The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041123	Serratia marcescens strain WVU-002 chromosome, complete genome	5307415	1130125	1208278	5307415	tail,integrase,tRNA,portal,lysis,holin,head,capsid,transposase,protease,terminase	Salmonella_phage(39.58%)	93	1147151:1147166	1200837:1200852
WP_050438932.1|1130125_1130767_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004940192.1|1130734_1131421_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.5	4.4e-05
WP_060440543.1|1131417_1133850_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043146773.1|1133919_1134987_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_073529319.1|1134983_1135508_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_060440541.1|1135657_1136380_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004940183.1|1136390_1136885_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_038875101.1|1137194_1138580_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	34.7	2.9e-40
WP_049278727.1|1138641_1138854_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004940177.1|1138864_1139731_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	9.0e-32
WP_077267529.1|1139963_1140146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958154.1|1140660_1141782_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	75.2	8.1e-166
WP_141958157.1|1142015_1142207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958159.1|1142203_1142413_-	hypothetical protein	NA	E5AGD4	Erwinia_phage	50.0	3.6e-11
WP_141958161.1|1142405_1142627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958163.1|1142697_1142952_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.3	8.5e-23
WP_060429108.1|1142961_1143222_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	56.6	2.2e-18
WP_141958165.1|1143279_1143897_-	hypothetical protein	NA	R9W0X9	Serratia_phage	46.8	1.5e-36
WP_141958168.1|1144066_1144288_-	hypothetical protein	NA	K4F9X1	Cronobacter_phage	52.2	3.8e-11
WP_141958170.1|1144289_1144715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958172.1|1144704_1144905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958174.1|1144901_1145117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958176.1|1145109_1145370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958178.1|1145362_1146259_-	phosphoadenosine phosphosulfate reductase family protein	NA	S4TN48	Salmonella_phage	79.0	2.5e-141
WP_141960596.1|1146245_1146764_-	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	73.5	2.0e-63
WP_141960598.1|1146778_1147444_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	50.7	4.5e-31
1147151:1147166	attL	TTCATATTTGCCCTGA	NA	NA	NA	NA
WP_072274585.1|1147542_1147722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958180.1|1147730_1148063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958182.1|1148090_1148546_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	66.7	1.1e-52
WP_141958185.1|1148546_1149173_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	66.0	1.5e-68
WP_141958187.1|1149461_1149593_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	60.5	1.2e-07
WP_141958189.1|1149749_1149989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958191.1|1150108_1150306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883557.1|1150323_1150572_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	36.7	1.6e-05
WP_141958193.1|1151195_1151930_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNG6	Salmonella_phage	65.8	4.9e-87
WP_060430772.1|1152047_1152275_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	76.0	4.0e-24
WP_004940137.1|1152384_1152663_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	56.7	9.6e-20
WP_141958195.1|1152848_1153748_+	DNA replication protein	NA	E7C9R4	Salmonella_phage	74.9	5.6e-117
WP_141958197.1|1153734_1155147_+	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	61.3	8.9e-162
WP_141958199.1|1155170_1155410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958201.1|1155413_1155653_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	60.6	2.8e-20
WP_141958203.1|1155655_1156108_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	51.7	8.0e-40
WP_141958206.1|1156104_1156275_+	NinE family protein	NA	NA	NA	NA	NA
WP_141958208.1|1156271_1156463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958210.1|1156822_1156951_+	protein ninF	NA	NA	NA	NA	NA
WP_141958212.1|1156943_1157525_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	43.5	1.3e-34
WP_141958214.1|1157872_1158364_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	79.8	9.5e-71
WP_042784831.1|1158791_1159118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004940112.1|1159114_1159447_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	74.3	1.0e-44
WP_141958216.1|1159430_1159865_+	glycoside hydrolase family protein	NA	Q5G8R3	Enterobacteria_phage	71.0	6.7e-52
WP_141958218.1|1159861_1160329_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	69.7	1.2e-54
WP_141958220.1|1160340_1160589_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	53.8	1.2e-13
WP_141958222.1|1160662_1160899_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	56.8	7.9e-15
WP_141958224.1|1161548_1161881_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_141958226.1|1161883_1162324_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	89.7	9.8e-75
WP_141958228.1|1162320_1163733_+|terminase	PBSX family phage terminase large subunit	terminase	Q9AZ00	Salmonella_phage	93.4	1.2e-264
WP_141958230.1|1163735_1165862_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	89.1	0.0e+00
WP_141958232.1|1165875_1166760_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	74.1	7.2e-101
WP_141958234.1|1166771_1168046_+|head	head protein	head	Q716H0	Shigella_phage	92.2	1.8e-222
WP_141958236.1|1168085_1168271_+	hypothetical protein	NA	Q716G9	Shigella_phage	78.7	3.4e-21
WP_004940081.1|1168245_1168728_+|head	head DNA stabilization protein	head	Q716G8	Shigella_phage	83.6	7.4e-76
WP_141958238.1|1168735_1170163_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	70.3	3.5e-206
WP_141958240.1|1170165_1170660_+	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	46.6	1.2e-33
WP_141958242.1|1170656_1171568_+|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	55.8	2.5e-32
WP_141958244.1|1171567_1172026_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	83.7	2.0e-70
WP_141958246.1|1172036_1172735_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	49.2	4.9e-36
WP_141958249.1|1172734_1174189_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	72.5	7.5e-172
WP_141958251.1|1174188_1175976_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	51.5	2.0e-126
WP_141958253.1|1176166_1176643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958255.1|1176645_1177047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958257.1|1177046_1177286_-	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	74.4	2.9e-25
WP_141958260.1|1180400_1181606_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.0	2.8e-132
WP_141958262.1|1182009_1184226_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077038822.1|1184240_1184699_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_038880661.1|1184710_1186015_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_077038925.1|1186431_1187553_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_141958265.1|1187572_1190668_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.2	5.3e-50
WP_141958267.1|1190679_1192107_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_126171419.1|1192206_1193175_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_141958270.1|1193343_1194996_+	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	27.5	2.7e-08
WP_141958272.1|1195180_1195765_+	LysE family transporter	NA	NA	NA	NA	NA
WP_141958274.1|1196873_1198067_+	gluconolaconase	NA	NA	NA	NA	NA
WP_141958276.1|1198204_1198732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958278.1|1198667_1199672_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_141958280.1|1200171_1200720_+	fimbrial protein	NA	NA	NA	NA	NA
WP_141960600.1|1200803_1201349_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
1200837:1200852	attR	TTCATATTTGCCCTGA	NA	NA	NA	NA
WP_141958282.1|1201413_1204053_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_126171449.1|1204152_1204905_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_126171429.1|1204968_1205628_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_126171430.1|1205638_1206142_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171431.1|1206155_1206656_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171432.1|1206666_1207239_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171433.1|1207231_1208278_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041123	Serratia marcescens strain WVU-002 chromosome, complete genome	5307415	2092012	2135557	5307415	tail,plate,integrase,holin,head,terminase	Pectobacterium_phage(64.1%)	59	2091911:2091934	2140421:2140444
2091911:2091934	attL	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
WP_141958829.1|2092012_2093095_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.6	1.1e-98
WP_072022390.1|2093069_2093342_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.2	3.4e-09
WP_060444327.1|2093417_2093921_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.9	1.5e-34
WP_141958831.1|2093917_2096050_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	5.2e-97
WP_141958833.1|2096064_2096385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958835.1|2096706_2096940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958836.1|2097076_2097388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116286447.1|2097400_2097574_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_082245749.1|2097596_2097794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116286446.1|2098057_2098501_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.3	1.3e-05
WP_116286445.1|2098568_2098805_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.9	1.6e-15
WP_141958838.1|2098824_2099289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958840.1|2099303_2099531_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_141958842.1|2099570_2100569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082245762.1|2100584_2100968_+	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	58.7	2.3e-40
WP_141958844.1|2100983_2101409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958846.1|2101446_2102274_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	43.1	2.9e-56
WP_141958848.1|2102270_2102678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958850.1|2102670_2102973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958852.1|2103134_2104241_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.5	5.4e-21
WP_141958854.1|2104247_2106506_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_060444338.1|2106999_2107596_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	53.5	5.2e-55
WP_116286438.1|2107592_2107880_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	64.5	1.5e-28
WP_141958856.1|2107876_2108527_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	29.3	2.4e-21
WP_141958858.1|2108783_2109107_+|holin	phage holin, lambda family	holin	Q8LTF0	Salmonella_phage	46.5	3.4e-16
WP_141958860.1|2109099_2109489_+	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	69.8	1.4e-48
WP_141958862.1|2109485_2109869_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_141958864.1|2109807_2110026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033638085.1|2110352_2110571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958866.1|2110955_2111465_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	48.4	1.3e-35
WP_141958868.1|2111461_2112076_+	protein Mom	NA	C9E2P8	Enterococcus_phage	61.6	7.5e-65
WP_033638087.1|2112078_2112336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958870.1|2112343_2113339_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.8	1.8e-60
WP_141958872.1|2113338_2114979_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	79.6	5.3e-267
WP_141958874.1|2114981_2116382_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	67.0	4.2e-180
WP_141960647.1|2116431_2117184_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	68.7	1.8e-92
WP_141958876.1|2117192_2118374_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	64.8	8.9e-107
WP_141958878.1|2118373_2118901_+	hypothetical protein	NA	H9C195	Pectobacterium_phage	58.4	8.7e-46
WP_060444351.1|2118954_2119893_+	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	72.4	7.8e-130
WP_050596002.1|2119893_2120235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958880.1|2120294_2120717_+	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	61.0	2.4e-38
WP_033638095.1|2120713_2121181_+	hypothetical protein	NA	H9C199	Pectobacterium_phage	83.2	5.7e-65
WP_033638096.1|2121183_2121603_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	80.7	8.2e-63
WP_141958882.1|2121602_2122139_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	50.8	9.5e-40
WP_141958884.1|2122154_2123405_+	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	62.3	1.5e-144
WP_033638099.1|2123411_2123816_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	79.1	3.5e-55
WP_141958886.1|2123815_2124214_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	60.5	1.4e-35
WP_072022396.1|2124474_2124681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958888.1|2124735_2125227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958890.1|2125291_2126962_+	glycoside hydrolase family protein	NA	H9C1A7	Pectobacterium_phage	43.0	1.5e-107
WP_141958892.1|2126961_2127660_+	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	40.6	2.7e-34
WP_141960649.1|2127664_2127946_+	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	59.6	8.5e-24
WP_141958894.1|2127938_2128838_+	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	48.5	2.7e-79
WP_141958896.1|2128845_2129448_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	51.4	1.9e-57
WP_033638104.1|2129462_2129813_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	70.4	1.9e-41
WP_141958898.1|2129812_2131018_+|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	62.7	1.8e-142
WP_141958900.1|2131010_2131865_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	53.5	4.1e-77
WP_141958902.1|2131890_2133522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958904.1|2133574_2135557_+|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	37.0	8.0e-92
2140421:2140444	attR	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP041123	Serratia marcescens strain WVU-002 chromosome, complete genome	5307415	2300280	2341250	5307415	protease,coat	Moraxella_phage(25.0%)	38	NA	NA
WP_141959028.1|2300280_2301699_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|2301845_2302055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|2302831_2303224_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060419277.1|2303228_2303828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100396313.1|2303883_2304123_-	YebV family protein	NA	NA	NA	NA	NA
WP_060440091.1|2304258_2305191_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_141960660.1|2305210_2307553_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_049201714.1|2307704_2308472_-	molecular chaperone	NA	NA	NA	NA	NA
WP_141959029.1|2308493_2309036_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_038877669.1|2309029_2309533_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060440090.1|2309535_2310072_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_060419268.1|2310346_2310883_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_141959031.1|2311155_2312592_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_087763559.1|2312694_2315325_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049198592.1|2315293_2316541_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_126180031.1|2316796_2317294_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|2317390_2318101_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2318120_2320169_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_038877656.1|2320236_2321082_-	DMT family transporter	NA	NA	NA	NA	NA
WP_141959033.1|2321078_2322386_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_060440085.1|2322378_2323176_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_087763515.1|2323163_2323949_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	8.8e-10
WP_060440083.1|2323945_2324986_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_089185885.1|2324988_2326080_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638291.1|2326450_2327329_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_102984783.1|2327379_2328774_-	MFS transporter	NA	NA	NA	NA	NA
WP_049274096.1|2329004_2329796_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_141959035.1|2329842_2330646_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_141959037.1|2330648_2331512_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_141959039.1|2331513_2332650_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	7.4e-26
WP_141959041.1|2332646_2333657_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102984780.1|2333831_2334551_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_141959043.1|2334706_2335810_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_141959045.1|2335819_2336629_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_089185892.1|2336693_2338091_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_141959047.1|2338266_2338815_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_049198577.1|2339239_2339905_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_141959049.1|2339969_2341250_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP041123	Serratia marcescens strain WVU-002 chromosome, complete genome	5307415	4071763	4132346	5307415	tail,tRNA	Enterobacteria_phage(13.04%)	63	NA	NA
WP_015378796.1|4071763_4072270_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.2	4.5e-07
WP_070914449.1|4072387_4073440_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_141959967.1|4073487_4074144_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_070914445.1|4074147_4075515_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_087762398.1|4075533_4076427_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_033654299.1|4076594_4077443_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141960711.1|4077694_4079131_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_025303942.1|4079222_4079483_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
WP_019452319.1|4079528_4079909_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_141959969.1|4079908_4080640_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004929165.1|4080711_4081443_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004929162.1|4081449_4082358_-	GTPase Era	NA	NA	NA	NA	NA
WP_004929158.1|4082354_4083035_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.3	9.6e-21
WP_033644122.1|4083270_4084248_-	signal peptidase I	NA	NA	NA	NA	NA
WP_033648940.1|4084280_4086080_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	3.2e-23
WP_141959971.1|4086598_4087435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141959972.1|4087431_4087908_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_141959973.1|4087907_4088864_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_049200771.1|4088863_4089517_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004929136.1|4089547_4090123_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_043128468.1|4090301_4091939_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_141959975.1|4091977_4092757_-	methyltransferase	NA	NA	NA	NA	NA
WP_016929798.1|4092856_4094179_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	3.6e-40
WP_141959977.1|4094231_4094987_-	ankyrin repeat domain-containing protein	NA	Q9JMM8	Wolbachia_phage	39.2	8.2e-05
WP_141959979.1|4094979_4095942_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_004929114.1|4096125_4096509_-	autonomous glycyl radical cofactor GrcA	NA	C3V1I5	Escherichia_virus	70.2	6.1e-33
WP_033635636.1|4096855_4097539_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.9	2.5e-53
WP_025303955.1|4097594_4098179_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_019452304.1|4098304_4099183_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_089186358.1|4099269_4100931_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004929101.1|4101171_4101510_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_087762394.1|4101628_4101913_-	RnfH family protein	NA	NA	NA	NA	NA
WP_086016675.1|4101905_4102394_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004929094.1|4102501_4102984_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	4.1e-26
WP_141959981.1|4103531_4104668_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_046687688.1|4104677_4105022_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_041036393.1|4105060_4105714_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_085337239.1|4105849_4106785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141960713.1|4106840_4108454_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_141959983.1|4108573_4108984_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_141959985.1|4109102_4109555_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141959987.1|4109655_4110390_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	43.2	1.8e-52
WP_141959989.1|4110451_4110949_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141959991.1|4111034_4111961_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141959993.1|4111955_4112471_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_025303973.1|4112591_4112774_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_047730014.1|4112806_4113085_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016929825.1|4113086_4113317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016929826.1|4113508_4113922_+	DoxX family protein	NA	NA	NA	NA	NA
WP_141959995.1|4114000_4115947_-	hypothetical protein	NA	W6ATR4	Escherichia_phage	58.5	4.0e-43
WP_141959997.1|4116068_4118102_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	44.8	2.6e-29
WP_141959999.1|4118159_4123913_-	DUF1983 domain-containing protein	NA	M9P0D8	Enterobacteria_phage	55.8	6.4e-291
WP_060441078.1|4123931_4124552_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	53.2	1.4e-55
WP_141960001.1|4124548_4125259_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	56.6	1.7e-81
WP_141960004.1|4125261_4126014_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	57.0	5.9e-88
WP_141960006.1|4126022_4126364_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	42.0	6.1e-16
WP_141960008.1|4126438_4128883_-|tail	phage tail tape measure protein	tail	A0A1W6DXJ0	Citrobacter_phage	30.3	1.8e-85
WP_141960715.1|4128938_4129172_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	60.6	1.4e-16
WP_019455561.1|4129240_4129594_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	54.3	5.0e-29
WP_019455562.1|4129667_4130330_-|tail	tail protein	tail	I6PBN6	Cronobacter_phage	64.5	6.8e-72
WP_141960010.1|4130456_4130966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123892442.1|4131132_4131501_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	56.7	6.1e-30
WP_019455565.1|4131674_4132346_+	hypothetical protein	NA	U5P0T5	Shigella_phage	67.3	6.7e-83
>prophage 5
NZ_CP041123	Serratia marcescens strain WVU-002 chromosome, complete genome	5307415	4372434	4384917	5307415	tRNA,integrase	Morganella_phage(30.0%)	15	4366651:4366667	4383179:4383195
4366651:4366667	attL	TGGAGCGGGTGAAGGGA	NA	NA	NA	NA
WP_141960153.1|4372434_4373739_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	27.5	2.3e-26
WP_141960735.1|4373738_4374371_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	70.0	2.8e-54
WP_110147368.1|4374423_4374891_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	73.0	1.1e-60
WP_141960155.1|4375565_4377701_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	60.1	5.4e-203
WP_141960736.1|4377758_4378160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110147377.1|4378282_4378507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960157.1|4378503_4378698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960160.1|4378681_4379497_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	55.8	1.8e-18
WP_141960738.1|4379477_4379663_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_141960162.1|4379665_4380271_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.4	2.7e-51
WP_141960740.1|4380284_4380716_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	3.0e-28
WP_141960164.1|4380715_4380913_-	AlpA family phage regulatory protein	NA	G8DCP6	Silicibacter_phage	37.9	1.6e-05
WP_141960166.1|4381051_4381654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960168.1|4381799_4383014_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	1.6e-143
WP_033649459.1|4383399_4384917_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.2	7.7e-87
4383179:4383195	attR	TGGAGCGGGTGAAGGGA	NA	NA	NA	NA
