The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041362	Citrobacter amalonaticus strain 133355-SW-C4-Cam chromosome, complete genome	4722748	562369	570048	4722748		Thermobifida_phage(16.67%)	10	NA	NA
WP_012908509.1|562369_563224_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_042325036.1|563257_563749_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|563864_564152_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_142764828.1|564174_565608_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_044263650.1|565655_566381_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.9e-22
WP_142764829.1|566387_566942_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_044255950.1|566910_567486_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_042998303.1|567482_568049_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	5.0e-55
WP_042998302.1|568069_569056_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	5.1e-39
WP_142764830.1|569070_570048_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.0	7.4e-06
>prophage 2
NZ_CP041362	Citrobacter amalonaticus strain 133355-SW-C4-Cam chromosome, complete genome	4722748	1825284	1863299	4722748	terminase,tail,protease,holin,portal,capsid,integrase,head	Enterobacteria_phage(35.14%)	50	1826245:1826304	1861662:1861723
WP_012905355.1|1825284_1825944_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
1826245:1826304	attL	ACCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGC	NA	NA	NA	NA
WP_061070694.1|1826406_1827435_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	5.6e-81
WP_071888413.1|1827373_1827652_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_142764988.1|1827721_1830004_-	exonuclease	NA	S4TNL0	Salmonella_phage	45.8	1.1e-113
WP_142765490.1|1830145_1830472_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_043001146.1|1830483_1830822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046402092.1|1830982_1831174_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_043001144.1|1831303_1831528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266817.1|1831801_1832209_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	52.3	3.0e-30
WP_044266820.1|1832339_1832567_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	78.7	3.8e-30
WP_094465142.1|1832569_1833124_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.7	2.0e-16
WP_142764989.1|1833171_1834278_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	50.3	7.0e-45
WP_139155853.1|1834189_1834735_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	73.2	1.6e-66
WP_142764990.1|1834750_1835467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142764991.1|1835463_1835670_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	61.5	5.8e-14
WP_142764992.1|1835666_1836497_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.4	1.2e-70
WP_142764993.1|1836811_1838974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142764994.1|1838966_1839959_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2H4PAK4	Aphanizomenon_phage	30.5	2.8e-29
WP_115625652.1|1839955_1840345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266846.1|1840630_1840864_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	84.4	3.5e-31
WP_142764995.1|1840907_1841153_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.3	1.1e-22
WP_142764996.1|1841278_1841479_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	57.6	3.0e-15
WP_043001131.1|1841481_1841862_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.9	4.4e-47
WP_043001130.1|1841837_1842872_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	51.7	6.0e-99
WP_142764997.1|1842885_1843485_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	71.9	3.6e-80
WP_142764998.1|1843823_1844270_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_142764999.1|1844269_1844737_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	34.6	2.8e-11
WP_142765000.1|1845035_1846088_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.8	4.4e-174
WP_046401839.1|1846231_1846555_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	83.8	6.1e-42
WP_142765001.1|1846538_1846988_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	78.5	6.7e-63
WP_142765002.1|1846984_1847521_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	50.3	1.7e-12
WP_042319517.1|1847764_1847977_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	75.7	5.4e-23
WP_071887719.1|1847987_1848176_+	cold-shock protein	NA	NA	NA	NA	NA
WP_142765003.1|1848241_1848472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141227697.1|1848680_1848854_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_142765004.1|1849203_1849749_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	94.5	6.4e-92
WP_142765005.1|1849723_1851646_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	95.0	0.0e+00
WP_043001120.1|1851645_1851852_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	86.8	1.5e-25
WP_142765006.1|1851848_1853441_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	86.6	8.8e-275
WP_142765007.1|1853421_1854747_+	S49 family peptidase	NA	O64320	Escherichia_phage	79.4	5.9e-184
WP_046401846.1|1854756_1855086_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	71.7	4.6e-37
WP_142765008.1|1855156_1856182_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	87.7	4.5e-171
WP_142765009.1|1856228_1856627_+	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	45.3	1.6e-15
WP_142765010.1|1856638_1856992_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	66.7	8.7e-42
WP_046401862.1|1857265_1858231_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	61.7	2.2e-111
WP_142765011.1|1858240_1860649_+	hypothetical protein	NA	I7B6L0	Escherichia_phage	47.0	2.1e-131
WP_142765012.1|1860818_1861058_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	57.0	4.4e-21
WP_061070271.1|1861059_1861380_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.7	6.5e-28
WP_142765013.1|1862083_1862926_+	hypothetical protein	NA	NA	NA	NA	NA
1861662:1861723	attR	ACCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_085048583.1|1863092_1863299_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	2.5e-09
>prophage 3
NZ_CP041362	Citrobacter amalonaticus strain 133355-SW-C4-Cam chromosome, complete genome	4722748	2996910	3005333	4722748	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_142765263.1|2996910_2998944_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.0e-53
WP_043000154.1|2999147_2999606_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	66.7	1.1e-49
WP_043001885.1|2999650_3000121_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.8	3.1e-63
WP_043000153.1|3000167_3000887_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043000152.1|3000879_3002568_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.5	2.4e-278
WP_043000151.1|3002791_3003523_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.9	8.3e-103
WP_042318015.1|3003582_3003690_+	protein YohO	NA	NA	NA	NA	NA
WP_043000150.1|3003670_3004402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044258667.1|3004385_3005333_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.7e-07
>prophage 4
NZ_CP041362	Citrobacter amalonaticus strain 133355-SW-C4-Cam chromosome, complete genome	4722748	3539415	3550338	4722748	integrase	Enterobacteria_phage(71.43%)	11	3539343:3539365	3550337:3550359
3539343:3539365	attL	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
WP_142765343.1|3539415_3540627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	1.3e-105
WP_131162445.1|3540575_3542720_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_131162444.1|3542716_3543388_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_131162443.1|3543595_3544162_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	61.6	7.7e-56
WP_000984211.1|3544178_3544424_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_142765344.1|3544420_3545158_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	66.1	6.2e-82
WP_142765345.1|3545958_3546507_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.8	9.1e-30
WP_131162438.1|3546503_3546731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131162437.1|3546727_3547048_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_142765346.1|3547062_3549396_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_142765347.1|3549837_3550338_+	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	62.0	2.3e-40
3550337:3550359	attR	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
