The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030035	Bacteriovorax stolpii strain AC01 chromosome, complete genome	3880871	2946711	2974894	3880871	transposase,integrase	Bacillus_phage(50.0%)	32	2966546:2966605	2974895:2974978
WP_142409963.1|2946711_2947743_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_142409964.1|2948080_2948401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409965.1|2948405_2948693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409966.1|2948876_2950028_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	28.2	1.9e-08
WP_142409967.1|2950038_2950299_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142409968.1|2950311_2950623_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	33.3	9.5e-08
WP_142409969.1|2950624_2951029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409970.1|2951255_2951990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409971.1|2951986_2953516_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142409972.1|2953460_2953961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409973.1|2953957_2954734_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_142409974.1|2954733_2955216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409975.1|2955215_2955677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409976.1|2955642_2957154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409977.1|2957150_2957873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409978.1|2957869_2959786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409979.1|2959763_2960039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409980.1|2960038_2960344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409981.1|2960368_2962282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409982.1|2962312_2962513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409983.1|2962726_2963203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409984.1|2963675_2964653_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_142409985.1|2964655_2966545_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2966546:2966605	attL	AATTCCTCCATTTTTATAGTTAAAATGGAATGGAAATTCAGTAGCATGACCTAAAAAGAG	NA	NA	NA	NA
WP_142409986.1|2966875_2967625_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142409987.1|2967637_2969182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142409988.1|2969422_2969749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142409989.1|2969814_2970195_+	response regulator	NA	NA	NA	NA	NA
WP_142409990.1|2970211_2971015_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142410315.1|2971126_2971309_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142409991.1|2971517_2971877_+	response regulator	NA	NA	NA	NA	NA
WP_142409984.1|2972024_2973002_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_142409985.1|2973004_2974894_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2974895:2974978	attR	AATTCCTCCATTTTTATAGTTAAAATGGAATGGAAATTCAGTAGCATGACCTAAAAAGAGGAAAGTTTAATGTTAAACACTACA	NA	NA	NA	NA
