The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040843	Leptospira weilii strain CUD13 chromosome I, complete sequence	3978120	1070389	1085072	3978120	integrase	Leptospira_phage(85.71%)	8	1064514:1064528	1084878:1084892
1064514:1064528	attL	TAAATCACTATGCTC	NA	NA	NA	NA
WP_004498002.1|1070389_1071262_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	79.5	6.8e-128
WP_004497997.1|1071757_1072690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498006.1|1072806_1073514_+	HNH endonuclease	NA	X2KTP9	Mycobacterium_phage	38.2	3.7e-07
WP_004498009.1|1073659_1074244_-	hypothetical protein	NA	S5WIZ6	Leptospira_phage	88.6	9.2e-89
WP_004497992.1|1074246_1075608_-	hypothetical protein	NA	S5VTD5	Leptospira_phage	95.8	2.7e-256
WP_004499991.1|1075639_1077052_-	hypothetical protein	NA	S5WIY5	Leptospira_phage	54.7	8.9e-146
WP_004499994.1|1077089_1078001_-	hypothetical protein	NA	S5W9U9	Leptospira_phage	85.5	1.1e-136
WP_004499990.1|1078283_1085072_+	RHS repeat-associated core domain protein	NA	S5VY91	Leptospira_phage	63.6	0.0e+00
1084878:1084892	attR	GAGCATAGTGATTTA	NA	NA	NA	NA
>prophage 2
NZ_CP040843	Leptospira weilii strain CUD13 chromosome I, complete sequence	3978120	1394867	1405298	3978120	integrase	Clostridium_phage(16.67%)	13	1390664:1390683	1404810:1404829
1390664:1390683	attL	GGTGAAGTTGGCACCTTAGA	NA	NA	NA	NA
WP_142511161.1|1394867_1395893_+	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	36.2	2.0e-09
WP_004495043.1|1395870_1396536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499698.1|1396637_1396847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036075960.1|1396987_1397197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004497460.1|1397399_1397594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004497469.1|1397599_1397959_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_004497461.1|1397936_1398137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036075202.1|1398168_1398567_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	39.8	1.0e-06
WP_142499699.1|1398739_1401580_+	toprim domain-containing protein	NA	A0A1S5RGC5	Helicobacter_phage	24.5	1.8e-20
WP_036075221.1|1401576_1401948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036075223.1|1401944_1403015_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.5	5.2e-21
WP_004501299.1|1403343_1404117_+	AAA family ATPase	NA	H7BUL8	unidentified_phage	28.7	6.2e-08
WP_004501301.1|1404113_1405298_+	hypothetical protein	NA	S5VKH6	Leptospira_phage	44.2	1.3e-60
1404810:1404829	attR	GGTGAAGTTGGCACCTTAGA	NA	NA	NA	NA
>prophage 3
NZ_CP040843	Leptospira weilii strain CUD13 chromosome I, complete sequence	3978120	1410576	1423239	3978120	integrase	Leptospira_phage(33.33%)	11	1407776:1407799	1427217:1427240
1407776:1407799	attL	CGGGGAACGCTCTTGGAATTTTGC	NA	NA	NA	NA
WP_142499908.1|1410576_1413915_+	hypothetical protein	NA	S5VY01	Leptospira_phage	70.3	2.2e-158
WP_004502136.1|1413937_1414474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004502134.1|1414601_1414811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499702.1|1414947_1415157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501434.1|1415420_1415756_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004495222.1|1415745_1415952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004496247.1|1415967_1416354_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	33.6	4.0e-08
WP_004496244.1|1416532_1419433_+	DNA primase	NA	A0A1S5RGC5	Helicobacter_phage	26.1	1.5e-25
WP_061235355.1|1419787_1420861_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.7	1.2e-17
WP_004501441.1|1421188_1421962_+	AAA family ATPase	NA	A0A1J1J9T1	Escherichia_phage	25.0	5.3e-07
WP_142499705.1|1421958_1423239_+	ParB N-terminal domain-containing protein	NA	S5VKH6	Leptospira_phage	42.0	2.1e-61
1427217:1427240	attR	CGGGGAACGCTCTTGGAATTTTGC	NA	NA	NA	NA
>prophage 4
NZ_CP040843	Leptospira weilii strain CUD13 chromosome I, complete sequence	3978120	1498947	1541702	3978120	terminase,tail,plate,transposase	Leptospira_phage(40.0%)	55	NA	NA
WP_004498521.1|1498947_1500072_-|plate	baseplate J-like protein	plate	NA	NA	NA	NA
WP_036075913.1|1500068_1500428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498566.1|1500588_1501275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499841.1|1501271_1502237_-	late control protein	NA	NA	NA	NA	NA
WP_004502047.1|1502227_1502629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061218312.1|1502625_1503078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004502049.1|1503077_1505375_-|tail	phage tail tape measure protein	tail	H7BVM4	unidentified_phage	28.2	7.7e-30
WP_004498602.1|1505381_1505606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499927.1|1505656_1505845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498589.1|1505862_1506276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498562.1|1506303_1506738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498601.1|1506762_1508256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061230726.1|1508258_1508675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004502056.1|1508676_1509246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498544.1|1509242_1509680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061230725.1|1509676_1510066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498599.1|1510062_1510482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061230724.1|1510498_1511581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061230723.1|1511593_1511968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061230722.1|1511981_1513256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498529.1|1513331_1513565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061230721.1|1513645_1514071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004502161.1|1514093_1514945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004498533.1|1515291_1515690_-	helix-turn-helix transcriptional regulator	NA	Q0SPH9	Clostridium_phage	37.3	1.2e-07
WP_004498560.1|1515809_1516079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004502160.1|1516071_1516482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501947.1|1516478_1516865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501951.1|1516861_1517182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498518.1|1517342_1517546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498514.1|1517625_1517886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498537.1|1517882_1518128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498545.1|1518129_1518381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498581.1|1518472_1518718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036085959.1|1518686_1519670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499840.1|1519666_1521469_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_142499839.1|1521465_1522476_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004498572.1|1522674_1523277_+	Gam-like protein	NA	NA	NA	NA	NA
WP_004498552.1|1523350_1523941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498592.1|1523927_1525601_+|terminase	phage terminase large subunit GpA-like protein	terminase	NA	NA	NA	NA
WP_142511162.1|1525600_1527937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501743.1|1527933_1528530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498517.1|1528747_1528963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501742.1|1529004_1529262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004498555.1|1529341_1529578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061230716.1|1529636_1530128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061230715.1|1530124_1530805_+	M23 family metallopeptidase	NA	Q6NDZ4	Leptospira_phage	44.4	1.5e-50
WP_061230714.1|1530817_1531237_+	hypothetical protein	NA	Q6NDZ2	Leptospira_phage	41.7	1.4e-25
WP_004503652.1|1531246_1531687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004500951.1|1532051_1532759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002619699.1|1533237_1533582_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004500948.1|1534427_1535711_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	33.2	3.9e-31
WP_142499837.1|1535896_1536556_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004498547.1|1539058_1539253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039931017.1|1540699_1541209_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004501542.1|1541195_1541702_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP040845	Leptospira weilii strain CUD13 plasmid pD13, complete sequence	95487	54688	79740	95487	transposase	Leptospira_phage(45.45%)	37	NA	NA
WP_004499342.1|54688_55639_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VSW1	Leptospira_phage	66.8	2.7e-98
WP_004497746.1|57046_57760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036075336.1|57992_58331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004497718.1|58323_58527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004499709.1|59635_59860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004499724.1|59965_60628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000384931.1|60712_60937_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_004502900.1|60926_61289_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_002634517.1|61423_61636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004501641.1|61643_62480_+	type I restriction endonuclease subunit R	NA	H7BWA0	unidentified_phage	43.5	7.1e-58
WP_004499720.1|62580_62994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016758349.1|63048_63480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085988630.1|63591_64361_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004497511.1|64578_65019_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080634873.1|65074_65578_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004500217.1|65700_66102_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCT8	Stx2-converting_phage	40.0	2.0e-05
WP_026054191.1|66103_66391_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	35.8	4.2e-10
WP_036075665.1|66535_66913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004497509.1|67657_67873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016758353.1|67916_68258_-	endoribonuclease MazF	NA	A9D9Y1	Lactobacillus_prophage	36.1	5.2e-07
WP_004499620.1|68251_68488_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036075668.1|68827_69217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004495132.1|69257_70040_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	80.0	2.9e-114
WP_002074414.1|70066_70330_-|transposase	transposase	transposase	S5WIS5	Leptospira_phage	85.4	8.5e-10
WP_085988574.1|70388_70523_+	helix-turn-helix transcriptional regulator	NA	S5WIW9	Leptospira_phage	68.8	4.5e-07
WP_004497519.1|70718_70949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004497508.1|72071_72275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100224550.1|72263_72587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004499330.1|72650_73289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004499329.1|73474_73840_-	helix-turn-helix transcriptional regulator	NA	S5WID3	Leptospira_phage	49.6	3.4e-25
WP_076621928.1|73808_74075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016761240.1|76817_77234_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_020782480.1|77211_77457_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_036075323.1|77663_78056_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1X9I6C0	Streptococcus_phage	35.1	5.2e-11
WP_004497764.1|78052_78292_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036059107.1|78666_78969_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	41.2	2.9e-09
WP_085986074.1|78970_79740_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
