The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	54884	127116	4946083	transposase	Stx2-converting_phage(30.0%)	54	NA	NA
WP_169053142.1|54884_56113_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.7e-175
WP_000792543.1|56306_58355_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_001352368.1|59892_61101_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001126822.1|63423_63990_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991576.1|64247_64820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958152.1|64888_65125_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065793218.1|65390_65939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016244154.1|65957_66437_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	42.5	3.5e-09
WP_016244155.1|67336_67771_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_016243920.1|70236_71121_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_001283626.1|72360_72882_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|72878_73832_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188254.1|73918_76243_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|76287_77190_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125181.1|77186_78185_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|78181_79138_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|79138_79906_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|80463_80721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|81718_82870_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000623562.1|84856_85204_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
WP_000993926.1|85203_85854_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	3.4e-15
WP_000948757.1|86145_87510_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_001317576.1|87908_89126_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_000790444.1|89122_91132_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_000952905.1|91121_92369_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_073506891.1|92497_93025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147588.1|93042_93291_-	hypothetical protein	NA	Q2A0A1	Sodalis_phage	39.1	6.4e-07
WP_001366542.1|93359_93551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018808.1|94146_95166_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
WP_001317566.1|95423_95867_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000699820.1|95945_96218_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000470229.1|96240_97629_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001101067.1|97625_98456_+	transketolase	NA	NA	NA	NA	NA
WP_000609007.1|98448_99402_+	transketolase family protein	NA	NA	NA	NA	NA
WP_131501864.1|99664_99778_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_039005722.1|100628_101888_+	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	76.1	5.2e-20
WP_000884153.1|101949_102405_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000760915.1|102761_103100_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000859647.1|103604_104294_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000983423.1|104293_105850_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001293447.1|106015_106840_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000551919.1|106996_108340_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_088895425.1|108459_109688_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000803221.1|111170_112487_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_089581225.1|112657_112843_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001313273.1|112851_112959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313270.1|114830_116801_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977396.1|116819_117611_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001282144.1|118181_118571_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612556.1|118567_118915_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001593684.1|119010_120603_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000624717.1|120633_120984_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|120980_121406_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001360336.1|123618_127116_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
>prophage 2
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	1919151	2027863	4946083	holin,integrase,terminase,portal,head,capsid,protease,transposase,tail	Escherichia_phage(40.74%)	89	1919140:1919199	2023513:2024844
1919140:1919199	attL	GTGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTG	NA	NA	NA	NA
WP_088895425.1|1919151_1920380_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000973176.1|1923656_1924202_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|1924198_1924942_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166160.1|1924953_1926033_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986321.1|1926094_1927030_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|1927487_1928405_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1928506_1929457_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122452224.1|1929574_1931218_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532912.1|1931846_1932563_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060242.1|1932905_1934360_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378572.1|1934461_1935778_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480506.1|1936092_1937145_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001323489.1|1939362_1940073_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000784547.1|1940763_1942785_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088826.1|1942915_1944493_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194282.1|1944496_1945300_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982854.1|1945296_1946397_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_141841210.1|1946393_1955885_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000623056.1|1955972_1962080_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000140405.1|1962270_1963230_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001317926.1|1963486_1965199_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.3	1.0e-31
WP_000654453.1|1965185_1966988_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_001286292.1|1966980_1968261_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703035.1|1968288_1969593_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000480162.1|1969786_1971049_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_001300801.1|1971386_1972184_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_045171449.1|1972419_1973445_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	2.6e-102
WP_000096344.1|1973444_1973648_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_065203452.1|1973706_1976178_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_016235603.1|1976270_1976462_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1976458_1976647_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122998275.1|1977007_1977193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|1977196_1977415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042030300.1|1977486_1977786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233320.1|1978144_1978564_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1978643_1978898_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693845.1|1978894_1979320_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1979342_1980305_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788950.1|1980311_1981058_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000451007.1|1981079_1981850_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_021543289.1|1981865_1982291_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.2e-63
WP_000150294.1|1982465_1983131_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000813254.1|1983368_1983524_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000737634.1|1983667_1984060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|1984356_1984635_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024188444.1|1984636_1985692_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_000139992.1|1985692_1986058_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_001064896.1|1986054_1986744_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_000839572.1|1987556_1987772_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193289.1|1987776_1988127_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992100.1|1988190_1988724_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228685.1|1988940_1989126_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001100260.1|1989343_1989610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000351660.1|1989615_1990155_-	YfbU family protein	NA	NA	NA	NA	NA
WP_141841212.1|1990293_1990644_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	9.5e-65
WP_001312917.1|1990791_1991274_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140903.1|1991273_1993031_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478564.1|1993042_1993225_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_000466255.1|1993224_1994466_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|1994443_1995094_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257522.1|1995108_1996314_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_000601355.1|1996364_1996553_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|1996564_1996870_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|1996878_1997217_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|1997216_1997663_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|1997659_1998004_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|1998063_1998768_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|1998782_1999154_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978930.1|1999177_1999456_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_024257906.1|1999502_2002730_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|2002707_2003064_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152456.1|2003063_2003762_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_096941456.1|2003766_2004510_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	8.3e-151
WP_041498141.1|2004407_2005055_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	2.3e-112
WP_141841214.1|2005115_2008511_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	89.9	0.0e+00
WP_001233121.1|2008578_2009178_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_000526135.1|2009374_2009833_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_072648490.1|2009953_2013367_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_048236353.1|2013366_2013948_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	3.0e-100
WP_001240090.1|2016444_2017080_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_141841216.1|2017080_2018085_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2018193_2018607_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001340597.1|2018739_2019411_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826785.1|2019410_2020769_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.0e-05
WP_000218222.1|2020876_2021728_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_088895425.1|2022331_2023559_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000824345.1|2023655_2024714_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
WP_000365598.1|2025682_2026378_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
2023513:2024844	attR	CAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCACCAATAAAAAAGCCTGAGTTCGATGAGGGACGAACTCAGGCTAGTGTTATGTTTTACAGTAACACGCCGCGGCGCGTTGGCTGATTAGAACTGGTAGACGATACCAAATGCGAGTTGGTCGTCGGTGTTCAGTCCATGAGCGAGAACATAATCACTCTTATCAAGCAGGTTGATCTGATAAGCGGTATATACGTTCATGTTCTTATTGAAGTAATACCAGGTACCGATTTCAATGTAGTTCAGACGATCAGAATCTTTGTAACCTGCTACGTCCAGTGCTTTAGAATAGGAGTAACCGATGGATGGACGCAGACCGAAGTCGAACTGATATTGCAGAACAGCTTCGAAGTTTTGTGTTTTGTTCACAACATCACCGTCGTCGGAATTCATGTTGTGAGATTCACCGTACATCACAGCAGCATAGACGTTGTTGGGATCATATTTTGTTGACAGTGCCCAAACTTCTGCTTTTTCACCTTTACTATCACTAGACTGGAAATCAGTACGGTCAGAGTTTGCGTAAGCACCAGTAAATGAGAAACCGTCAATAGTGTAAGTTACAGATAAACCATGGCCATCGCCATTTGCTTTGTAGTTGCCTGTACCTTCATTTTTACCCTGATATTGCAGAGCAAAATTTAGACCTTCAACCATGCCAAAGAAATCTGTGTTACGATAGGTTGCAACACCGTTGGTACGGTTGGTCATGAACAGGTCAGTACCAGCCCATGAATCACCGCCCCACTCAACAAACATATCAGTAAATGCTTCTGCATCATACGCGACACCGACATTACGACCATAGTCGAATGAACCAAAATCTTTGTAACTCAAACCAGCATAAGCCAAACGAGTTTGGTCAGGGTTGTGTCTGTTTGATGCTTCCAGGTCTAGTTCAAACTGACCGTAACCAGTCAATTCAGGGTTGATCTGAGTTTCACCTTTCACGCCTACACGGGCATAAGAGGTATCTTGAGAATTATCGCCTTTTTCACCATTTTCACGGTCGGTCAGAATGCGCTCACCAACCATCTTGCCGTACAGATCCAGTTTATTGCCATCTTTATTATAAATTTCAGCCGCATTTGCTGCGCCAGCAACTAATAACGCCGGGACCAGCATTGCCAGAACTTTTCTTTTCATTATGTATTCCCTTGTGATTATAATCTTCATGAATATATCAATAAGTGCCGTTATCCAAAAAAAGCACATTTGGATACTATTCTATGAAGTTCATTTTATTTTAAAGATTACATGCAACAAATATATTTAA	NA	NA	NA	NA
WP_001157247.1|2026444_2027863_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
>prophage 3
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	2068948	2103765	4946083	holin,integrase,terminase,head,plate,portal,capsid,tail	Enterobacteria_phage(91.89%)	44	2067880:2067939	2103872:2103995
2067880:2067939	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|2068948_2069089_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488113.1|2069279_2069540_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001613305.1|2071376_2072486_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000005386.1|2072643_2073828_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000290462.1|2073827_2074340_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651582.1|2074395_2074770_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	74.0	3.1e-37
WP_000333503.1|2074778_2074934_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_001613299.1|2074920_2077728_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.3	0.0e+00
WP_001613297.1|2077740_2078229_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.8e-85
WP_001447286.1|2078417_2078963_+	transferase	NA	NA	NA	NA	NA
WP_000885638.1|2078926_2079544_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_086525118.1|2079543_2081733_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.7	2.7e-109
WP_001613291.1|2081735_2082266_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	5.3e-91
WP_001613289.1|2082258_2083155_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	4.6e-156
WP_001067548.1|2083158_2083488_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077627896.1|2083505_2084072_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	3.1e-97
WP_000356339.1|2084083_2084719_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001613287.1|2084711_2085179_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.3e-85
WP_000780567.1|2085316_2085724_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	1.0e-65
WP_086525117.1|2085720_2086113_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	3.8e-70
WP_000104350.1|2086109_2086433_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2086435_2086636_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063097.1|2086635_2087130_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	1.3e-88
WP_000632347.1|2087231_2088032_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001055119.1|2088077_2089130_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001262686.1|2089153_2089990_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
WP_141841218.1|2090144_2091896_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001539203.1|2091895_2092942_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_000654460.1|2093552_2094359_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001613284.1|2094590_2094902_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.1e-48
WP_001613283.1|2094906_2095866_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.2e-180
WP_086525115.1|2095942_2098783_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.0	0.0e+00
WP_086525114.1|2098779_2099169_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_000985152.1|2099492_2099696_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021671.1|2099783_2099897_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000514284.1|2099893_2100136_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158977.1|2100147_2100426_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	1.6e-35
WP_000716033.1|2100436_2100787_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	2.1e-48
WP_000014504.1|2100808_2101012_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2101083_2101221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001613279.1|2101310_2101715_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	9.4e-24
WP_000290343.1|2101730_2102381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865205.1|2102410_2102758_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_032206500.1|2102763_2103765_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	2.1e-104
2103872:2103995	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 4
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	2416365	2522497	4946083	integrase,lysis,portal,terminase,protease,transposase,tail	Enterobacteria_phage(34.48%)	114	2423942:2423957	2453248:2453263
WP_001254970.1|2416365_2417187_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2417286_2417370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2417462_2417798_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091847.1|2418195_2419449_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019561.1|2419555_2420449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039004209.1|2420583_2421804_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2421928_2422624_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|2422576_2423869_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2423942:2423957	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148698.1|2424026_2424641_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
WP_000526519.1|2424683_2425538_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2425539_2426157_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001695753.1|2426167_2428591_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041658.1|2428651_2431078_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001317855.1|2431276_2431582_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2431689_2432400_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2432402_2432963_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705195.1|2432997_2433339_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2433473_2433800_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2434005_2435220_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836040.1|2435231_2436251_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001389342.1|2436308_2436437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877006.1|2436438_2437719_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
WP_001695752.1|2437753_2438005_-	excisionase family protein	NA	S4TND0	Salmonella_phage	48.7	1.9e-14
WP_001695751.1|2438077_2440549_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2440642_2440834_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_086525109.1|2440830_2441019_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2441434_2441722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241299.1|2441690_2442068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2442067_2442220_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000381212.1|2442388_2442796_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2442876_2443104_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2443087_2443609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054495.1|2443589_2444555_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151252.1|2444595_2444997_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
WP_000547812.1|2445530_2446556_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	28.2	3.2e-28
WP_122985418.1|2447081_2447189_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887486.1|2447233_2447446_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_000980999.1|2447662_2447914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032297225.1|2447980_2448259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696469.1|2448260_2449310_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_001047132.1|2449323_2450076_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_000066485.1|2450751_2450967_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|2451720_2451936_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2451940_2452252_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2452248_2452782_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2452778_2453276_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2453248:2453263	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2453639_2453852_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2453862_2454051_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2454053_2454119_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2454198_2454354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|2454525_2454699_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|2454850_2455261_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|2455461_2455668_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_001696471.1|2456221_2456716_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	8.4e-83
WP_001696472.1|2456715_2458818_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|2458814_2459027_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023908451.1|2458954_2460535_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_141841233.1|2460479_2462507_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097046.1|2462593_2462917_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_025492009.1|2462909_2463185_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	7.2e-44
WP_042003597.1|2463196_2463775_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_001079398.1|2463771_2464173_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2464184_2464928_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|2464988_2465375_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2465383_2465713_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_025492007.1|2465684_2468750_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_000447253.1|2468749_2469079_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2469088_2469787_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_141841235.1|2469792_2470536_+	C40 family peptidase	NA	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_000090949.1|2470472_2471075_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_141841237.1|2471135_2474549_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_044720454.1|2474618_2475218_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_041498220.1|2475282_2478243_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.9	1.1e-55
WP_041498222.1|2478242_2478845_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	1.4e-103
WP_000087133.1|2478915_2479506_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|2479824_2480058_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|2480126_2480240_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2480843_2482127_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527790.1|2482215_2483676_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|2483711_2483915_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215552.1|2484091_2484778_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_001317837.1|2484866_2485613_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001317836.1|2485749_2487795_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000671731.1|2488159_2488552_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592798.1|2488806_2489697_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	36.4	4.0e-19
WP_000901367.1|2489915_2490011_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054178.1|2490137_2491325_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087219.1|2491519_2492419_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803533.1|2492449_2492668_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2492699_2493083_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2493103_2493538_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|2493749_2494415_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|2494439_2495630_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000366493.1|2495974_2496850_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001317833.1|2496950_2498339_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2498402_2499329_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191042.1|2499328_2499688_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558450.1|2499826_2501245_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_000854630.1|2501472_2502924_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001317832.1|2503120_2504035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286572.1|2504038_2504797_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2504853_2505144_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774172.1|2505167_2506043_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172485.1|2506069_2507092_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222725.1|2507103_2508096_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911179.1|2508095_2509124_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194895.1|2509117_2510653_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	6.8e-22
WP_000154356.1|2510901_2511855_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113152.1|2511933_2513526_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001296726.1|2515757_2516024_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125469.1|2516023_2517340_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296758.1|2518315_2518879_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001195165.1|2519240_2519951_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001352368.1|2521288_2522497_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 5
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	3053246	3129763	4946083	integrase,protease,terminase,tRNA,transposase	Bacillus_phage(16.67%)	60	3063448:3063463	3133160:3133175
WP_000117881.1|3053246_3054647_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977917.1|3055248_3056337_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462684.1|3056521_3057712_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109449.1|3057762_3058410_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3058436_3058985_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000926012.1|3059165_3061013_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000526135.1|3061350_3061809_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000572669.1|3061984_3066445_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3063448:3063463	attL	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
WP_001295931.1|3066444_3067149_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288856.1|3067129_3068452_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001304765.1|3068448_3069234_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899580.1|3069369_3070149_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436910.1|3070125_3071019_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011622.1|3071172_3071919_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3071915_3072098_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056558.1|3072149_3073382_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570550.1|3073418_3074405_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3074401_3076150_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_141841257.1|3076186_3078451_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3078657_3078942_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3079101_3080775_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3080885_3081569_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001317748.1|3081741_3082506_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445215.1|3082675_3083959_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3084029_3085118_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3085316_3086009_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194829.1|3086138_3087899_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3088304_3089162_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3089216_3091499_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3091690_3092431_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000918506.1|3092640_3094071_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3094280_3095429_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3095743_3096370_+	hydrolase	NA	NA	NA	NA	NA
WP_000534633.1|3096404_3097268_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3097269_3097887_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850334.1|3097897_3100342_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000886683.1|3100580_3101873_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3101963_3103307_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3103317_3103929_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077032.1|3104087_3108155_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3108289_3108784_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_141841259.1|3109328_3110294_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.2e-61
WP_001043586.1|3110416_3112183_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202181.1|3112183_3113905_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	5.8e-22
WP_001241678.1|3113946_3114651_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3114935_3115154_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3116197_3118474_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3118504_3118825_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_024187550.1|3119611_3119896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835283.1|3120159_3120702_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	46.9	1.1e-35
WP_001017076.1|3120909_3122823_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.1	3.6e-214
WP_000973809.1|3122915_3123089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126642.1|3123454_3123877_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000208459.1|3123873_3124119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141841260.1|3124405_3126223_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	7.5e-129
WP_001261502.1|3126219_3126519_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113141.1|3126525_3126846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396399.1|3126838_3127885_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001206975.1|3127895_3128105_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_000092883.1|3128524_3129763_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.0e-126
3133160:3133175	attR	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	3248979	3304629	4946083	integrase,terminase,head,portal,lysis,capsid,protease,transposase,tail	Enterobacteria_phage(54.69%)	77	3255646:3255662	3313913:3313929
WP_001317842.1|3248979_3249561_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
WP_001695591.1|3249560_3252962_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	38.2	8.2e-12
WP_001695589.1|3253026_3253626_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
3255646:3255662	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_050541368.1|3257254_3257857_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	4.7e-88
WP_001695586.1|3257793_3258537_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_001152632.1|3258542_3259241_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847345.1|3259240_3259570_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001695584.1|3259566_3262128_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_000459480.1|3262120_3262555_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_001695582.1|3262536_3262959_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.6e-69
WP_021539112.1|3262974_3263715_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_001695579.1|3263722_3264118_-	MFS transporter	NA	A0A0K2FIF4	Enterobacteria_phage	98.5	5.0e-70
WP_001695577.1|3264114_3264693_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752994.1|3264704_3265058_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|3265069_3265465_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_088895425.1|3266457_3267685_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_032298611.1|3267787_3268951_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	28.9	9.6e-21
WP_000389900.1|3268955_3269504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453554.1|3269567_3269762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178671.1|3270007_3270391_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190778.1|3270402_3270744_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228111.1|3270753_3271794_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_101980535.1|3272011_3272461_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557480.1|3272472_3272715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761770.1|3273004_3274756_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.6	2.2e-93
WP_000425298.1|3274752_3275052_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091145.1|3275069_3275291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3275291_3275483_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920679.1|3275482_3275668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3275660_3275858_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179577.1|3276048_3276354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049528.1|3276704_3277241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737991.1|3277310_3277538_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896725.1|3277539_3278775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_001338090.1|3279238_3279571_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_033556695.1|3279580_3280900_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.4e-233
WP_039004547.1|3280880_3282482_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.7e-308
WP_000198149.1|3282478_3282685_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_039004545.1|3282681_3284607_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453587.1|3284581_3285127_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001415975.1|3285515_3285710_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738421.1|3286071_3286365_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3286455_3286638_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135252.1|3286854_3287352_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	95.8	7.9e-89
WP_000839597.1|3287351_3287567_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000737280.1|3288139_3289237_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3289426_3289810_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3289895_3290036_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099702.1|3290032_3290395_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	3.6e-59
WP_000386641.1|3290601_3290943_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	6.2e-61
WP_001254223.1|3290945_3291122_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|3291118_3291646_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|3291642_3292083_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145926.1|3292156_3292447_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788877.1|3292443_3293145_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185516.1|3293141_3294041_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.1e-173
WP_000251069.1|3294073_3294367_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3294485_3294686_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|3294786_3295500_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708836.1|3295627_3296485_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_001317717.1|3296966_3297290_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
WP_001278766.1|3297282_3297777_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000065373.1|3298033_3298402_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|3298474_3298615_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|3298607_3298751_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|3298825_3299122_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001317715.1|3299127_3299913_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.2	4.1e-148
WP_000186851.1|3299909_3300590_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_000149532.1|3300586_3300769_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000548531.1|3300741_3300933_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001395510.1|3300943_3301225_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763363.1|3301323_3301545_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289879.1|3301541_3302090_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
WP_000789830.1|3302220_3302919_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.0	1.6e-100
WP_000545745.1|3303155_3303323_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3303362_3303581_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533645.1|3303558_3304629_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3313913:3313929	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 7
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	3755451	3829653	4946083	integrase,transposase,holin	uncultured_marine_virus(18.75%)	59	3746285:3746300	3797004:3797019
3746285:3746300	attL	TAATATCACTCTGGAT	NA	NA	NA	NA
WP_001159121.1|3755451_3757140_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	6.2e-61
WP_001362381.1|3758302_3758866_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001317642.1|3758924_3759719_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001695470.1|3759872_3760634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088435459.1|3761773_3762967_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000003133.1|3763148_3763817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370406.1|3764057_3764753_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001295802.1|3764745_3766173_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|3766183_3766903_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339603.1|3767430_3768285_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046289.1|3768510_3769836_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474088.1|3769944_3770181_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3770192_3770786_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3770945_3771815_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_130526563.1|3772063_3772921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039004091.1|3773045_3777293_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174468.1|3777858_3778710_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	8.8e-48
WP_001172276.1|3778736_3779726_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910706.1|3779756_3780650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001317639.1|3781009_3781252_+	NADH-flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_000662258.1|3781732_3781834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3782197_3782461_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3782460_3782601_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|3783684_3784227_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001352368.1|3784380_3785589_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000730984.1|3785639_3786227_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_141841274.1|3786283_3786952_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131109.1|3786977_3789503_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265664.1|3789492_3791136_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_021525526.1|3791104_3791815_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_032148604.1|3792128_3792458_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3792706_3793321_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146236.1|3793535_3793721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059463.1|3799715_3800210_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
3797004:3797019	attR	TAATATCACTCTGGAT	NA	NA	NA	NA
WP_000772639.1|3800644_3800983_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_000893310.1|3801327_3802581_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	3.7e-95
WP_001285288.1|3802592_3803696_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|3803984_3805040_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_000174685.1|3805078_3805480_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189578.1|3805537_3806782_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|3806873_3807332_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293000.1|3807592_3809050_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602135.1|3809106_3809721_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001304886.1|3809717_3810869_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	2.1e-31
WP_001059897.1|3811046_3811499_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226161.1|3811495_3812551_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207550.1|3812621_3813407_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001304888.1|3813351_3815091_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000093934.1|3815365_3816115_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225680.1|3816426_3817167_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001304889.1|3817137_3817905_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3818109_3818688_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973128.1|3818927_3821372_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532690.1|3821414_3821888_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001304891.1|3822041_3822812_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000862929.1|3824498_3825008_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088895425.1|3825364_3826592_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001352368.1|3827106_3828315_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001352368.1|3828444_3829653_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 8
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	4083781	4158233	4946083	holin,integrase,terminase,protease,portal,lysis,tRNA,tail	Enterobacteria_phage(47.27%)	83	4105342:4105357	4165524:4165539
WP_001223138.1|4083781_4084468_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4084867_4085008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4085103_4085820_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920295.1|4085878_4087231_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_141841278.1|4087288_4088713_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.6e-09
WP_001188671.1|4088712_4089402_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
WP_000875487.1|4089414_4089888_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4090098_4090968_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|4090964_4091612_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001545810.1|4091663_4092179_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068678.1|4092172_4092499_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4092588_4094526_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046743.1|4094861_4096529_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000007436.1|4096584_4096869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001317608.1|4096870_4097203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093813.1|4097294_4098527_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4098547_4099930_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132967.1|4099978_4100947_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124623.1|4101052_4101697_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105834.1|4101724_4102741_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566145.1|4102772_4103036_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4103196_4103916_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|4103995_4105219_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4105270_4106593_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
4105342:4105357	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|4106719_4107499_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143238.1|4107756_4109307_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088428.1|4109278_4110142_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563081.1|4110358_4111138_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001317607.1|4111134_4112208_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4112329_4112491_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001317606.1|4112617_4113223_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4113615_4115202_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217535.1|4115421_4115670_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000859544.1|4115777_4116350_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_000734593.1|4116346_4117168_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|4117164_4117878_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000355702.1|4118377_4118668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204579.1|4118677_4118956_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
WP_130526595.1|4118952_4121019_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	66.9	8.4e-161
WP_063269873.1|4121083_4121683_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_141841280.1|4121750_4125449_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.8	0.0e+00
WP_041498141.1|4125509_4126157_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	2.3e-112
WP_063116075.1|4126054_4126798_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
WP_001152382.1|4126803_4127502_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_000447253.1|4127511_4127841_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_063269906.1|4127840_4130906_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_032231171.1|4130877_4131207_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	6.4e-55
WP_001298500.1|4131215_4131602_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_032231172.1|4131662_4132406_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	5.6e-131
WP_063269913.1|4132416_4132818_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	4.6e-71
WP_000677102.1|4132814_4133393_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|4133404_4133680_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|4133672_4133996_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|4134082_4136110_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985957.1|4136054_4137563_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
WP_001072975.1|4137562_4137775_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_063269907.1|4137771_4139871_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.7	0.0e+00
WP_000421825.1|4139879_4140419_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001139675.1|4141091_4141244_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|4141231_4141699_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001542080.1|4141695_4142172_-	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	97.4	1.7e-85
WP_001120496.1|4142175_4142502_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000907077.1|4142902_4143652_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_125282403.1|4143667_4144012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542079.1|4144015_4144630_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	35.9	2.2e-32
WP_001205457.1|4144655_4145000_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_063269908.1|4145018_4146008_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001072669.1|4146015_4146831_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|4146993_4147389_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210170.1|4147385_4147712_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_049144297.1|4147708_4148362_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	2.4e-125
WP_072108508.1|4148361_4148856_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	7.3e-87
WP_024249647.1|4148852_4149671_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_000620698.1|4149667_4149892_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_063269909.1|4149888_4151037_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	80.4	1.1e-162
WP_000515860.1|4151033_4151585_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001557924.1|4151577_4151838_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	2.7e-40
WP_032140105.1|4151935_4152628_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	97.0	2.2e-121
WP_000135680.1|4153350_4153713_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|4153778_4154603_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008196.1|4154730_4155267_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.2	1.3e-97
WP_001105426.1|4155705_4156839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218291.1|4156997_4158233_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.6e-234
4165524:4165539	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 9
NZ_CP041304	Escherichia coli strain MSHS 133 chromosome, complete genome	4946083	4374643	4423403	4946083	integrase,transposase,terminase	uncultured_marine_virus(22.22%)	42	4370860:4370875	4393465:4393480
4370860:4370875	attL	CGGTGAAAAGCAGATT	NA	NA	NA	NA
WP_001218810.1|4374643_4375906_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	5.3e-81
WP_000344091.1|4376357_4379873_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_141841289.1|4379981_4381481_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_141841311.1|4381662_4382403_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001274542.1|4383015_4384665_+	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
WP_000283233.1|4384669_4385995_+	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
WP_000114120.1|4385975_4391030_+	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_001327223.1|4391067_4391586_+	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_000071509.1|4391586_4391892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533805.1|4391940_4392747_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000937304.1|4392805_4393162_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_000905895.1|4393161_4395162_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
4393465:4393480	attR	AATCTGCTTTTCACCG	NA	NA	NA	NA
WP_000041168.1|4395151_4396786_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
WP_000179014.1|4396782_4397868_-	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
WP_000258195.1|4398330_4398504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166952.1|4398500_4398845_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	38.4	3.1e-07
WP_001167422.1|4398863_4399412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831911.1|4399499_4399658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|4399654_4399891_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991584.1|4399959_4400535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|4401364_4402573_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|4402938_4404144_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|4404587_4404908_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|4404900_4405287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|4405294_4405981_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|4405958_4406582_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|4406663_4407869_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|4407981_4408575_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|4409088_4410297_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001611300.1|4410366_4410504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|4413260_4414422_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000902464.1|4414559_4415351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900255.1|4415421_4416243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609859.1|4416280_4416730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4417063_4418044_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000387046.1|4418178_4418730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609855.1|4418915_4419719_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
WP_001617303.1|4420369_4420717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218942.1|4420995_4421772_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072164.1|4421774_4422278_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000538703.1|4422481_4422964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906543.1|4422908_4423403_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
>prophage 1
NZ_CP041303	Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence	157660	22318	88631	157660	protease,transposase,integrase	Macacine_betaherpesvirus(16.67%)	39	44017:44076	55223:56004
WP_000016970.1|22318_23125_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|23125_23431_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|23432_23651_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|24210_24441_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|24437_24854_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|24928_26494_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|26478_27501_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000973521.1|28966_31168_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|31249_32527_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|32523_34266_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011908.1|34265_35213_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|35213_36938_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|37073_38267_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|38646_39027_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|40269_41127_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|41123_41981_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|41977_42805_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949005.1|42804_43719_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
44017:44076	attL	ATCGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGT	NA	NA	NA	NA
WP_001312823.1|45056_45215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280980.1|46487_47441_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771476.1|47873_48983_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001312822.1|49051_49954_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_032146390.1|50328_50517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066941.1|50637_51378_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361612.1|51656_52634_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_000928805.1|56544_57732_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	54.7	7.8e-10
55223:56004	attR	ACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCGATTTTCCGATTCGTTTGGGGATAACCCACCGTTATATTCGTGCGGTCTTAGTGCGCTGTAATATCCAACGATATAGACCGTTATGGCGTGAGCGGCCTCGCAGAAGCTTCGTAACCCACCACCGGCATCCATTCGTTCTTCAGACTCCTGAAGAAGCGTTCCATTGGGCTGTTATCCCAGCAGTTTCCGCGCCGGCTCATACTCTGCCTGATCTGGTATCGCCACAATAACTGCCGGAACTGCCTGCTCGTATCGCTGTGGAACATCACCCCGCCGGGCTTACCCGTCCAGATATAGGTCACATCACCGCACCACACCTGTATAGCGGCGTAATCCCCAAAAACGATGCTGGTTGTCAGTAAACAAGCCATGAATGACAGTCGTTCCTGAAATCATAAGACCTGGAGGAGTGTATGCTCCGTCGCAGTAATTACCACGATACGCTTGCAGAATTTTTTCCAGTTACTGAAGCGTGAACGGATAAAGAAAAAGCTCTTCGGAACGCGGGAAGACGCCTCCAACGATATTTTTGAACATCGAAATGTTTTATAACAATAAGCGTCGGCATGGTTCCTGCGAACAGATGTCAACAATAGAATATAAAAACAATTATTATCAACAACTTGGAAGGAGTAAGACTACCCGTGGCGATTCAATATTAGATCATTGATGGAGATATAAATGGCTCACTTTTTATCGGTTGTTGACGATACGTTTATCAAGT	NA	NA	NA	NA
WP_000733250.1|57728_59669_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_141841187.1|59672_61043_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974760.1|62616_63558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450492.1|65820_67014_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000738422.1|68043_68337_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001352368.1|69066_70275_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001318220.1|72819_73935_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001318221.1|74074_77734_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_000271277.1|79150_80107_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001259003.1|80151_82329_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	32.5	5.6e-06
WP_000076221.1|82632_82893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021531208.1|84353_85838_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_088895425.1|87403_88631_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
