The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	608374	655940	4063541	head,capsid,portal,integrase,tail,protease,tRNA,terminase	uncultured_Caudovirales_phage(33.33%)	67	618565:618585	660186:660206
WP_003155999.1|608374_608851_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_024084958.1|608831_609521_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003155993.1|609531_609987_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_069013100.1|609979_611020_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	7.7e-62
WP_079005209.1|611243_613172_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	7.9e-60
WP_003155986.1|613311_613824_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003155984.1|613820_614468_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|614486_614657_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_007609791.1|614663_615422_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|615463_615655_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003155972.1|615651_616386_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|616622_616907_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003155941.1|616948_618583_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
618565:618585	attL	TATGGGCGGCATGATGTAATC	NA	NA	NA	NA
WP_003155938.1|618673_619870_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	44.6	3.5e-82
WP_003155936.1|619887_620394_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	62.8	1.4e-56
WP_071348587.1|620466_621366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155933.1|621620_621983_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.8	4.9e-16
WP_079005208.1|622143_622374_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003155930.1|622414_622594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155923.1|622577_622823_-	hypothetical protein	NA	X2KU02	Streptococcus_phage	61.3	1.1e-22
WP_003155921.1|622903_623218_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	50.0	2.8e-15
WP_003155918.1|623214_623985_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.5	8.5e-74
WP_003155916.1|624094_624667_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_003155914.1|624663_624921_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.2	1.0e-07
WP_003155912.1|624917_625121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155909.1|625222_625414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155908.1|625410_626328_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	61.7	9.4e-88
WP_076983163.1|626347_627085_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	3.9e-52
WP_003155906.1|627084_627273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005213.1|627282_627984_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	5.3e-06
WP_131259882.1|627868_628816_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	51.6	1.0e-57
WP_079005207.1|629050_629479_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	2.8e-42
WP_079005206.1|629770_629974_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.2	1.3e-21
WP_003155893.1|630114_630495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005205.1|630491_630866_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	43.1	4.1e-05
WP_071348438.1|630862_631123_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.2	5.7e-06
WP_079005204.1|631126_631969_+	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	57.9	1.0e-88
WP_079005203.1|631947_632361_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	94.7	9.5e-72
WP_079005202.1|632503_632854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005201.1|632962_633397_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.0	1.2e-48
WP_072565159.1|633580_633784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095836083.1|634049_634178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005200.1|634192_634708_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	42.6	1.5e-26
WP_013351218.1|635049_635241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|635248_635461_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_079005199.1|635593_635779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005198.1|635845_636607_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_079005197.1|636752_637514_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	57.3	4.0e-68
WP_079005196.1|637500_638709_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	87.0	6.4e-209
WP_079005195.1|638708_640112_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	1.4e-151
WP_079005194.1|640098_641025_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	3.0e-81
WP_079005193.1|641127_641709_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	54.2	2.1e-53
WP_015388406.1|641724_642642_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.9	2.9e-113
WP_079005192.1|642646_642982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304502.1|642983_643256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304503.1|643264_643573_+	hypothetical protein	NA	R4IFL8	Staphylococcus_phage	39.6	4.8e-12
WP_079005191.1|643569_643908_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014471518.1|643900_644317_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_003155849.1|644335_644734_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	6.4e-25
WP_017417511.1|644747_645272_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.9	3.7e-28
WP_069013025.1|645312_645528_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	72.7	1.2e-17
WP_076983593.1|645541_645784_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_079005190.1|645840_646347_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	5.1e-11
WP_071348589.1|646394_646703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005189.1|646707_651783_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	26.1	5.1e-34
WP_031378548.1|651779_652544_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_079005188.1|652556_655940_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	45.9	3.9e-131
660186:660206	attR	TATGGGCGGCATGATGTAATC	NA	NA	NA	NA
>prophage 2
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	695505	705396	4063541		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|695505_696798_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|696873_697593_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|697592_697847_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_043866890.1|697843_698527_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155755.1|698510_700739_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	3.2e-158
WP_003155754.1|700714_702145_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_003155753.1|702236_703277_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155752.1|703273_703861_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_057080046.1|703857_705396_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	1.1e-77
>prophage 3
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	1260752	1292651	4063541	portal,plate,holin,tail,terminase	Bacillus_phage(32.26%)	42	NA	NA
WP_087920760.1|1260752_1261889_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1261878_1262013_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1262155_1263109_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154878.1|1263146_1263524_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_063174231.1|1263633_1264239_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.3	3.3e-41
WP_003154873.1|1264393_1264984_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1265132_1265471_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_063174230.1|1265662_1265842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063174229.1|1265831_1266659_+	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	1.3e-19
WP_063174228.1|1266558_1267359_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	6.1e-59
WP_063174227.1|1267623_1267965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1267954_1268158_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_063174226.1|1268270_1268783_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	42.7	5.0e-22
WP_057080061.1|1268895_1269693_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	2.7e-59
WP_063174225.1|1269689_1270988_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_099762611.1|1271036_1272416_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_015417286.1|1272447_1273293_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_003154848.1|1273319_1274255_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_003154846.1|1274271_1274655_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_063174224.1|1274651_1275008_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_052585748.1|1275004_1275508_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	1.6e-36
WP_014304848.1|1275504_1275951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1275947_1276157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053125.1|1276156_1277554_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|1277555_1277999_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1278074_1278521_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1278562_1278715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099762609.1|1278702_1283829_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_007610816.1|1283821_1284481_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_003154829.1|1284494_1285472_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_007610818.1|1285471_1285738_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|1285841_1286267_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_079004808.1|1286259_1287306_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.0e-69
WP_003154823.1|1287289_1287868_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154822.1|1287864_1288137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063174222.1|1288139_1289762_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304856.1|1289774_1290146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1290151_1290349_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_063174221.1|1290405_1291167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866112.1|1291218_1291482_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	5.2e-23
WP_003154813.1|1291495_1291759_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1291772_1292651_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 4
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	1840656	1846869	4063541		Bacillus_phage(50.0%)	7	NA	NA
WP_014305044.1|1840656_1841049_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
WP_003154060.1|1841008_1843111_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_003154059.1|1843128_1844118_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_003154057.1|1844166_1844787_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.7e-46
WP_069013563.1|1844835_1845594_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	6.2e-53
WP_015388200.1|1845627_1845852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1845900_1846869_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	2135865	2149009	4063541		Bacillus_phage(90.0%)	14	NA	NA
WP_063174275.1|2135865_2136240_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	3.6e-30
WP_057080783.1|2136474_2136927_-	hypothetical protein	NA	O64117	Bacillus_phage	76.0	4.1e-60
WP_057080784.1|2137288_2138425_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.4	2.4e-165
WP_063174276.1|2138414_2138597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053348.1|2138921_2139941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305240.1|2140001_2140361_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	3.7e-32
WP_024085506.1|2140366_2140834_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	57.1	1.0e-42
WP_014305242.1|2141408_2141747_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.2	1.1e-25
WP_063174277.1|2142504_2143101_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	84.6	8.5e-90
WP_024085508.1|2143155_2143614_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_063174278.1|2143628_2145428_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	65.0	4.2e-172
WP_041482372.1|2146362_2146671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043867223.1|2146728_2148396_+	recombinase family protein	NA	O64015	Bacillus_phage	89.1	1.1e-272
WP_025852502.1|2148418_2149009_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.5	1.1e-12
>prophage 6
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	2183033	2214445	4063541		Bacillus_phage(90.62%)	52	NA	NA
WP_079005139.1|2183033_2183588_-	hypothetical protein	NA	O64195	Bacillus_phage	92.1	7.2e-91
WP_014470254.1|2183685_2183925_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_079005138.1|2184498_2185047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005137.1|2185027_2185573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095836066.1|2185562_2185718_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	85.4	1.3e-13
WP_079005136.1|2185750_2185963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005135.1|2185996_2186827_-	metallophosphoesterase	NA	O64184	Bacillus_phage	88.0	1.9e-151
WP_042976081.1|2186985_2187198_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_079005134.1|2187279_2187468_-	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	96.8	1.4e-25
WP_079005133.1|2187977_2188298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589202.1|2188444_2188975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005132.1|2189026_2189392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005131.1|2189521_2190028_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	39.8	2.4e-32
WP_079005130.1|2190027_2190867_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	90.3	1.9e-151
WP_045207798.1|2191642_2191942_-	hypothetical protein	NA	O64180	Bacillus_phage	51.1	1.3e-17
WP_045207799.1|2191934_2192243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005129.1|2192263_2192569_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	58.8	3.1e-11
WP_077722340.1|2192860_2193475_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.2	2.1e-43
WP_079005128.1|2193716_2193956_-	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	76.2	1.2e-26
WP_079005127.1|2193952_2194939_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	83.6	6.4e-151
WP_079005126.1|2194939_2195260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005125.1|2195279_2198534_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	95.6	0.0e+00
WP_079005124.1|2198505_2198892_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	84.4	8.9e-56
WP_038458556.1|2198888_2199239_-	hypothetical protein	NA	O64171	Bacillus_phage	47.5	4.5e-22
WP_079005123.1|2199531_2199798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005122.1|2199821_2200184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095836067.1|2200189_2200333_-	hypothetical protein	NA	O64168	Bacillus_phage	90.9	1.9e-16
WP_079005121.1|2200325_2200538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005120.1|2200600_2201068_-	hypothetical protein	NA	O64167	Bacillus_phage	87.8	3.8e-69
WP_131259890.1|2201119_2201293_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	69.2	4.3e-10
WP_079005119.1|2201282_2201474_-	hypothetical protein	NA	S6BUY9	Bacillus_phage	46.8	6.8e-09
WP_079005118.1|2201518_2201812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005117.1|2201854_2202052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005116.1|2202070_2202418_-	hypothetical protein	NA	O64164	Bacillus_phage	93.0	9.8e-54
WP_079005115.1|2202432_2202843_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	64.9	6.8e-38
WP_079005114.1|2202854_2203304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458576.1|2203320_2203500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005113.1|2203531_2204005_-	hypothetical protein	NA	O64162	Bacillus_phage	66.7	6.2e-59
WP_014470217.1|2204325_2204550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005111.1|2205055_2205283_-	hypothetical protein	NA	O64157	Bacillus_phage	70.7	8.1e-25
WP_079005110.1|2205320_2205548_-	hypothetical protein	NA	O64155	Bacillus_phage	61.8	4.5e-15
WP_079005109.1|2205585_2205864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005108.1|2205904_2206456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005107.1|2206581_2206929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458597.1|2206991_2207510_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	90.7	5.7e-90
WP_038458598.1|2207487_2208015_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	79.4	1.7e-70
WP_014417936.1|2208174_2208378_-	YorP family protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
WP_079005165.1|2208389_2209049_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	35.8	3.1e-24
WP_079005106.1|2209111_2210833_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	56.0	8.6e-175
WP_079005105.1|2210842_2211910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005104.1|2211925_2212942_-	hypothetical protein	NA	A0A1W6JK26	Lactococcus_phage	29.6	2.1e-16
WP_029974388.1|2212963_2214445_-	DNA helicase	NA	V9VET6	Lactococcus_phage	26.9	1.5e-42
>prophage 7
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	2217472	2248314	4063541	integrase	Bacillus_phage(86.84%)	53	2235917:2235939	2253472:2253494
WP_079005100.1|2217472_2217847_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	79.0	2.3e-53
WP_038458623.1|2217985_2218369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471971.1|2218560_2218938_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	3.4e-52
WP_046559760.1|2218976_2220719_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.0	6.8e-220
WP_079005164.1|2220715_2221537_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	62.9	6.9e-90
WP_077722306.1|2221636_2222014_-	hypothetical protein	NA	A8ASN9	Listeria_phage	41.2	1.2e-17
WP_079005099.1|2222047_2222500_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	47.3	4.0e-15
WP_079005098.1|2222517_2222790_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	81.1	4.7e-35
WP_079005097.1|2222779_2223667_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.2	2.0e-159
WP_079005096.1|2223715_2224195_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	46.1	6.8e-13
WP_061573857.1|2224210_2224462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061573814.1|2224487_2224733_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	85.5	7.2e-27
WP_079005095.1|2224804_2225479_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.8	2.1e-76
WP_079005094.1|2225548_2226361_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	86.3	3.9e-138
WP_079005093.1|2226434_2226842_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	88.7	8.5e-65
WP_079005092.1|2227297_2227801_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.1	7.8e-36
WP_062623441.1|2227841_2228150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623442.1|2228161_2228686_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.1	4.6e-47
WP_079005091.1|2229054_2229429_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	61.8	1.4e-34
WP_046559767.1|2229442_2229658_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	97.2	1.1e-31
WP_020954117.1|2229831_2230014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045207879.1|2230058_2230322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005090.1|2230335_2230962_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	87.6	4.6e-102
WP_079005089.1|2231116_2231455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005088.1|2231784_2231988_-	hypothetical protein	NA	O64115	Bacillus_phage	92.5	1.6e-32
WP_079005087.1|2232033_2234232_-	AAA family ATPase	NA	Q4Z932	Staphylococcus_phage	42.2	1.3e-156
WP_079005086.1|2234328_2234712_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.4	3.6e-57
WP_041352901.1|2234708_2234912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061573808.1|2234908_2235319_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	60.9	3.4e-37
WP_053574311.1|2235315_2235516_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	89.1	1.0e-26
2235917:2235939	attL	AATACTTATTTTATTTTTATTCT	NA	NA	NA	NA
WP_020954128.1|2235962_2236208_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_045207904.1|2236282_2236582_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	52.0	2.7e-20
WP_014471994.1|2236746_2236968_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	78.1	1.4e-26
WP_079005084.1|2237189_2238173_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	77.1	4.8e-138
WP_079005083.1|2238193_2239543_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	74.8	7.6e-187
WP_079005082.1|2239619_2240678_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	75.7	1.0e-154
WP_014471999.1|2240890_2241121_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014472000.1|2241135_2241348_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_108490789.1|2241774_2241915_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_079005081.1|2241936_2243085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005080.1|2243247_2243658_-	pilus assembly protein HicB	NA	A0A1L2JY34	Aeribacillus_phage	59.7	1.6e-39
WP_079005079.1|2243762_2244452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095836069.1|2244522_2244654_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	86.0	1.0e-16
WP_079005078.1|2244666_2244882_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	56.3	9.4e-15
WP_079005077.1|2244884_2245136_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.2	1.2e-21
WP_014417903.1|2245206_2245389_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_079005076.1|2245403_2245628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005075.1|2245673_2246306_-	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	52.4	2.2e-51
WP_079005074.1|2246386_2246860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005073.1|2246872_2247190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005072.1|2247229_2247619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005071.1|2247678_2247993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2248110_2248314_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
2253472:2253494	attR	AATACTTATTTTATTTTTATTCT	NA	NA	NA	NA
>prophage 8
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	2262674	2312538	4063541	capsid,holin,integrase,tail	Bacillus_phage(85.71%)	41	2270506:2270521	2300523:2300538
WP_079005057.1|2262674_2265203_+	hypothetical protein	NA	O64076	Bacillus_phage	84.0	0.0e+00
WP_077722257.1|2265456_2265732_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	93.4	3.5e-38
WP_003230977.1|2267803_2268004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005054.1|2268015_2269215_+	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.5	8.3e-68
WP_079005053.1|2269363_2269864_+|capsid	capsid protein	capsid	A0A1P8CWS3	Bacillus_phage	31.4	5.1e-19
WP_079005052.1|2269972_2270980_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.2	2.8e-08
2270506:2270521	attL	ATATATTCGTTTCCGT	NA	NA	NA	NA
WP_079005051.1|2270979_2274045_+	heavy metal transporter	NA	A0A0K2FLD6	Brevibacillus_phage	30.0	8.1e-51
WP_079005050.1|2274063_2275605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005049.1|2275622_2276777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559809.1|2276817_2277282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559810.1|2277305_2278412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559811.1|2278466_2278940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064778365.1|2278953_2279340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079005048.1|2279349_2280015_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	4.0e-48
WP_095836098.1|2280017_2280518_+	hypothetical protein	NA	A0A1P8CWR3	Bacillus_phage	68.7	1.2e-63
WP_022553075.1|2280514_2281225_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	64.7	6.0e-90
WP_022553074.1|2281265_2282069_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	56.6	1.3e-69
WP_064778362.1|2282084_2282552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022553073.1|2282623_2282980_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_079005047.1|2282979_2284314_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.6	1.3e-26
WP_076982967.1|2284647_2284842_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	2.6e-11
WP_064778360.1|2284924_2285410_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.3	1.8e-58
WP_079005046.1|2285409_2285826_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	7.6e-45
WP_064778358.1|2285839_2286817_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2FM05	Brevibacillus_phage	59.7	7.9e-109
WP_064778356.1|2287416_2288097_+	hypothetical protein	NA	Q37974	Bacillus_phage	68.3	8.6e-78
WP_079005045.1|2288155_2295040_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	58.6	0.0e+00
WP_079005044.1|2295097_2295856_+|tail	phage tail protein	tail	O64045	Bacillus_phage	84.1	4.2e-126
WP_079005043.1|2299170_2299986_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	63.2	2.1e-94
WP_079005042.1|2299999_2302549_+	hypothetical protein	NA	D6R401	Bacillus_phage	37.5	4.9e-142
2300523:2300538	attR	ACGGAAACGAATATAT	NA	NA	NA	NA
WP_079005041.1|2302718_2303765_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	54.7	1.1e-87
WP_014472511.1|2303871_2304243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|2304255_2304507_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_099762739.1|2304845_2305151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020954197.1|2305302_2306463_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_046559826.1|2306626_2307877_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	92.1	2.1e-223
WP_064778347.1|2307869_2308202_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	6.9e-41
WP_079005039.1|2308418_2309177_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_064778345.1|2309304_2309646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982784.1|2309848_2309938_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_079005038.1|2310232_2310784_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	57.8	5.0e-52
WP_079005037.1|2310783_2312538_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	70.2	2.0e-240
>prophage 9
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	2417349	2423602	4063541		Staphylococcus_phage(66.67%)	10	NA	NA
WP_003153378.1|2417349_2417943_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2417932_2418688_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2418895_2418985_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2419072_2419594_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153374.1|2419538_2419754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153373.1|2419659_2420034_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2420150_2420615_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2420647_2421844_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_079005021.1|2421858_2422506_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.1e-39
WP_014305330.1|2422486_2423602_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.5e-55
>prophage 10
NZ_CP041361	Bacillus velezensis strain WRN014 chromosome, complete genome	4063541	3728562	3773684	4063541	coat,protease	Cafeteria_roenbergensis_virus(11.11%)	48	NA	NA
WP_003151043.1|3728562_3729222_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3729327_3729516_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003151040.1|3729553_3729973_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151038.1|3730071_3730305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151037.1|3730363_3731743_+	amino acid permease	NA	NA	NA	NA	NA
WP_003151036.1|3731806_3732307_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003151035.1|3732346_3733648_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3733808_3734033_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003151032.1|3734237_3735011_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151030.1|3735311_3735587_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085924.1|3735587_3736142_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_060387228.1|3736239_3737160_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	8.4e-36
WP_003151025.1|3737156_3738110_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014306028.1|3738099_3738936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014306029.1|3738926_3739724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063174469.1|3739692_3740616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3740664_3740844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063174468.1|3740995_3741859_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003151014.1|3741905_3742805_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_015387551.1|3742920_3743898_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3743934_3744906_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3745168_3745933_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003151010.1|3746052_3746832_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_052586859.1|3746848_3748048_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003151007.1|3748060_3749242_-	MFS transporter	NA	NA	NA	NA	NA
WP_057080304.1|3749238_3750657_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003151003.1|3750674_3751436_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
WP_015387548.1|3751432_3752143_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003150997.1|3752132_3752747_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_014306036.1|3752908_3754147_-	MFS transporter	NA	NA	NA	NA	NA
WP_052586863.1|3754370_3755573_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.6	8.4e-28
WP_014306038.1|3755605_3757024_-	amino acid permease	NA	NA	NA	NA	NA
WP_014306039.1|3757048_3758731_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003150992.1|3758802_3760350_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015387545.1|3760557_3761844_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_003150988.1|3762029_3762491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387544.1|3762706_3763162_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003150984.1|3763158_3764007_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_014306044.1|3764027_3764975_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
WP_003150981.1|3764977_3765715_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_063174466.1|3765742_3766747_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|3766748_3767492_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_060387235.1|3767481_3768603_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_025853631.1|3768602_3769466_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150976.1|3769466_3770636_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_015387538.1|3770658_3772083_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_024085938.1|3772087_3772858_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_003150971.1|3773138_3773684_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
