The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041365	Acinetobacter tandoii strain SE63 chromosome, complete genome	3543632	892669	901303	3543632		Acinetobacter_phage(83.33%)	7	NA	NA
WP_142768146.1|892669_895933_+	DEAD/DEAH box helicase family protein	NA	A0A1P8BMQ8	Lactococcus_phage	25.7	4.2e-05
WP_171334055.1|896667_897216_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.6	4.9e-92
WP_142768147.1|897309_897996_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	74.3	8.6e-86
WP_142768148.1|898554_898797_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_142768149.1|898858_899665_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	89.2	1.8e-130
WP_142768150.1|899680_900727_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	84.8	9.2e-164
WP_171334054.1|900727_901303_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	96.3	6.3e-106
>prophage 2
NZ_CP041365	Acinetobacter tandoii strain SE63 chromosome, complete genome	3543632	1089065	1154914	3543632	plate,portal,protease,capsid,tail,tRNA,terminase,integrase	Pseudomonas_phage(22.5%)	79	1088040:1088085	1129646:1129691
1088040:1088085	attL	TTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATGCCTACCAA	NA	NA	NA	NA
WP_142768289.1|1089065_1090208_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A0P0IKZ2	Acinetobacter_phage	66.6	7.7e-148
WP_044740305.1|1090209_1090476_-	hypothetical protein	NA	A0A0P0IE28	Acinetobacter_phage	63.6	3.5e-27
WP_142768290.1|1090465_1090771_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	54.3	2.8e-20
WP_142768292.1|1091206_1092076_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_171479115.1|1092041_1092938_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_142768294.1|1092991_1093771_-	peptidase S24	NA	A0A0P0IYD9	Acinetobacter_phage	45.6	8.1e-24
WP_142768295.1|1093772_1094018_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	64.3	7.2e-19
WP_142768296.1|1094042_1094492_+	phage regulatory CII family protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	76.4	1.7e-58
WP_142768297.1|1094504_1095458_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	55.2	1.3e-20
WP_171479116.1|1095454_1095622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768298.1|1095618_1096050_+	hypothetical protein	NA	G3EN88	Psychrobacter_phage	41.3	2.1e-21
WP_142768299.1|1096059_1096446_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	37.6	6.0e-12
WP_142768300.1|1096559_1096796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768301.1|1098073_1098445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768302.1|1098441_1098891_+	glycoside hydrolase family protein	NA	A0A1I9L2K1	Xanthomonas_phage	60.6	5.5e-41
WP_142768303.1|1099038_1099542_+|terminase	terminase small subunit	terminase	V5YUM0	Pseudomonas_phage	50.9	8.6e-35
WP_142770013.1|1099528_1101508_+|terminase	phage terminase large subunit family protein	terminase	V5YTA4	Pseudomonas_phage	68.2	1.6e-254
WP_142768304.1|1101877_1103059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768305.1|1103094_1103358_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_142768306.1|1103528_1104401_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	58.1	7.7e-31
WP_171479117.1|1104835_1104973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768307.1|1104988_1105528_+	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	52.8	2.8e-39
WP_142768308.1|1105534_1107109_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	58.8	6.0e-167
WP_142768309.1|1107108_1109100_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	50.8	4.0e-176
WP_142768310.1|1109151_1109442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768311.1|1109447_1109771_+	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	52.8	1.6e-26
WP_142768312.1|1109763_1110282_+	hypothetical protein	NA	A0A088FVG9	Escherichia_phage	37.4	8.4e-17
WP_142768313.1|1110266_1110845_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	36.8	2.5e-25
WP_142768314.1|1110841_1111354_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	37.5	9.1e-16
WP_142770014.1|1111353_1111686_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	59.6	1.8e-28
WP_142768315.1|1111682_1112660_+|plate	baseplate J/gp47 family protein	plate	A0A0M4REB7	Salmonella_phage	43.3	7.0e-65
WP_142768316.1|1112656_1113187_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	37.7	1.2e-23
WP_142768317.1|1115360_1115777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768318.1|1115856_1117035_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	V5YTI0	Pseudomonas_phage	57.0	2.2e-142
WP_142768319.1|1117047_1117557_+|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	62.0	1.1e-53
WP_142768320.1|1117558_1117846_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	50.5	4.3e-15
WP_142770015.1|1118179_1118674_+	Ltp family lipoprotein	NA	G3ENA3	Psychrobacter_phage	58.2	1.2e-09
WP_142768321.1|1118820_1121244_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	40.8	2.9e-136
WP_142768322.1|1121243_1121702_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	46.8	1.2e-30
WP_142768323.1|1121704_1121920_+|tail	tail protein X	tail	A0A219Y9W1	Aeromonas_phage	40.3	9.4e-07
WP_142768324.1|1121910_1122894_+|tail	phage tail protein	tail	V5YTN9	Pseudomonas_phage	48.2	4.4e-83
WP_044738568.1|1122947_1123229_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	49.5	2.6e-20
WP_142768325.1|1123253_1123538_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_142768326.1|1123558_1123783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142768327.1|1123797_1124418_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	49.8	3.9e-53
WP_142768328.1|1124553_1125567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142768329.1|1125629_1125848_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142770016.1|1126111_1126864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768330.1|1126890_1127439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142768331.1|1127440_1127893_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_171479118.1|1128092_1128848_+	hypothetical protein	NA	B6SCX2	Bacteriophage	50.0	3.4e-19
WP_142768333.1|1128886_1129357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142768334.1|1130173_1130413_+	hypothetical protein	NA	NA	NA	NA	NA
1129646:1129691	attR	TTGACATCGTAGAGGTCTCCAGTTCGAGTCTGGATATGCCTACCAA	NA	NA	NA	NA
WP_142768335.1|1130862_1131084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768336.1|1131815_1132073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768337.1|1132800_1133091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171479119.1|1133428_1133620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768339.1|1134015_1134471_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_142768340.1|1134718_1135123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171479120.1|1135695_1136361_+	hypothetical protein	NA	A0A2H4J8A2	uncultured_Caudovirales_phage	46.2	6.9e-48
WP_100242682.1|1137196_1138519_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	8.3e-61
WP_142768342.1|1138582_1139581_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_142768343.1|1139670_1140225_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_142768344.1|1140452_1140830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142770017.1|1140963_1141326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142768345.1|1141392_1141965_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.1	3.7e-26
WP_016166582.1|1142020_1142275_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.0e-12
WP_016166581.1|1142521_1143802_-	aspartate kinase	NA	NA	NA	NA	NA
WP_171479121.1|1143867_1146561_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.0	5.6e-72
WP_142768346.1|1146961_1147984_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_142768347.1|1148028_1148550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100241638.1|1148807_1149122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100241520.1|1149138_1149438_-	AzlD family protein	NA	NA	NA	NA	NA
WP_142768348.1|1149434_1150187_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_100241518.1|1150329_1150782_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_142768349.1|1150993_1152160_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_142768350.1|1152229_1153549_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.5	4.1e-68
WP_100241515.1|1153716_1154025_+	DUF1705 domain-containing protein	NA	NA	NA	NA	NA
WP_142768351.1|1154137_1154914_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP041365	Acinetobacter tandoii strain SE63 chromosome, complete genome	3543632	1265098	1277684	3543632	tRNA	Moumouvirus(12.5%)	13	NA	NA
WP_142768424.1|1265098_1266520_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.0	3.3e-47
WP_142770022.1|1266775_1267753_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	2.3e-36
WP_100242974.1|1267756_1268296_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_100242973.1|1268340_1268895_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_142768425.1|1268878_1269445_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_100242971.1|1269444_1270191_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	6.2e-21
WP_142768426.1|1270316_1270913_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.6	6.4e-21
WP_171334125.1|1270926_1271523_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	1.8e-10
WP_142768427.1|1271645_1272488_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	36.0	7.7e-36
WP_142768428.1|1272616_1273282_-	class I SAM-dependent methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.0	1.9e-29
WP_171334124.1|1273409_1274075_-	peptidase M15	NA	NA	NA	NA	NA
WP_004938070.1|1274260_1274584_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_142768429.1|1275047_1277684_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.2	5.2e-38
