The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035466	Klebsiella aerogenes strain LU2 chromosome, complete genome	5062651	15850	56845	5062651	lysis,tail,head,capsid,tRNA,plate,terminase,integrase,portal	Salmonella_phage(89.19%)	51	27170:27216	56964:57010
WP_008806092.1|15850_16618_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015703198.1|16649_17198_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_015370257.1|17216_17465_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_020078159.1|17735_19100_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015703199.1|19266_20058_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026612238.1|20075_21362_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015370253.1|21465_22056_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015370252.1|22179_23058_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_047064167.1|23144_24806_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_045413345.1|24953_25292_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015370249.1|25354_25645_-	RnfH family protein	NA	NA	NA	NA	NA
WP_026612237.1|25634_26111_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_015370247.1|26225_26708_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
27170:27216	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_072056497.1|27395_27614_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	5.8e-28
WP_142426284.1|27679_28780_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.3	8.7e-181
WP_047049588.1|28776_29262_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	3.5e-73
WP_142426285.1|31898_32504_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.0	5.8e-110
WP_142426286.1|32496_33405_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.1	7.5e-146
WP_087877061.1|33391_33751_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.6	1.2e-54
WP_142962214.1|33747_34326_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	95.3	9.1e-105
WP_110916486.1|34426_35122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142426287.1|35123_35573_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.2	2.1e-64
WP_142426288.1|35565_35997_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.4e-72
WP_142426289.1|35959_36163_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	95.5	1.7e-29
WP_047049566.1|36092_36518_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	96.5	1.0e-65
WP_142426290.1|36517_36895_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	90.4	5.1e-56
WP_063447397.1|36899_37409_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	6.4e-94
WP_000171565.1|37389_37605_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|37608_37812_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_063447398.1|37811_38276_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	95.5	1.0e-82
WP_142426291.1|38369_39020_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.1	3.0e-112
WP_142426292.1|39023_40085_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	97.7	2.4e-191
WP_142426293.1|40101_40935_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	96.4	2.3e-125
WP_142426294.1|41078_42845_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_142426295.1|42844_43873_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	95.6	2.0e-179
WP_142426296.1|43903_45751_-	NTPase	NA	X2KLG0	Campylobacter_phage	29.3	1.6e-14
WP_142962215.1|45768_47349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142426297.1|47436_47985_-	3'-5' exoribonuclease	NA	A0A2I7R2S7	Vibrio_phage	41.8	1.5e-32
WP_001217561.1|48155_48389_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154444.1|48400_48589_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_142426298.1|48750_51159_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.9	0.0e+00
WP_142426299.1|51149_52010_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	82.2	2.5e-130
WP_142426300.1|52006_52234_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	7.3e-34
WP_142426301.1|52233_52467_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	79.2	1.2e-23
WP_013098807.1|52534_52876_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_032413916.1|52839_53040_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	1.9e-30
WP_047049525.1|53047_53557_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	95.9	1.9e-85
WP_000102104.1|53592_53832_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_142426302.1|53951_54584_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	95.2	3.8e-112
WP_142426303.1|54585_55602_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	94.4	2.5e-190
WP_142426304.1|55609_56845_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	1.8e-150
56964:57010	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP035466	Klebsiella aerogenes strain LU2 chromosome, complete genome	5062651	3043509	3069859	5062651	tail,terminase,integrase,holin,protease	Klebsiella_phage(50.0%)	38	3040138:3040153	3073276:3073291
3040138:3040153	attL	TCAATTTTCCCTTCCG	NA	NA	NA	NA
WP_015704916.1|3043509_3044169_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	6.4e-46
WP_047054242.1|3044434_3046063_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142961985.1|3046474_3047824_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_142961986.1|3047820_3048354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142962227.1|3048359_3049391_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	48.0	1.1e-79
WP_071609812.1|3049374_3049608_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_142962228.1|3049677_3051156_-	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	59.3	1.9e-58
WP_142961987.1|3052319_3052514_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032707013.1|3053212_3053593_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	54.7	5.5e-18
WP_032707014.1|3053700_3053916_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.1	6.5e-16
WP_045389612.1|3053918_3054473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142961988.1|3054517_3055537_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	41.4	2.7e-35
WP_045389630.1|3055529_3055994_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	66.2	5.5e-60
WP_087867532.1|3056001_3056307_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032707016.1|3056303_3056657_+	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	57.3	3.0e-26
WP_032707017.1|3056657_3056843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142961989.1|3056901_3057084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032707019.1|3057337_3057781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032707020.1|3058116_3058350_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.7	9.8e-26
WP_080687411.1|3058361_3058652_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	3.0e-16
WP_050595504.1|3058692_3059085_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	44.3	3.7e-17
WP_032707021.1|3059081_3059285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032707022.1|3059284_3060316_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	9.9e-94
WP_032706183.1|3060329_3060932_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	71.6	2.1e-80
WP_032705626.1|3062009_3062321_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.5	1.1e-43
WP_032705627.1|3062317_3062860_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	71.3	5.1e-73
WP_032705628.1|3062856_3063204_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	75.7	6.4e-37
WP_032705629.1|3063200_3063464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072201313.1|3063453_3063612_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.5	5.3e-15
WP_086538038.1|3063948_3064131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032707023.1|3064490_3064778_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	43.8	1.3e-11
WP_032707024.1|3064777_3065140_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.0e-63
WP_032707025.1|3065136_3065451_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	59.6	1.6e-07
WP_072383085.1|3066069_3066504_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	90.3	5.5e-70
WP_032722455.1|3067446_3067626_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	89.8	1.2e-20
WP_015367366.1|3068038_3068749_+|tail	phage tail assembly protein	tail	Q6UAW4	Klebsiella_phage	92.8	3.7e-140
WP_142961990.1|3068789_3069212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041165565.1|3069259_3069859_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	78.0	1.2e-78
3073276:3073291	attR	CGGAAGGGAAAATTGA	NA	NA	NA	NA
>prophage 3
NZ_CP035466	Klebsiella aerogenes strain LU2 chromosome, complete genome	5062651	4543672	4562633	5062651	holin,terminase,integrase	Klebsiella_phage(25.0%)	27	4543958:4543972	4566027:4566041
WP_142962171.1|4543672_4544665_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	33.6	2.2e-26
4543958:4543972	attL	CGCAGCATCCGGCGC	NA	NA	NA	NA
WP_126003066.1|4545130_4545313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047052335.1|4545350_4545587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047041390.1|4545796_4546081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073981861.1|4546706_4546862_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.6	1.0e-15
WP_142962172.1|4546851_4547127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142962173.1|4547123_4547471_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	73.9	4.1e-36
WP_142962174.1|4547467_4548010_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	71.9	7.8e-74
WP_131645981.1|4548006_4548306_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	88.9	6.7e-43
WP_142962175.1|4548906_4549260_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_142962176.1|4549870_4550368_-	antiterminator	NA	G8C7V7	Escherichia_phage	90.9	8.1e-86
WP_032737391.1|4550364_4550505_-	YlcG family protein	NA	NA	NA	NA	NA
WP_142962177.1|4550501_4551146_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	1.4e-34
WP_142962241.1|4551458_4551647_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	48.2	1.7e-07
WP_064783981.1|4552000_4552294_-	winged helix-turn-helix transcriptional regulator	NA	M1FPD5	Enterobacteria_phage	60.2	2.6e-23
WP_142962178.1|4552290_4552683_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	75.6	4.1e-32
WP_142962179.1|4552699_4552933_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZDD7	Stx2-converting_phage	63.6	5.2e-19
WP_032709994.1|4552974_4553727_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	63.1	4.5e-72
WP_015705909.1|4554288_4554495_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
WP_142962180.1|4554565_4554850_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	83.0	2.7e-41
WP_142962181.1|4554868_4555714_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.8	3.1e-69
WP_142962182.1|4556863_4557085_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	46.8	3.9e-08
WP_142962183.1|4557087_4557429_+	hypothetical protein	NA	I3PV00	Vibrio_phage	51.0	3.7e-21
WP_045346713.1|4557535_4557727_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	93.7	5.4e-30
WP_061329534.1|4557707_4558886_-|integrase	site-specific integrase	integrase	K7P703	Enterobacteria_phage	93.1	5.4e-221
WP_142962184.1|4559067_4560492_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_042895686.1|4560530_4562633_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	6.8e-65
4566027:4566041	attR	GCGCCGGATGCTGCG	NA	NA	NA	NA
>prophage 4
NZ_CP035466	Klebsiella aerogenes strain LU2 chromosome, complete genome	5062651	5036307	5044919	5062651	integrase	Escherichia_phage(33.33%)	10	5031772:5031785	5049253:5049266
5031772:5031785	attL	CAGCGCGCCTTCGC	NA	NA	NA	NA
WP_142962209.1|5036307_5037708_-	hypothetical protein	NA	A0A0F7L8S4	uncultured_marine_virus	26.4	5.4e-18
WP_142962210.1|5039901_5040156_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.1	1.8e-09
WP_142962244.1|5040148_5040343_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	83.1	2.5e-22
WP_142962211.1|5040891_5041980_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	57.1	2.6e-108
WP_032708420.1|5042014_5042368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142962245.1|5042375_5042846_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.0	5.6e-28
WP_142962212.1|5042842_5043151_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	6.5e-25
WP_071826829.1|5043158_5043398_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	4.2e-24
WP_032712288.1|5043436_5043712_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	1.2e-30
WP_047058650.1|5043689_5044919_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.0e-238
5049253:5049266	attR	GCGAAGGCGCGCTG	NA	NA	NA	NA
