillus_phage	46.3	5.2e-15
WP_061578453.1|1114887_1115154_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	52.3	3.7e-21
WP_142782232.1|1115150_1115669_-	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	47.6	1.5e-34
WP_142782233.1|1115870_1116644_-	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	63.1	1.8e-79
WP_142782234.1|1116663_1117074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061576066.1|1117113_1117440_-	hypothetical protein	NA	S6C476	Thermus_phage	54.4	2.1e-18
WP_080576845.1|1117452_1117710_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142782235.1|1117858_1118224_+	helix-turn-helix domain-containing protein	NA	A0A0B5CYL9	Listeria_phage	36.9	2.6e-12
WP_142782236.1|1118483_1118750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061576070.1|1118844_1119366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782237.1|1119378_1119726_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	66.2	1.9e-17
WP_075218703.1|1119837_1120317_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.2	5.2e-29
WP_142782238.1|1120347_1121487_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	40.2	3.2e-69
WP_003178395.1|1121588_1121981_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
1121588:1121655	attR	ATTAACGTTTTGAGAACTGAGGTGCACGGCGTGCGCCTTTAAGTCCGTATTTTTTACGCTCTTTCATA	NA	NA	NA	NA
WP_003178393.1|1122001_1122439_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_025805809.1|1122599_1123343_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003178389.1|1123353_1124151_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003178387.1|1124147_1125017_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.7e-12
>prophage 3
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	1930161	1938088	4341076	integrase	uncultured_Caudovirales_phage(28.57%)	9	1927555:1927569	1941884:1941898
1927555:1927569	attL	AAAAGGAGGAGACGC	NA	NA	NA	NA
WP_009329635.1|1930161_1931781_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	7.8e-45
WP_142782358.1|1931827_1932805_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003185554.1|1932791_1933127_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	38.5	4.3e-14
WP_003185552.1|1933238_1933814_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	28.2	1.0e-10
WP_003185550.1|1933893_1934490_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.4	1.3e-53
WP_009329632.1|1934730_1935048_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_142782359.1|1935409_1936399_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	24.2	7.4e-14
WP_142782360.1|1936556_1937282_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.1	1.8e-17
WP_142782361.1|1937542_1938088_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	43.0	1.2e-26
1941884:1941898	attR	AAAAGGAGGAGACGC	NA	NA	NA	NA
>prophage 4
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	2589210	2648783	4341076	protease,terminase,coat,tRNA	Moraxella_phage(25.0%)	59	NA	NA
WP_142782476.1|2589210_2590506_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.4	5.0e-159
WP_011198170.1|2590509_2590731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885553.1|2590947_2591148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|2591161_2591653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329319.1|2591696_2591951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782477.1|2592363_2593746_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003184104.1|2593788_2594016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003184102.1|2594472_2595387_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184100.1|2595811_2597536_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184097.1|2597532_2598051_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184095.1|2598074_2599103_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_044822493.1|2599089_2600646_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	1.5e-08
WP_003184091.1|2600673_2601786_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_009329313.1|2601819_2603238_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_009329311.1|2603250_2603850_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003184086.1|2603979_2604987_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011198167.1|2605212_2606487_+	trigger factor	NA	NA	NA	NA	NA
WP_003184083.1|2606755_2608021_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_003184080.1|2608203_2609859_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_009329308.1|2610077_2612402_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184076.1|2612398_2612986_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003184074.1|2613034_2613520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009329306.1|2613708_2615070_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011198166.1|2615075_2615906_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_009329302.1|2615945_2616887_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_075646663.1|2616876_2617668_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009329298.1|2617671_2618646_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_009329296.1|2618671_2619967_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_063906779.1|2620115_2621573_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329292.1|2621600_2622623_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003184058.1|2622642_2622834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782478.1|2623295_2625938_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	1.3e-161
WP_003184054.1|2626013_2627318_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_142782479.1|2627460_2628210_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_142782480.1|2628413_2629445_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|2629598_2630171_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184045.1|2630225_2630900_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184042.1|2630987_2631998_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184040.1|2632028_2632937_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184039.1|2632933_2633452_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011198163.1|2633506_2634187_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184035.1|2634189_2634996_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003184034.1|2635040_2635361_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184032.1|2635360_2635789_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184030.1|2635934_2636726_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184028.1|2636718_2637585_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184027.1|2637741_2638050_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184025.1|2638062_2638404_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184023.1|2638416_2638698_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184022.1|2638923_2639502_+	sporulation protein	NA	NA	NA	NA	NA
WP_142782481.1|2639534_2640821_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184018.1|2640934_2641378_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184017.1|2641386_2642256_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184015.1|2642299_2642842_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_009327768.1|2642810_2643989_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184010.1|2644089_2645664_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327769.1|2645644_2646484_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184007.1|2646505_2647615_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003184005.1|2647730_2648783_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	3402189	3449303	4341076	capsid,protease,integrase,portal,transposase,tail,holin,plate	uncultured_Caudovirales_phage(29.63%)	58	3435106:3435123	3451138:3451155
WP_142782588.1|3402189_3403335_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.5	4.7e-44
WP_142782589.1|3403661_3403910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885195.1|3403992_3404223_-|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	60.6	4.0e-19
WP_029326993.1|3404243_3405224_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.0	4.7e-69
WP_003181190.1|3405290_3405554_-|holin	holin	holin	NA	NA	NA	NA
WP_003181188.1|3405557_3405752_-	XkdX family protein	NA	NA	NA	NA	NA
WP_142782590.1|3405752_3406046_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.4e-40
WP_142782591.1|3406061_3407285_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	59.6	5.8e-125
WP_142782592.1|3408892_3410263_-	endopeptidase	NA	A6M966	Geobacillus_virus	35.2	9.6e-44
WP_142782593.1|3410273_3411134_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.6	3.2e-61
WP_142782594.1|3411133_3413950_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	44.6	2.6e-96
WP_142782595.1|3413950_3414187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782596.1|3414285_3414654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181175.1|3414711_3415257_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	6.2e-55
WP_142782597.1|3415295_3415670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181172.1|3415673_3416084_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	54.4	1.1e-30
WP_048350738.1|3416080_3416419_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	43.8	1.9e-17
WP_124932295.1|3416419_3416806_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	45.5	1.8e-24
WP_142782598.1|3416820_3417033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181166.1|3417087_3418179_-	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	66.6	1.3e-128
WP_142782599.1|3418232_3418964_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	54.6	7.6e-24
WP_128993924.1|3419078_3419453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782600.1|3419629_3420454_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	55.4	3.2e-79
WP_142782601.1|3420453_3422061_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.5	4.0e-166
WP_142782602.1|3422063_3422492_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	52.2	3.8e-31
WP_142782603.1|3422507_3424262_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	72.8	1.6e-253
WP_048350001.1|3424366_3424912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	44.1	8.5e-28
WP_142782604.1|3424908_3425712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782605.1|3425808_3426321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782606.1|3427364_3427634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782607.1|3429073_3429520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782608.1|3429557_3429746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782609.1|3429795_3430068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095240107.1|3430098_3430434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181141.1|3430502_3430874_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.1	1.5e-15
WP_111327957.1|3430976_3431153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025808385.1|3432135_3432531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782610.1|3432517_3432865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782611.1|3432861_3433059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782612.1|3433055_3433394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782613.1|3433390_3433741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031314606.1|3433926_3434112_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142782614.1|3434421_3435945_+|transposase	transposase	transposase	NA	NA	NA	NA
3435106:3435123	attL	ATGCTGAAAAAAGTCGGA	NA	NA	NA	NA
WP_142782615.1|3435956_3436319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782616.1|3436573_3436792_-	helix-turn-helix domain-containing protein	NA	D0R7I7	Paenibacillus_phage	65.7	3.3e-07
WP_061576561.1|3437262_3437463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782617.1|3437455_3437788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885212.1|3438123_3438297_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	90.9	3.1e-24
WP_095240284.1|3438332_3438677_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_142782618.1|3440170_3440503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782619.1|3440650_3441628_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_142782620.1|3441636_3442695_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.8	2.6e-25
WP_009328607.1|3443341_3443839_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	6.1e-57
WP_003181103.1|3443860_3444592_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	48.0	9.6e-59
WP_003181100.1|3444584_3445025_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003181098.1|3445027_3445687_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.9	6.6e-67
WP_003181096.1|3445951_3446986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885804.1|3447206_3449303_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.6	1.2e-125
3451138:3451155	attR	TCCGACTTTTTTCAGCAT	NA	NA	NA	NA
>prophage 6
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	3562967	3630483	4341076	terminase,portal,tail,coat,holin,plate	Bacillus_phage(25.71%)	82	NA	NA
WP_061576227.1|3562967_3563234_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	62.1	1.3e-26
WP_061576226.1|3563248_3563542_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	2.8e-25
WP_021837301.1|3564987_3565155_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	53.7	5.8e-12
WP_021837300.1|3565144_3565513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061576225.1|3565527_3565839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180850.1|3566745_3567132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782642.1|3567145_3568066_-	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	1.1e-11
WP_009328732.1|3568052_3569096_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_003180844.1|3569088_3569514_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_003180843.1|3569532_3569841_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_009328734.1|3569837_3570818_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180838.1|3570874_3571531_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_142782643.1|3571523_3575306_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180833.1|3575309_3575447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180832.1|3575488_3575938_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180830.1|3576120_3576564_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_011197804.1|3576565_3577912_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180826.1|3577911_3578136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180824.1|3578136_3578577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180822.1|3578589_3579078_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_009328738.1|3579074_3579431_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_011201613.1|3579427_3579808_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328739.1|3579895_3580831_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_009328740.1|3580848_3581697_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_003180808.1|3581704_3583219_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_003180806.1|3583222_3584521_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_142782644.1|3584517_3585318_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_003180803.1|3585460_3585964_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180800.1|3586083_3586287_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180798.1|3586283_3586625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197802.1|3586895_3587696_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180792.1|3587595_3588426_-	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_003180790.1|3588426_3588723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197800.1|3588712_3588973_-	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	2.3e-07
WP_003180787.1|3589145_3589499_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_142782645.1|3589688_3590345_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	3.1e-40
WP_003180784.1|3590358_3591006_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180781.1|3593277_3593760_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180779.1|3594134_3594548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180775.1|3594925_3595504_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197798.1|3595519_3596944_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180772.1|3596999_3597734_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_142782646.1|3598186_3598735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180768.1|3598778_3599156_-	glyoxalase	NA	NA	NA	NA	NA
WP_003180767.1|3599203_3600076_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003180765.1|3600167_3601055_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180762.1|3601112_3602831_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011197796.1|3602858_3604688_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180759.1|3605008_3605899_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035333938.1|3606105_3606393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782647.1|3606484_3607063_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011197793.1|3607097_3607277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782880.1|3607715_3607799_+	hydrophobic toxin	NA	NA	NA	NA	NA
WP_142782648.1|3608401_3609388_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_142782649.1|3609691_3611065_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.1	2.5e-07
WP_009328774.1|3611240_3611525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197790.1|3611514_3612084_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197789.1|3612257_3613448_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_009328782.1|3613493_3614669_-	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_009328785.1|3614658_3615783_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328787.1|3616091_3617039_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197787.1|3617119_3617608_+	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_011197786.1|3617801_3618134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|3618124_3618847_+	esterase family protein	NA	NA	NA	NA	NA
WP_009328796.1|3618911_3619421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328797.1|3619430_3619850_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328798.1|3620014_3620410_+	GtrA family protein	NA	NA	NA	NA	NA
WP_009328799.1|3620432_3621323_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_061576213.1|3621319_3622306_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	2.1e-53
WP_009328801.1|3622405_3622993_+	DedA family protein	NA	NA	NA	NA	NA
WP_009328802.1|3623032_3623290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197782.1|3623411_3625694_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_009328805.1|3625732_3625990_-	sporulation protein	NA	NA	NA	NA	NA
WP_011197781.1|3626119_3626251_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328806.1|3626330_3626540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197779.1|3626826_3627183_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328807.1|3627329_3627716_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|3627764_3628163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328809.1|3628233_3628746_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|3628877_3629366_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_142782650.1|3629516_3629966_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_142782651.1|3630003_3630483_-|coat	spore coat protein CotO	coat	NA	NA	NA	NA
>prophage 7
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	3673000	3688683	4341076	integrase	Bacillus_phage(89.47%)	22	3677126:3677141	3692728:3692743
WP_142782660.1|3673000_3674521_+	hypothetical protein	NA	O64068	Bacillus_phage	81.8	1.8e-245
WP_142782661.1|3674554_3675994_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.3	2.8e-171
WP_142782662.1|3676018_3676621_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.0	7.6e-78
WP_021837892.1|3676661_3677678_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.6	1.2e-160
3677126:3677141	attL	AGTTCGATTGTATTTG	NA	NA	NA	NA
WP_009328375.1|3677712_3678183_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
WP_095233947.1|3678194_3678593_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	61.4	8.3e-41
WP_142782663.1|3678589_3678820_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	58.3	3.7e-09
WP_142782664.1|3678806_3679466_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	67.1	5.7e-79
WP_080623929.1|3679462_3679993_+	hypothetical protein	NA	O64060	Bacillus_phage	62.5	6.5e-57
WP_142782665.1|3679989_3680709_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	43.7	7.2e-51
WP_080623927.1|3680753_3681548_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	43.9	3.8e-29
WP_080623926.1|3681587_3681980_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	46.8	1.6e-12
WP_142782666.1|3682087_3682453_+	lysozyme	NA	NA	NA	NA	NA
WP_142782667.1|3682455_3683748_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	46.2	1.4e-36
WP_142782668.1|3683759_3684074_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	48.4	1.2e-15
WP_050820989.1|3684070_3684259_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	52.1	1.3e-07
WP_095266710.1|3684296_3684782_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	32.1	2.8e-14
WP_142782669.1|3684782_3685202_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	54.8	2.2e-36
WP_142782881.1|3685215_3686217_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.5	3.3e-171
WP_016886023.1|3686354_3687032_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_142782670.1|3687573_3688035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929247.1|3688224_3688683_+	hypothetical protein	NA	O64047	Bacillus_phage	41.5	3.3e-25
3692728:3692743	attR	CAAATACAATCGAACT	NA	NA	NA	NA
>prophage 8
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	3705125	3712115	4341076	holin	Bacillus_phage(100.0%)	8	NA	NA
WP_142782679.1|3705125_3705923_+	hypothetical protein	NA	O64043	Bacillus_phage	57.5	1.1e-71
WP_142782680.1|3705938_3707843_+	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.0	1.2e-49
WP_142782681.1|3707998_3709087_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1P8CWN6	Bacillus_phage	61.9	4.1e-106
WP_021837858.1|3709218_3709605_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
WP_009328416.1|3709623_3709878_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
WP_034291560.1|3709896_3710196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034291561.1|3710397_3710481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328417.1|3711008_3712115_-	hypothetical protein	NA	D6R410	Bacillus_phage	28.5	2.5e-34
>prophage 9
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	3877274	3883484	4341076		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003183104.1|3877274_3877868_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|3877857_3878613_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|3878795_3878891_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|3879011_3879533_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_142782712.1|3879543_3879918_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|3880019_3880484_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|3880518_3881715_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|3881736_3882384_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_142782714.1|3882395_3883484_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.5	1.1e-63
>prophage 10
NZ_CP033218	Bacillus licheniformis strain TCCC 11148 chromosome, complete genome	4341076	4253165	4302728	4341076	integrase	Bacillus_phage(95.92%)	72	4258619:4258634	4304229:4304244
WP_017474717.1|4253165_4253756_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	81.2	8.7e-87
WP_017474718.1|4253798_4253978_-	hypothetical protein	NA	O64193	Bacillus_phage	47.3	1.1e-05
WP_142782789.1|4253955_4254405_-	DUF1768 domain-containing protein	NA	A0A172JI41	Bacillus_phage	65.5	8.8e-47
WP_142782790.1|4254451_4254679_-	hypothetical protein	NA	A0A0E3D9Q5	Bacillus_phage	48.7	1.5e-10
WP_075223501.1|4254706_4255063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782791.1|4255125_4255296_-	hypothetical protein	NA	O64190	Bacillus_phage	89.3	1.7e-19
WP_017474722.1|4255337_4255517_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	84.7	1.6e-20
WP_075223502.1|4255556_4256384_-	metallophosphoesterase	NA	O64184	Bacillus_phage	88.4	1.5e-153
WP_075223503.1|4256403_4256925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782792.1|4257918_4258392_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	45.9	6.5e-24
WP_117612599.1|4258388_4258598_-	hypothetical protein	NA	NA	NA	NA	NA
4258619:4258634	attL	TATTTTTAATTTGTTT	NA	NA	NA	NA
WP_142782793.1|4258637_4259003_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.8	3.5e-17
WP_142782794.1|4259156_4260008_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	2.2e-51
WP_142782795.1|4260009_4260297_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	48.9	3.7e-14
WP_142782796.1|4260427_4260868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782797.1|4260939_4261374_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	3.2e-70
WP_142782798.1|4261700_4262087_-	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	1.1e-13
WP_142782799.1|4262124_4262376_-	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	69.7	6.9e-25
WP_142782800.1|4262375_4263371_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	81.5	1.2e-152
WP_142782801.1|4263406_4264390_-	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	58.2	1.8e-100
WP_142782802.1|4264696_4264918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782803.1|4264939_4267477_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	83.9	0.0e+00
WP_142782804.1|4267599_4268298_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	59.3	7.2e-48
WP_142782805.1|4268405_4269134_-	ribonucleotide-diphosphate reductase subunit alpha	NA	S6B1K0	Bacillus_phage	85.7	1.1e-115
WP_009328274.1|4269090_4269492_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	64.0	1.7e-38
WP_017474744.1|4269491_4269839_-	hypothetical protein	NA	O64171	Bacillus_phage	41.7	6.8e-15
WP_142782806.1|4269891_4270146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782807.1|4270169_4270514_-	hypothetical protein	NA	O64168	Bacillus_phage	88.6	1.8e-15
WP_006640514.1|4270545_4270812_-	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	90.9	1.4e-36
WP_081605435.1|4270828_4271041_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	90.0	3.7e-32
WP_142782808.1|4271055_4271247_-	hypothetical protein	NA	S6BUY9	Bacillus_phage	50.0	3.6e-10
WP_142782809.1|4271294_4271615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782810.1|4271656_4272088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782811.1|4272109_4272499_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_142782812.1|4273649_4273994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782813.1|4274014_4274602_-	hypothetical protein	NA	A7KV03	Bacillus_phage	38.6	2.8e-29
WP_009328285.1|4274925_4275141_-	YorP family protein	NA	NA	NA	NA	NA
WP_075223447.1|4275145_4275862_-	3D domain-containing protein	NA	O64147	Bacillus_phage	43.9	8.0e-42
WP_142782814.1|4275872_4277309_-	hypothetical protein	NA	A0A1P8CX14	Bacillus_phage	76.8	2.6e-217
WP_142782815.1|4277295_4278066_-	hypothetical protein	NA	R9QM99	Lactococcus_phage	32.8	6.2e-16
WP_080601106.1|4278249_4280814_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	88.0	0.0e+00
WP_142782816.1|4280829_4282551_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.4	1.7e-215
WP_075223450.1|4282554_4283688_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.7	7.4e-159
WP_073411027.1|4283704_4285219_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.3	3.7e-238
WP_073411029.1|4285233_4285704_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.9	3.4e-57
WP_075223451.1|4285750_4286722_-	AAA family ATPase	NA	A0A1P8CX29	Bacillus_phage	85.0	5.0e-156
WP_142782817.1|4286775_4287690_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	66.7	6.7e-110
WP_073411037.1|4287773_4288106_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	48.6	1.3e-15
WP_073411041.1|4288317_4288689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142236762.1|4288714_4290079_-	DUF3238 domain-containing protein	NA	NA	NA	NA	NA
WP_075223453.1|4290207_4290462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474772.1|4290820_4291063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782818.1|4291059_4291254_-	hypothetical protein	NA	R4JF30	Bacillus_phage	96.8	1.0e-28
WP_009328305.1|4291250_4291439_-	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	64.4	4.1e-14
WP_142782819.1|4291435_4291843_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	52.4	1.3e-20
WP_006640545.1|4291959_4292322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885326.1|4292318_4292543_-	hypothetical protein	NA	O64132	Bacillus_phage	63.4	3.1e-21
WP_006640547.1|4292636_4293449_+	hypothetical protein	NA	O64130	Bacillus_phage	75.8	7.7e-118
WP_006640548.1|4293458_4293707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782820.1|4294541_4294754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073425984.1|4294972_4295164_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	67.7	1.8e-17
WP_075646773.1|4295462_4295807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075223458.1|4295853_4296051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142782821.1|4296230_4296899_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	74.4	5.8e-95
WP_142782822.1|4296917_4297160_-	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	78.8	1.2e-29
WP_142782823.1|4297415_4297703_-	hypothetical protein	NA	A0A0E3DEX0	Bacillus_phage	49.5	2.3e-16
WP_080623961.1|4297755_4298910_-	AAA family ATPase	NA	A0A172JHS6	Bacillus_phage	40.2	2.3e-67
WP_100225863.1|4299215_4299401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474446.1|4299517_4299712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474447.1|4299724_4299979_-	YopT family protein	NA	NA	NA	NA	NA
WP_017474448.1|4300346_4301348_-|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	40.4	3.7e-61
WP_017474449.1|4301351_4302728_-	hypothetical protein	NA	O64100	Bacillus_phage	41.7	1.0e-93
4304229:4304244	attR	TATTTTTAATTTGTTT	NA	NA	NA	NA
