The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	1303	14682	5567434	tail	Stx2-converting_phage(60.0%)	17	NA	NA
WP_048814763.1|1303_1624_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	99.1	8.7e-49
WP_001154345.1|1731_1905_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001414206.1|1975_2899_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_142987981.1|2953_3274_+	cell wall hydrolase	NA	A0A0P0ZDT1	Stx2-converting_phage	100.0	7.6e-53
WP_142987982.1|3051_3690_+	NlpC/P60 family protein	NA	Q6H9T4	Enterobacteria_phage	99.3	6.5e-88
WP_122994717.1|3635_4268_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_142987983.1|4506_7986_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_001230508.1|8053_8653_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268850.1|8717_10031_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001023455.1|10032_10302_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000491542.1|10442_11318_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|11542_12193_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_012779375.1|12177_12462_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_001322269.1|12907_13102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|13041_13173_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001492395.1|13211_13355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303036.1|13515_14682_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
>prophage 2
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	29347	96663	5567434	tail,integrase,head,transposase,portal,holin,terminase	Escherichia_phage(35.56%)	70	24988:25003	80752:80767
24988:25003	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000998048.1|29347_30886_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|30935_31283_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|31279_31660_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|32021_32567_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|32563_33307_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|33318_34398_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|34459_35395_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|35850_36768_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|36869_37820_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|37937_39581_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|40206_40923_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|41265_42720_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|42821_44138_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|44451_45504_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|45765_53748_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|54237_55035_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|55270_56293_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|56292_56496_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|56554_59026_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|59121_59310_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|59306_59495_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|59975_60128_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|60402_61047_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|61144_61372_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|61368_61794_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|61862_62900_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|62931_63354_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|63388_64087_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|64108_64333_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|64329_64686_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|64718_64871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|64867_65179_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|65305_65869_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|65978_66083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|66269_66482_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|66523_66709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|66649_66928_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|66929_67979_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|67991_68351_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|68347_69037_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|69067_69190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|69670_70099_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001303186.1|70576_72427_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_085948178.1|72508_73722_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|74041_74248_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|74252_74597_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|74647_75181_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|75336_75519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|75531_75663_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|75890_76076_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|76602_76917_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|76998_77223_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|77617_78127_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_142987984.1|78098_80027_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.5e-260
WP_000259002.1|80010_80217_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|80213_81806_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
80752:80767	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|81795_83301_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|83337_83685_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|83742_84009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|83990_84731_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|84744_85176_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|85202_85616_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|85596_88176_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847298.1|88172_88502_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|88501_89200_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|89210_89954_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_123007081.1|89899_90529_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_001230508.1|94315_94915_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001303169.1|94979_96392_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	92.1	2.7e-78
WP_001023407.1|96393_96663_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 3
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	150093	175541	5567434	tail,integrase,transposase	Enterobacteria_phage(76.0%)	34	168677:168690	178683:178696
WP_085952872.1|150093_151307_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_142987985.1|151344_151692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001283421.1|151688_153521_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|153577_154126_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001303543.1|155117_155399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801851.1|155419_155614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032161583.1|155555_156692_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|156642_156966_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|157123_158308_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|158307_158820_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|158874_159240_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|159275_159404_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|162206_162695_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|162851_163424_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|163467_163884_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|165089_165404_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|165408_166368_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|166444_169267_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
168677:168690	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|169273_169639_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|169711_169942_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|170264_170564_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|170560_170827_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|170823_171027_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|171050_171467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|171559_171673_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|171669_171912_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|171923_172202_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|172212_172563_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|172584_172788_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|172859_172997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|173086_173491_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|173506_174157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|174186_174534_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|174539_175541_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
178683:178696	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	496066	612220	5567434	tail,protease,transposase,capsid,head,portal,holin,terminase	Stx2-converting_phage(41.67%)	141	NA	NA
WP_001260835.1|496066_496888_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|496987_497071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|497163_497499_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|497895_499149_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|499255_500149_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|500283_501504_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|501628_502324_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|502276_503569_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|503726_504341_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|504383_505238_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|505239_505857_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|505867_508291_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|508351_510778_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|510976_511282_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|511389_512100_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|512102_512663_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|512697_513039_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|513173_513500_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|513672_513798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|514488_514725_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_085948178.1|516247_517461_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001090196.1|518689_518881_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|518877_519066_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|519466_519631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|519634_519853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|519924_520224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|520575_520854_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|520855_521047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|521067_521439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|521536_521839_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|521835_522261_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|522283_523246_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|523252_523993_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|524803_525199_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|525255_525840_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|525955_526060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|526248_526461_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|526628_526907_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|526908_527958_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|527970_528330_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|528326_529016_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|529046_529169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|529650_530079_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|530557_532408_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|532856_533063_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|533067_533412_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_137330336.1|533351_533576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001056806.1|534264_534834_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|534833_534980_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|535207_535393_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|535817_536045_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|536086_536452_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958360.1|536741_537305_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_001303187.1|537301_538963_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|539026_540964_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|541008_541230_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001303188.1|541175_543677_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.0	0.0e+00
WP_000126019.1|543756_544083_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|544092_544443_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|544439_544886_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|544882_545227_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|545285_546002_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|546007_546382_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|546477_546687_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212920.1|546738_549981_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|549973_550315_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179503.1|550314_550752_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	99.2	1.9e-62
WP_048814788.1|550939_554200_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|554202_554418_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|554485_555085_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268842.1|555149_556373_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|556374_556644_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|556757_557333_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_010917823.1|557711_558059_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|558043_558694_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|559276_560815_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|560864_561212_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|561208_561589_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|562551_562866_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|563504_564749_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000449175.1|565025_565214_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|565778_565988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|565988_566627_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|566638_566791_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|567083_567422_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|567813_568056_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|568039_568465_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001356791.1|568533_569589_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_001379651.1|569620_570043_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|570076_570793_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|570825_571107_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|571103_571331_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|571323_571635_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|571762_571981_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|571982_572540_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|572773_572986_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|573105_573450_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191871.1|573571_573844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265229.1|573845_574895_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|574907_575213_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|575275_575830_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|576054_576252_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|576386_577100_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|577550_577982_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_064234946.1|578459_580310_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411805.1|580757_580964_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|580968_581313_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|581363_581897_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|582167_582737_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|582736_582883_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|583110_583296_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|583720_583948_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|583989_584355_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958392.1|584644_585208_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|585204_586866_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000173065.1|586929_588867_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_001063023.1|588911_589133_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|591173_591500_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|591509_591860_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|591856_592303_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|592299_592644_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|592702_593419_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|593424_593799_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|593894_594104_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|594156_597399_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|597391_597733_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303180.1|597732_598431_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000194720.1|598441_599185_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|599130_599763_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000143597.1|601669_604183_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_001230508.1|604250_604850_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001303181.1|604914_606228_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|606229_606499_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|606612_607188_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|607260_607890_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|607971_608613_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001480712.1|608643_608778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|608774_609089_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|609148_610432_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|610520_611981_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|612016_612220_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 5
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	881331	1000006	5567434	tail,protease,integrase,transposase,capsid,head,lysis,portal,holin,terminase	Enterobacteria_phage(34.95%)	143	925135:925194	984143:984205
WP_000422055.1|881331_882381_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|882600_883359_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|883355_883946_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|883985_884858_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|885070_886654_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|886681_887302_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|887298_888180_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|888317_888362_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|888453_890016_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|890015_891611_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000209521.1|892983_894177_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|894176_894983_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|895363_895543_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|895628_896129_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|896174_896681_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032156508.1|897718_898303_-	protein kinase	NA	NA	NA	NA	NA
WP_001023406.1|899433_899703_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_048814667.1|899704_901018_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	5.1e-79
WP_001303160.1|901082_901682_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.8e-109
WP_001303164.1|901748_905225_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.2	0.0e+00
WP_064761467.1|905465_906095_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_048814666.1|906040_906784_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	7.3e-147
WP_001303165.1|906789_907488_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	2.4e-131
WP_000847298.1|907487_907817_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303163.1|907813_910459_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|910502_910811_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|910837_911260_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|911273_912026_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|912033_912432_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|912444_913068_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|913070_913352_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|913344_913671_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|913758_915738_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|915727_917230_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|917229_917442_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|917438_919562_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|919558_920035_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|920509_920695_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|921213_921747_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|921783_922341_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|922344_922560_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|922637_922883_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|922923_923103_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_137531777.1|923240_925187_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
925135:925194	attL	GCAAGGTCTGACGGCGACGCCGCCCTGACAACATCATAATGTTTAAATGTCATTATTCCT	NA	NA	NA	NA
WP_001303214.1|925781_926840_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	97.7	8.3e-205
WP_000917735.1|926990_927188_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|927414_928236_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|928232_928607_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|928619_929669_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_072166534.1|929670_929949_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001217394.1|930018_930276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|930496_930709_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|930897_931002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|931117_931480_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|931476_931848_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|931883_932096_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|932144_932501_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|932557_932953_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|932968_933739_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_001302109.1|933773_934196_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	2.2e-76
WP_000020570.1|934227_935268_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|935239_935791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|935774_936002_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|936079_936487_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|936676_936832_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|936991_937210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|937213_937378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|937775_937964_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|937960_938149_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|938241_940686_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|940750_940999_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|940976_942107_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000147167.1|942594_942813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|943406_943835_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|945563_946154_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|946337_946985_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|947121_947268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|947695_947974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|948313_948694_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|948690_949038_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|949087_950626_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|951591_952161_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|952226_953138_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|953244_953367_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|954508_954697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|954964_956290_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|957316_957586_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|957587_958901_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228334.1|959052_959652_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000514948.1|959719_962575_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_122989782.1|962815_963445_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000194801.1|963390_964134_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|964144_964843_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|964842_965172_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643101.1|965168_967781_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000533440.1|967761_968175_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|968201_968624_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|968637_969390_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|969397_969793_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|969789_970323_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|970337_970691_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|970702_971101_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|971142_972168_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|972223_972556_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|972565_973885_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|973865_975467_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|975463_975670_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|975666_977592_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|977566_978112_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_032161313.1|978225_978483_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_001303940.1|978498_978723_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|978804_979119_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|979582_980050_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|980057_980204_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|980203_980773_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|981043_981577_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|981627_981972_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|981976_982192_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|982341_984195_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|984314_984500_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
984143:984205	attR	GCAAGGTCTGACGGCGACGCCGCCCTGACAACATCATAATGTTTAAATGTCATTATTCCTCCC	NA	NA	NA	NA
WP_000917750.1|986199_986397_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|986638_987169_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|987177_987537_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|987549_988596_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|988597_988876_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|988945_989203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|989423_989636_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|989914_990673_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|991371_991536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|991532_992114_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|992300_992723_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|992754_993795_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|993766_994318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|994301_994529_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|994605_995013_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|995275_995575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|995647_995866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|995888_996296_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|996273_996507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|996500_996668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|997065_997254_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|997250_997442_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|997534_1000006_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
>prophage 6
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	1048136	1157125	5567434	tail,protease,integrase,transposase,capsid,head,lysis,portal,tRNA,holin,terminase	Enterobacteria_phage(48.21%)	116	1085316:1085331	1151028:1151043
WP_001299679.1|1048136_1049393_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|1049606_1050230_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|1050229_1051081_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|1051231_1052179_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001303185.1|1052303_1053983_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.8e-23
WP_000823885.1|1054037_1054316_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|1054593_1055178_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|1055294_1056386_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001310261.1|1060213_1062133_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|1062360_1063431_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|1063441_1064074_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|1064084_1065503_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|1065815_1065944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|1066049_1067507_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|1067534_1067735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|1067842_1068865_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|1068864_1069845_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|1069841_1070600_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000904019.1|1070609_1071254_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|1071198_1071480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|1071418_1072273_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|1072298_1074269_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|1074318_1074573_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|1074773_1075370_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|1075421_1076634_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|1076822_1077434_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|1077533_1078448_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|1078543_1080280_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|1080382_1080472_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|1080437_1081651_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|1081988_1083059_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|1083068_1084367_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|1084729_1086262_+	SpoVR family protein	NA	NA	NA	NA	NA
1085316:1085331	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|1086313_1087033_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|1087254_1088796_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|1088941_1089472_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000897378.1|1090784_1091204_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|1091576_1092488_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|1092694_1093156_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|1093232_1093892_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|1093963_1094257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|1094497_1094899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|1095001_1095370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|1095889_1096585_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|1096608_1097421_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|1097424_1097691_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|1098926_1099511_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|1100009_1100963_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|1101149_1102634_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|1102936_1104475_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|1104524_1104872_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1104868_1105249_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|1105324_1105573_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|1105629_1106298_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|1106795_1106978_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|1107056_1107557_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|1107593_1108100_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|1108118_1109009_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|1109128_1109710_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|1109709_1112625_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|1112689_1113289_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|1113355_1116754_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|1116814_1117447_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|1117383_1118127_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|1118132_1118831_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|1118830_1119160_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000459457.1|1121697_1122132_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|1122113_1122536_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|1122551_1123292_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|1123299_1123695_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|1123691_1124270_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|1124280_1124634_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|1124645_1125044_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|1125085_1126111_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|1126166_1126499_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|1126508_1127828_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001303133.1|1127808_1129410_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	8.8e-307
WP_000198153.1|1129406_1129613_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|1129609_1131535_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|1131509_1132055_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|1132443_1132638_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|1132802_1133009_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|1133294_1133705_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_085948178.1|1133893_1135107_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738495.1|1135309_1135603_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|1135693_1135876_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|1136092_1136569_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|1136555_1136861_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|1137182_1137872_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|1137868_1138009_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|1138005_1138368_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|1138364_1138655_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|1138647_1138818_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|1138817_1139273_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|1139463_1139655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|1139774_1141301_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|1141358_1141481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|1141545_1141878_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1141945_1142248_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|1142244_1142946_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|1142942_1143767_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|1143870_1144107_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|1144096_1145239_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|1145352_1146603_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_048814605.1|1146774_1147428_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1147437_1147899_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|1147952_1149059_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|1149094_1149736_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1149739_1151110_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
1151028:1151043	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|1151278_1151950_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|1151949_1153410_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|1154010_1154292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1154547_1155090_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|1155295_1155709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|1155721_1156057_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|1156069_1157125_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 7
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	1163217	1220565	5567434	tail,integrase,head,capsid,holin,terminase	Stx2-converting_phage(26.79%)	70	1206133:1206153	1227222:1227242
WP_000085256.1|1163217_1164447_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|1164695_1165817_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|1165865_1167092_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|1167341_1168478_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|1168461_1169325_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|1169355_1169568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1169688_1171050_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|1171110_1171386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|1171465_1171591_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_115455637.1|1173694_1177096_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_115801847.1|1180053_1180143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|1180155_1180392_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|1180337_1181075_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|1181128_1182007_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|1182309_1182420_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|1182529_1182784_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|1182800_1183499_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|1183498_1183840_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212850.1|1183832_1187075_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_001453698.1|1187127_1187337_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|1187432_1187807_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|1187821_1188538_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|1188603_1188948_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1188944_1189391_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|1189387_1189738_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|1189747_1190074_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|1192599_1192821_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|1192865_1194803_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001303187.1|1194866_1196528_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|1196524_1197088_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|1197377_1197743_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|1197784_1197970_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|1198099_1198240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1198596_1198821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1198885_1199092_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|1199319_1199466_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1199465_1200035_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|1200305_1200839_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|1200889_1201234_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|1201238_1201454_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|1201529_1201799_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|1201836_1202019_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|1202166_1204104_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|1204418_1204586_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|1205182_1206004_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|1206000_1206375_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
1206133:1206153	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|1206387_1207437_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|1207438_1207717_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|1207884_1208097_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|1208285_1208390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|1208505_1209093_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|1209095_1209287_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|1209288_1209726_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|1209712_1210030_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|1209983_1210301_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|1210290_1210593_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|1210589_1210907_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|1210903_1211620_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|1211653_1212076_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|1212107_1213145_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|1213213_1213639_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|1213622_1213946_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|1214070_1214547_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|1214862_1215015_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|1215129_1215645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|1215777_1216167_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|1216228_1216498_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|1216466_1217585_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000759316.1|1218541_1219588_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|1219743_1220565_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
1227222:1227242	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	1481014	1536623	5567434	tail,protease,transposase,head,holin	Enterobacteria_phage(27.91%)	68	NA	NA
WP_000003653.1|1481014_1481602_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|1481598_1482306_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|1482324_1484118_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|1484114_1485233_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|1485850_1486033_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|1487506_1487776_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|1487777_1489091_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|1489155_1489755_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|1489822_1493296_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|1493429_1493957_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|1493987_1494194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140437151.1|1494147_1494780_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	4.2e-103
WP_000194801.1|1494725_1495469_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|1495479_1496178_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|1496177_1496507_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303139.1|1496503_1499083_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000533402.1|1499063_1499477_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|1499503_1499935_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|1499948_1500689_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|1500670_1500937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|1500994_1501342_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000259002.1|1504460_1504667_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|1506549_1506792_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|1506841_1508380_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1508429_1508777_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1508773_1509154_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|1509229_1509505_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|1510255_1510462_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|1510424_1510769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|1510717_1510990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|1510922_1511117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1511149_1511683_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1511903_1512017_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1512238_1512424_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1512950_1513265_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|1513469_1514683_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|1514858_1516709_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|1516826_1517030_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|1517476_1518190_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|1518284_1518524_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|1518810_1519629_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|1519780_1520152_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|1520141_1520513_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|1520525_1521575_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|1521576_1521855_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|1522022_1522235_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|1522279_1522417_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|1522782_1523556_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1523907_1524321_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|1524336_1525107_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|1525128_1525875_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|1525881_1526973_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|1527051_1527507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1527713_1528139_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1528122_1528395_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1528503_1528905_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1528932_1529124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1529123_1529411_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|1529412_1529631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1529688_1529844_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1529985_1530375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1530561_1530747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|1530748_1531054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1531320_1531509_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1531505_1531697_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|1531790_1534262_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|1534329_1534572_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|1535963_1536623_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 9
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	1767545	1805645	5567434	tail,protease,integrase,lysis,portal,holin,terminase	Enterobacteria_phage(48.84%)	53	1767130:1767144	1805719:1805733
1767130:1767144	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|1767545_1768244_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|1768296_1768500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951025.1|1768474_1769356_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|1769525_1769687_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|1770183_1771203_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|1771236_1772217_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|1772393_1772663_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|1772664_1773981_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|1774040_1774640_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_001303146.1|1774710_1778124_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_048814615.1|1778184_1778793_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	4.2e-100
WP_000194779.1|1778729_1779473_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|1779478_1780177_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|1780186_1780516_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|1780515_1783581_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1783552_1783882_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|1783890_1784277_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|1784337_1785081_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|1785091_1785493_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|1785489_1786068_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|1786079_1786355_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1786347_1786671_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|1786757_1788785_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|1788729_1789065_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|1789186_1790311_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|1790238_1790451_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|1790447_1792550_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|1792549_1793041_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|1793030_1793309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|1793715_1793868_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|1793855_1794323_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|1794319_1794817_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|1794816_1795032_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|1795174_1795573_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1795653_1795812_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1795897_1796641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|1796824_1797514_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|1797528_1797651_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1797987_1798947_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|1799158_1799824_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|1799820_1800441_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|1800433_1800604_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|1800600_1800783_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|1801480_1802161_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|1802157_1802340_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|1802312_1802504_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|1802514_1802796_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|1802894_1803116_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|1803326_1803929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|1804053_1804239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|1804171_1804339_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|1804378_1804597_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|1804574_1805645_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
1805719:1805733	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	2384701	2438171	5567434	tail,plate,integrase,transposase	Escherichia_phage(29.41%)	49	2384272:2384286	2420162:2420176
2384272:2384286	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|2384701_2385883_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|2386845_2387589_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|2388412_2389186_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|2389243_2389798_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_077889754.1|2390404_2390695_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	95.8	2.1e-49
WP_000788819.1|2392045_2392357_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|2393218_2393512_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_085948178.1|2393621_2394834_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|2395161_2395407_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|2396476_2397730_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|2397741_2398845_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2399132_2400188_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|2400226_2400628_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|2400685_2401930_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2402021_2402480_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|2402740_2404198_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|2404254_2404791_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|2404723_2404990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|2405296_2405749_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|2405758_2406157_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|2406159_2406453_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|2406504_2407560_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|2407630_2408401_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|2408360_2410100_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|2410917_2411691_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|2411876_2412137_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|2412155_2412416_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2412571_2413312_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|2413282_2414050_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2414154_2414733_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|2414972_2417417_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|2417459_2417933_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|2418086_2418857_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|2418974_2420147_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|2420227_2420413_+	protein YncO	NA	NA	NA	NA	NA
2420162:2420176	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|2420327_2420591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|2420792_2422553_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|2422555_2423692_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|2423799_2424090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001506588.1|2424437_2424977_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|2425045_2426578_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000995683.1|2426735_2427452_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|2427591_2431824_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|2431899_2434041_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|2434250_2434769_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|2435465_2435966_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2436000_2436225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|2436275_2437667_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|2437757_2438171_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 11
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	2882503	2941514	5567434	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|2882503_2883856_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|2883949_2884501_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|2884656_2886030_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|2886205_2887204_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|2887236_2888232_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|2888218_2889241_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|2890896_2891853_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2892162_2892693_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|2892772_2893123_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|2893116_2893368_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|2893579_2893921_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|2893923_2897703_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|2897699_2899433_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|2899638_2900277_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|2900599_2901943_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|2902021_2902228_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|2902552_2903107_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|2903169_2904108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|2904319_2905060_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001303074.1|2905249_2907193_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001303072.1|2907310_2907691_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|2907779_2908640_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|2908747_2909713_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|2909820_2910483_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|2910527_2911940_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|2912248_2912869_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|2913086_2913725_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|2913859_2915068_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|2915075_2915507_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|2916129_2916924_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|2916994_2917444_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|2917485_2917713_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|2917717_2918032_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|2918038_2918434_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|2918760_2919036_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|2919164_2919851_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949515.1|2919850_2920705_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|2920714_2921365_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|2921378_2921843_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|2921852_2922158_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|2922173_2923571_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|2923925_2924990_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|2925097_2925853_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|2925849_2926599_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|2926780_2927110_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|2927258_2927534_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|2927650_2929276_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|2929359_2930523_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|2930525_2931164_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|2931173_2931572_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|2931589_2932249_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|2932299_2932998_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|2933016_2933418_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|2933544_2934276_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|2934456_2936898_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|2936936_2937362_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2937566_2938865_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2938968_2939166_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2939247_2940252_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2940254_2941514_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 12
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	3078390	3093055	5567434	tRNA,tail,integrase	Enterobacteria_phage(37.5%)	19	3074231:3074246	3091760:3091775
3074231:3074246	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|3078390_3079806_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|3079888_3080872_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|3081037_3081280_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|3081413_3082451_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|3082539_3083637_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|3083698_3083947_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|3084107_3084749_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|3084830_3085460_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|3085532_3086105_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|3086216_3086486_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|3086487_3087801_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|3087865_3088465_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|3089786_3090323_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|3090313_3090664_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|3090660_3090945_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|3090954_3091134_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|3091280_3091478_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|3091822_3092104_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
3091760:3091775	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|3092521_3093055_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 13
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	4685504	4709089	5567434	tail,holin,integrase,transposase	Enterobacteria_phage(35.29%)	30	4677150:4677164	4709960:4709974
4677150:4677164	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|4685504_4686710_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|4686711_4688025_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|4688021_4689653_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_048814609.1|4689653_4690052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4690149_4690563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526871.1|4690958_4692299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|4692374_4692677_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|4692712_4693468_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|4693797_4694364_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|4694338_4694950_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|4694946_4695612_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001303137.1|4695608_4696232_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	97.6	6.3e-112
WP_001302581.1|4696484_4697228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|4697313_4697481_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143064.1|4697888_4699742_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|4699891_4700107_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|4700111_4700456_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001171554.1|4700812_4701193_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4701189_4701537_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|4701586_4702231_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|4702037_4702928_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|4702924_4703251_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|4703468_4703738_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|4703898_4704321_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|4704450_4705509_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|4705587_4706238_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|4706420_4707011_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|4706997_4707117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|4707512_4707761_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|4708606_4709089_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4709960:4709974	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 14
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	4986705	5057984	5567434	tail,integrase,transposase,capsid,lysis,portal,holin,bacteriocin,terminase	Escherichia_phage(79.78%)	90	4991061:4991085	5056953:5056977
WP_001005794.1|4986705_4987236_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|4987235_4987703_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|4987689_4988370_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|4988379_4989516_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|4989690_4990848_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
4991061:4991085	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|4991279_4992449_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|4992432_4992615_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001303144.1|4992693_4993068_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	5.4e-50
WP_001171554.1|4993148_4993529_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4993525_4993873_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4993922_4995461_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001291844.1|4995556_4995769_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|4995728_4996355_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|4996351_4996783_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|4996838_4997516_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260980.1|4997840_4998098_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|4998226_4998424_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|4998512_4998818_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|4998860_4999430_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|4999691_5000315_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|5000318_5000606_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|5000607_5000826_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|5000827_5001043_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|5001002_5001509_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|5001510_5002458_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|5002454_5002694_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|5002686_5002890_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|5002886_5003765_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|5003872_5004316_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|5004392_5005214_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|5005277_5005625_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|5005700_5006288_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187066.1|5006287_5006977_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459721.1|5006973_5007924_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|5007940_5008222_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_024177061.1|5008242_5008464_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000917252.1|5008535_5008748_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_115455635.1|5008818_5009604_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	94.6	5.5e-137
WP_001064714.1|5010221_5011175_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|5011171_5012641_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|5012735_5013449_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|5013544_5013748_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|5013918_5014113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|5014279_5014657_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|5014650_5016171_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|5016160_5017132_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|5017131_5017581_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|5017588_5018152_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|5018148_5018343_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|5018335_5018770_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_024165517.1|5018758_5019004_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001356551.1|5019018_5019171_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|5019553_5020513_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5020524_5020794_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|5021279_5023217_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|5023351_5023531_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|5023571_5023817_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|5023894_5024110_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|5024114_5024648_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001056885.1|5024922_5025492_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|5025491_5025641_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|5025648_5026113_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|5026144_5026438_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|5026587_5026791_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|5026846_5027653_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|5027633_5029340_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|5029339_5031484_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|5031641_5032649_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|5032672_5033887_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|5033942_5034332_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|5034381_5034843_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|5034826_5035390_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|5035389_5036040_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|5036036_5037974_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|5037975_5038245_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|5038384_5038573_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_085948178.1|5040330_5041544_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000197192.1|5041802_5043071_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|5043085_5043364_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|5043369_5043987_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835362.1|5044077_5044812_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	100.0	4.4e-136
WP_024175551.1|5044742_5044988_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000078907.1|5045044_5045185_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|5045241_5045643_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|5045736_5046393_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|5046395_5046842_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|5046851_5047103_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|5047113_5048379_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|5048448_5056830_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|5057051_5057984_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
5056953:5056977	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 15
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	5304096	5411525	5567434	tail,protease,integrase,portal,tRNA,holin,terminase	Enterobacteria_phage(46.99%)	125	5388716:5388730	5413587:5413601
WP_000569336.1|5304096_5305023_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|5305027_5305759_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|5305739_5305847_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|5305906_5306608_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|5306628_5307915_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|5307948_5308203_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|5308221_5308356_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|5308359_5308602_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|5308689_5309052_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|5309048_5309405_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|5309481_5309769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|5309738_5309915_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|5309916_5310864_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|5310860_5311082_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|5311180_5311462_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|5311472_5311664_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|5311636_5311819_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|5311818_5312496_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|5312492_5313278_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|5313283_5313580_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|5313655_5313862_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|5314342_5314720_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|5314697_5315759_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|5315839_5316529_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|5316633_5316864_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|5316933_5317473_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415640.1|5317559_5318489_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_000788810.1|5318485_5319187_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|5319183_5319486_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|5319553_5319886_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|5319977_5320085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|5320142_5321669_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|5322133_5322685_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|5322694_5323492_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|5323608_5323710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|5323706_5324162_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|5324161_5324332_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|5324324_5324615_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|5324611_5324974_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|5324970_5325111_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|5325196_5325631_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_024165948.1|5325619_5325868_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001356551.1|5325882_5326035_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|5326838_5328785_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|5328921_5329101_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5329141_5329387_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|5329464_5329680_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|5329684_5330218_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|5330488_5331058_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5331057_5331204_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5331431_5331617_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|5332134_5332611_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|5332607_5334731_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|5334727_5334940_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|5334939_5336442_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|5336386_5338411_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|5338498_5338825_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|5338817_5339099_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|5339101_5339725_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|5339737_5340136_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|5340143_5340896_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|5340909_5341332_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|5341358_5341667_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_070479909.1|5341710_5344356_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|5344352_5344682_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|5344681_5345380_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|5345390_5346134_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_123007081.1|5346079_5346709_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000514991.1|5346949_5350423_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228302.1|5350490_5351090_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|5351154_5352468_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|5352469_5352739_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|5353106_5353355_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|5353869_5355555_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|5355551_5356271_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|5356317_5356788_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|5356829_5357291_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|5357415_5359419_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|5359415_5360552_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|5360544_5361276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|5361294_5362824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|5362834_5363923_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|5365163_5365481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122989774.1|5369180_5370722_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|5370885_5372166_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|5376128_5378162_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|5378293_5379403_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|5379664_5379946_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|5380227_5380770_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|5380857_5381532_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|5381547_5384028_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|5384038_5385073_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|5385154_5385493_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|5385710_5386562_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|5386681_5386954_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|5387063_5387378_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|5387387_5387735_-	hypothetical protein	NA	NA	NA	NA	NA
5388716:5388730	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|5388785_5389025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|5389358_5390147_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|5390143_5390944_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|5391008_5391827_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|5391878_5392625_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|5392598_5393564_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|5393560_5394565_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|5394561_5395839_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|5396095_5397148_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|5397446_5398301_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|5398329_5399592_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|5399601_5400054_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|5400084_5400369_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|5400372_5401728_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|5401775_5402816_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|5402915_5403695_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|5403776_5404676_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|5405081_5405399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|5405386_5405566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|5405663_5406677_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|5406792_5407092_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|5407213_5407489_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|5407666_5408167_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|5408230_5408455_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|5408454_5408754_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|5408756_5408981_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|5408977_5409253_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|5409242_5411525_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
5413587:5413601	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 16
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	5415620	5441824	5567434	tail,head,capsid,lysis,portal,tRNA,plate,holin,terminase	Escherichia_phage(70.97%)	32	NA	NA
WP_000038161.1|5415620_5416655_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|5416654_5418427_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|5418600_5419455_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|5419513_5420587_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|5420590_5421334_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_048814590.1|5421433_5421943_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846406.1|5421942_5422146_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|5422149_5422431_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|5422430_5422928_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|5422942_5423368_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|5423355_5423781_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|5423752_5423926_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|5423888_5424356_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|5424348_5424801_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|5424867_5425503_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|5425499_5425847_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|5425851_5426760_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|5426752_5427364_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001008233.1|5428575_5429019_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_000905094.1|5430140_5430734_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|5430793_5431984_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|5431996_5432515_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|5432571_5432847_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|5432879_5432999_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|5432991_5435439_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|5435453_5435933_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|5435932_5437096_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|5437177_5437396_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|5437669_5439031_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|5439178_5439511_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|5439701_5440424_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|5440420_5441824_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 17
NZ_CP015853	Escherichia coli strain ATCC 43889 chromosome, complete genome	5567434	5525046	5566498	5567434	tail,protease,integrase,head,capsid,lysis,holin,terminase	Stx2-converting_phage(45.45%)	67	5515997:5516011	5531434:5531448
5515997:5516011	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|5525046_5526225_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|5526205_5526397_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|5526474_5526819_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|5527006_5527357_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|5527353_5527710_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|5527786_5528074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|5528043_5528220_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289930.1|5528221_5529169_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|5529165_5529387_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|5529485_5529767_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|5529793_5529985_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|5529957_5530140_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|5530136_5530817_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001301718.1|5530813_5531599_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
5531434:5531448	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|5531604_5531901_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|5531975_5532119_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|5532087_5532252_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|5532324_5532693_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|5532875_5533127_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|5533185_5533458_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|5533435_5533618_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|5534186_5534708_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|5535209_5535905_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|5535980_5536196_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|5536337_5536634_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|5536814_5537636_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|5537632_5539009_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|5539079_5539358_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|5539490_5539706_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|5539716_5539953_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|5539909_5540356_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|5540352_5540880_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|5540876_5541059_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|5541333_5542092_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001302729.1|5541997_5542192_-	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
WP_000849633.1|5542347_5543028_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|5543102_5543825_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|5543824_5544430_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|5544426_5545098_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|5545088_5545577_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|5546226_5547186_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|5547197_5547467_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|5547763_5548087_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_120795341.1|5548330_5550268_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.5	0.0e+00
WP_000143458.1|5550404_5550584_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|5550624_5550897_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|5550973_5551189_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|5551188_5551686_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|5551682_5552120_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|5552322_5552820_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|5552816_5553074_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|5553536_5553764_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|5553805_5554171_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001367009.1|5554167_5554347_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	92.9	1.0e-22
WP_000958422.1|5554462_5555026_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_001301491.1|5555022_5556684_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_001303194.1|5556747_5558685_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|5558729_5558951_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|5561476_5561803_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|5561812_5562163_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|5562159_5562606_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5562602_5562947_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|5563005_5563722_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|5563727_5564102_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5564197_5564407_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_142987988.1|5565732_5565996_+	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	95.2	8.0e-24
WP_142987989.1|5566189_5566498_+|tail	phage tail protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	76.3	2.1e-28
>prophage 1
NZ_CP015854	Escherichia coli strain ATCC 43889 plasmid, complete genome	92854	32882	85066	92854	protease,transposase,integrase	Macacine_betaherpesvirus(30.77%)	47	63835:63849	84791:84805
WP_001034100.1|32882_36785_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|38182_38362_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|38963_39785_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|39784_40891_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|40980_42702_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|42775_43774_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|44141_44522_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|44518_44866_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|44915_46454_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_115446889.1|46729_46936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302198.1|46839_47055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|47117_49814_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|49900_50776_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|50833_52744_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|52743_54249_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|54250_55474_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000173396.1|56502_56850_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|56846_57446_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|57442_58420_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|58458_59631_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|59617_60130_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|60187_61021_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|61112_61514_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|63404_63920_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
63835:63849	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|63921_66918_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|66967_69088_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001303402.1|70596_70791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|70820_71105_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|71105_71303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|71273_71504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|71624_72365_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|72649_73627_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|73939_74128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|74034_74235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|74231_74852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|74848_75532_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|75990_76209_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|76210_76516_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|76516_77323_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|77999_78080_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|78045_79259_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000772446.1|80262_81429_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|81428_82400_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|82784_83057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|83094_83997_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|84000_84306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|84382_85066_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
84791:84805	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
